Starting /dee2/code/volunteer_pipeline.sh SRR13857051 current disk space = 3052425678848 free memory = 1505268268 SRR13857051 SRAfilesize df92964623b793030a1d1042ae67daa5 SRR13857051.sra SRR13857051.sra file validated SRR13857051 is paired end SRR13857051 is conventional basespace SRR13857051 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857051_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.835 32.0 32.0 32.0 2.0 32.0 2 31.405 32.0 32.0 32.0 32.0 32.0 3 34.59125 37.0 32.0 37.0 32.0 37.0 4 35.67875 37.0 37.0 37.0 32.0 37.0 5 36.1025 37.0 37.0 37.0 32.0 37.0 6 39.37925 41.0 41.0 41.0 37.0 41.0 7 39.608 41.0 41.0 41.0 37.0 41.0 8 39.36925 41.0 41.0 41.0 37.0 41.0 9 39.49175 41.0 41.0 41.0 37.0 41.0 10-14 39.47475 41.0 41.0 41.0 37.0 41.0 15-19 39.3657 41.0 41.0 41.0 37.0 41.0 20-24 39.208749999999995 41.0 41.0 41.0 37.0 41.0 25-29 38.93365 41.0 41.0 41.0 35.0 41.0 30-34 38.527899999999995 41.0 40.2 41.0 32.0 41.0 35-39 38.649150000000006 41.0 41.0 41.0 32.0 41.0 40-44 38.5344 41.0 41.0 41.0 32.0 41.0 45-49 38.2286 41.0 40.2 41.0 32.0 41.0 50-54 38.189800000000005 41.0 41.0 41.0 31.0 41.0 55-59 38.01195 41.0 39.4 41.0 29.0 41.0 60-64 37.712599999999995 41.0 37.0 41.0 27.0 41.0 65-69 37.50255 41.0 37.0 41.0 27.0 41.0 70-74 37.4434 41.0 37.0 41.0 27.0 41.0 75-79 36.989999999999995 41.0 37.0 41.0 26.0 41.0 80-84 37.391450000000006 41.0 37.0 41.0 26.0 41.0 85-89 37.432900000000004 41.0 37.0 41.0 27.0 41.0 90-94 37.11755 41.0 37.0 41.0 24.0 41.0 95-99 36.9564 41.0 37.0 41.0 23.0 41.0 100-104 36.76805 41.0 37.0 41.0 22.0 41.0 105-109 36.92335 41.0 37.0 41.0 22.0 41.0 110-114 36.554050000000004 41.0 37.0 41.0 22.0 41.0 115-119 36.227349999999994 41.0 37.0 41.0 22.0 41.0 120-124 36.0214 41.0 37.0 41.0 22.0 41.0 125-129 35.7103 41.0 36.0 41.0 18.0 41.0 130-134 35.5108 41.0 35.0 41.0 14.0 41.0 135-139 35.0184 41.0 32.0 41.0 12.0 41.0 140-144 34.8899 41.0 32.0 41.0 12.0 41.0 145-149 34.38705 41.0 32.0 41.0 12.0 41.0 150 34.23225 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 6.0 23 32.0 24 68.0 25 87.0 26 76.0 27 98.0 28 72.0 29 99.0 30 87.0 31 88.0 32 92.0 33 97.0 34 109.0 35 136.0 36 129.0 37 171.0 38 222.0 39 369.0 40 1962.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.852664576802509 28.156169848959816 17.01339412938159 41.97777144485608 2 14.95 25.174999999999997 44.625 15.25 3 16.175 29.099999999999998 32.75 21.975 4 17.375 25.775 34.825 22.025 5 24.9 27.6 29.2 18.3 6 20.05 26.924999999999997 34.050000000000004 18.975 7 24.9 27.075 28.249999999999996 19.775000000000002 8 16.25 26.025 37.9 19.825 9 19.825 23.7 36.325 20.150000000000002 10-14 22.439999999999998 27.16 29.475 20.925 15-19 22.55 26.845000000000002 28.13 22.475 20-24 22.065 27.060000000000002 28.549999999999997 22.325 25-29 21.645 27.055 28.79 22.509999999999998 30-34 22.275 28.084999999999997 27.474999999999998 22.165000000000003 35-39 22.32 27.675 27.584999999999997 22.42 40-44 21.985 28.32 27.57 22.125 45-49 21.959999999999997 28.285 27.025 22.73 50-54 21.84 27.794999999999998 27.705000000000002 22.66 55-59 22.195 27.345000000000002 27.76 22.7 60-64 21.834999999999997 27.32 27.61 23.235 65-69 21.634999999999998 27.939999999999998 27.725 22.7 70-74 21.895 28.494999999999997 27.694999999999997 21.915000000000003 75-79 21.39 27.975 27.544999999999998 23.09 80-84 21.565 28.735 27.125 22.575 85-89 21.634999999999998 28.685 26.875 22.805 90-94 21.515 28.535 27.315 22.634999999999998 95-99 22.225 28.49 26.705000000000002 22.58 100-104 21.92328849327399 28.649297394609192 26.8740311046657 22.553383007451117 105-109 21.735 28.02 27.555000000000003 22.689999999999998 110-114 21.77608880444022 28.23641182059103 27.071353567678386 22.916145807290363 115-119 21.68608430421521 28.606430321516076 26.97134856742837 22.736136806840342 120-124 22.330582645661416 27.666916729182294 27.46686671667917 22.535633908477116 125-129 22.685 28.235 26.900000000000002 22.18 130-134 22.0 28.835 27.115000000000002 22.05 135-139 21.951585475642695 28.608582574772434 27.253175952785835 22.18665599679904 140-144 21.75 29.5 26.61 22.14 145-149 22.805 29.630000000000003 25.755 21.81 150 22.925 31.05 23.849999999999998 22.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 4.0 3 6.5 4 6.0 5 2.5 6 0.0 7 1.0 8 1.5 9 1.0 10 0.5 11 0.0 12 1.0 13 2.0 14 3.0 15 5.5 16 5.0 17 8.0 18 10.5 19 9.0 20 8.0 21 9.5 22 13.0 23 14.5 24 16.5 25 19.5 26 22.0 27 28.5 28 34.0 29 47.0 30 59.5 31 60.0 32 63.5 33 71.5 34 72.0 35 85.5 36 103.0 37 110.0 38 124.5 39 116.5 40 126.0 41 158.0 42 164.0 43 164.0 44 200.0 45 212.0 46 166.0 47 145.5 48 154.5 49 158.0 50 150.0 51 128.0 52 108.0 53 98.5 54 84.0 55 79.0 56 81.5 57 71.0 58 62.0 59 54.0 60 49.5 61 43.0 62 36.0 63 37.5 64 25.5 65 15.5 66 15.0 67 15.0 68 14.0 69 8.0 70 4.5 71 3.5 72 2.5 73 2.5 74 1.5 75 1.0 76 3.5 77 4.5 78 4.0 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.005 115-119 0.005 120-124 0.025 125-129 0.0 130-134 0.0 135-139 0.03 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 92.3812124522119 84.575 2 6.335335882031677 11.600000000000001 3 0.9830693610049154 2.7 4 0.2730748225013654 1.0 5 0.027307482250136534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTGTTTGAGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.35000000000000003 0.0 0.0 0.0 0.0 136-137 1.3875000000000002 0.0 0.0 0.0 0.0 138 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTGT 25 5.929791E-6 115.09999 2 CTTTGTG 25 5.228295E-4 98.65714 1 TGTGTTT 35 3.154752E-5 82.214294 4 GTGTTTG 45 1.0964131E-4 63.944447 5 TGTTTGA 45 1.0964131E-4 63.944447 6 GTTTGAG 35 0.0034162651 61.660717 7 TTGTGTT 50 1.846738E-4 57.549995 3 >>END_MODULE SRR13857051 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13857051_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.385 27.0 2.0 32.0 2.0 32.0 2 31.215 32.0 32.0 32.0 32.0 32.0 3 32.42 32.0 32.0 37.0 32.0 37.0 4 33.62125 37.0 32.0 37.0 27.0 37.0 5 35.0375 37.0 37.0 37.0 27.0 37.0 6 37.98 41.0 37.0 41.0 32.0 41.0 7 38.40875 41.0 37.0 41.0 32.0 41.0 8 38.842 41.0 41.0 41.0 37.0 41.0 9 38.48 41.0 41.0 41.0 32.0 41.0 10-14 38.65105 41.0 41.0 41.0 32.0 41.0 15-19 38.6863 41.0 41.0 41.0 33.0 41.0 20-24 38.58675 41.0 41.0 41.0 33.0 41.0 25-29 38.502449999999996 41.0 40.2 41.0 32.0 41.0 30-34 38.32005 41.0 39.4 41.0 32.0 41.0 35-39 38.45865 41.0 38.6 41.0 32.0 41.0 40-44 37.91590000000001 41.0 37.0 41.0 30.0 41.0 45-49 37.7472 41.0 37.0 41.0 29.0 41.0 50-54 37.649 41.0 37.0 41.0 28.0 41.0 55-59 37.584950000000006 41.0 37.0 41.0 27.0 41.0 60-64 37.294650000000004 41.0 37.0 41.0 27.0 41.0 65-69 37.380250000000004 41.0 37.0 41.0 27.0 41.0 70-74 37.0746 41.0 37.0 41.0 26.0 41.0 75-79 36.1545 40.2 35.0 41.0 24.0 41.0 80-84 36.84755 41.0 37.0 41.0 26.0 41.0 85-89 36.6843 41.0 37.0 41.0 23.0 41.0 90-94 36.48950000000001 41.0 37.0 41.0 22.0 41.0 95-99 36.01165 41.0 37.0 41.0 22.0 41.0 100-104 35.258100000000006 41.0 32.0 41.0 20.0 41.0 105-109 35.2254 41.0 32.0 41.0 22.0 41.0 110-114 34.82155 41.0 32.0 41.0 14.0 41.0 115-119 34.334950000000006 41.0 32.0 41.0 12.0 41.0 120-124 33.823750000000004 40.2 31.0 41.0 12.0 41.0 125-129 33.52085 39.4 27.0 41.0 12.0 41.0 130-134 32.7719 37.0 27.0 41.0 12.0 41.0 135-139 32.4365 37.0 27.0 41.0 12.0 41.0 140-144 31.8996 37.0 27.0 41.0 12.0 41.0 145-149 31.3761 37.0 25.0 41.0 12.0 41.0 150 30.4665 37.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 6.0 23 46.0 24 42.0 25 79.0 26 103.0 27 98.0 28 127.0 29 137.0 30 132.0 31 147.0 32 134.0 33 173.0 34 173.0 35 192.0 36 192.0 37 257.0 38 330.0 39 553.0 40 1079.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.332563510392609 29.838337182448036 16.21247113163972 41.61662817551963 2 14.799999999999999 24.925 45.9 14.374999999999998 3 16.625 27.625 33.900000000000006 21.85 4 18.55 25.15 35.925000000000004 20.375 5 26.150000000000002 25.775 30.475 17.599999999999998 6 19.725 26.575 34.300000000000004 19.400000000000002 7 24.6 27.55 28.15 19.7 8 17.299999999999997 24.175 40.175 18.35 9 20.549999999999997 23.275000000000002 36.65 19.525000000000002 10-14 22.025 27.57 29.304999999999996 21.099999999999998 15-19 22.485 26.515 29.185 21.815 20-24 22.23 26.884999999999998 29.275000000000002 21.61 25-29 21.73 27.060000000000002 29.92 21.29 30-34 22.57 26.72 29.475 21.235 35-39 22.355 26.939999999999998 29.425 21.279999999999998 40-44 23.369999999999997 27.375 28.205000000000002 21.05 45-49 23.015 27.075 28.405 21.505 50-54 22.900000000000002 26.355 28.845 21.9 55-59 22.46 26.07 29.765000000000004 21.705 60-64 22.314999999999998 26.07 29.805 21.81 65-69 22.439999999999998 26.119999999999997 29.86 21.58 70-74 22.835 26.39 29.69 21.085 75-79 22.634999999999998 25.855 30.125 21.385 80-84 22.365 26.834999999999997 29.5 21.3 85-89 21.97 26.950000000000003 29.4 21.68 90-94 22.225 27.250000000000004 28.65 21.875 95-99 22.56 26.6 29.225 21.615000000000002 100-104 22.400000000000002 26.924999999999997 29.335 21.34 105-109 21.834999999999997 26.325 29.65 22.189999999999998 110-114 22.075 25.83 30.585 21.51 115-119 22.45 26.21 29.755 21.584999999999997 120-124 22.045 26.419999999999998 29.45 22.085 125-129 21.855 26.605 29.565 21.975 130-134 22.055 26.834999999999997 29.549999999999997 21.560000000000002 135-139 22.1 26.645000000000003 29.625 21.63 140-144 22.43 27.389999999999997 29.48 20.7 145-149 22.895 27.325 28.810000000000002 20.97 150 22.625 27.6 27.325 22.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.5 2 4.0 3 4.0 4 4.5 5 5.0 6 3.5 7 2.0 8 2.0 9 4.5 10 5.5 11 5.0 12 5.0 13 4.5 14 6.0 15 8.0 16 8.5 17 8.5 18 8.5 19 8.0 20 9.5 21 14.0 22 14.0 23 13.5 24 17.5 25 23.0 26 27.5 27 26.0 28 33.5 29 42.5 30 48.5 31 63.0 32 67.5 33 68.5 34 79.0 35 93.0 36 103.0 37 113.0 38 118.0 39 129.5 40 150.5 41 151.5 42 164.0 43 181.0 44 208.0 45 204.5 46 162.0 47 155.5 48 158.0 49 158.5 50 132.0 51 99.5 52 99.5 53 94.5 54 79.5 55 76.0 56 79.0 57 74.0 58 65.0 59 59.0 60 43.0 61 29.5 62 29.5 63 30.0 64 24.0 65 17.5 66 11.5 67 9.5 68 9.5 69 7.0 70 8.5 71 6.5 72 3.0 73 3.5 74 4.0 75 2.0 76 1.5 77 3.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content fail #Base N-Count 1 45.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 94.78973816450674 89.60000000000001 2 4.892885480031738 9.25 3 0.26448029621793173 0.75 4 0.026448029621793177 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026448029621793177 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGTGTTTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATA 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.15 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.47500000000000003 0.0 0.0 0.0 0.0 136-137 1.5125000000000002 0.0 0.0 0.0 0.0 138 1.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420949 spots for SRR13857051.sra Written 1420949 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra Read 1420944 spots for SRR13857051.sra Written 1420944 spots for SRR13857051.sra SRR ids: ['SRR13857051.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1jcjycyp SRR13857051.sra spots: 28418885 blocks: [[1, 1420944], [1420945, 2841888], [2841889, 4262832], [4262833, 5683776], [5683777, 7104720], [7104721, 8525664], [8525665, 9946608], [9946609, 11367552], [11367553, 12788496], [12788497, 14209440], [14209441, 15630384], [15630385, 17051328], [17051329, 18472272], [18472273, 19893216], [19893217, 21314160], [21314161, 22735104], [22735105, 24156048], [24156049, 25576992], [25576993, 26997936], [26997937, 28418885]] SRR13857051 file size 9580774 SRR13857051 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13857051 SRR13857051_1.fastq SRR13857051_2.fastq Input file: SRR13857051_1.fastq Paired file: SRR13857051_2.fastq trimmed: SRR13857051-trimmed-pair1.fastq, SRR13857051-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:17:35 2025 >> started Tue Feb 11 22:18:07 2025 >> done (31.252s) 28418885 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 39 ( 0.00%) empty read pairs filtered out after trimming by size control 28418829 (100.00%) read pairs available; of these: 3524466 (12.40%) trimmed read pairs available after processing 24894363 (87.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 4 0.00% 24 11 0.00% 25 15 0.00% 26 16 0.00% 27 10 0.00% 28 12 0.00% 29 19 0.00% 30 25 0.00% 31 16 0.00% 32 12 0.00% 33 31 0.00% 34 21 0.00% 35 23 0.00% 36 23 0.00% 37 23 0.00% 38 33 0.00% 39 40 0.00% 40 23 0.00% 41 44 0.00% 42 30 0.00% 43 43 0.00% 44 33 0.00% 45 60 0.00% 46 36 0.00% 47 65 0.00% 48 55 0.00% 49 51 0.00% 50 63 0.00% 51 119 0.00% 52 93 0.00% 53 95 0.00% 54 75 0.00% 55 100 0.00% 56 100 0.00% 57 115 0.00% 58 100 0.00% 59 147 0.00% 60 88 0.00% 61 150 0.00% 62 122 0.00% 63 225 0.00% 64 133 0.00% 65 234 0.00% 66 183 0.00% 67 275 0.00% 68 248 0.00% 69 169 0.00% 70 234 0.00% 71 182 0.00% 72 535 0.00% 73 258 0.00% 74 184 0.00% 75 194 0.00% 76 162 0.00% 77 174 0.00% 78 165 0.00% 79 193 0.00% 80 167 0.00% 81 182 0.00% 82 149 0.00% 83 215 0.00% 84 173 0.00% 85 159 0.00% 86 155 0.00% 87 202 0.00% 88 219 0.00% 89 167 0.00% 90 170 0.00% 91 259 0.00% 92 137 0.00% 93 162 0.00% 94 128 0.00% 95 142 0.00% 96 195 0.00% 97 172 0.00% 98 183 0.00% 99 158 0.00% 100 169 0.00% 101 155 0.00% 102 139 0.00% 103 155 0.00% 104 149 0.00% 105 157 0.00% 106 140 0.00% 107 168 0.00% 108 176 0.00% 109 199 0.00% 110 187 0.00% 111 231 0.00% 112 203 0.00% 113 230 0.00% 114 228 0.00% 115 204 0.00% 116 247 0.00% 117 278 0.00% 118 266 0.00% 119 345 0.00% 120 326 0.00% 121 358 0.00% 122 434 0.00% 123 416 0.00% 124 447 0.00% 125 502 0.00% 126 540 0.00% 127 505 0.00% 128 518 0.00% 129 602 0.00% 130 518 0.00% 131 512 0.00% 132 532 0.00% 133 1397 0.00% 134 125958 0.44% 135 132982 0.47% 136 134210 0.47% 137 138234 0.49% 138 142437 0.50% 139 150300 0.53% 140 148297 0.52% 141 156127 0.55% 142 155150 0.55% 143 162629 0.57% 144 163156 0.57% 145 167733 0.59% 146 171383 0.60% 147 184284 0.65% 148 254628 0.90% 149 1115922 3.93% 150 24894363 87.60% 28418829 reads passed initial QC criterion=sequence-density sequence-density=3.18 sequence-density-rank=1 fanout-score=1.08 fanout-score-rank=37 prefix-density=1.56 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=77.09 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=1.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=7.77 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=40 prefix-density=11.34 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.47 sequence-density-rank=33 fanout-score=51.84 fanout-score-rank=1 prefix-density=13.29 prefix-fanout=1.8 sequence=TTGTGTTTGATA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TTTGTGTTTGAG -y TTTGTGTTTGAG -o SRR13857051 SRR13857051_1.fastq SRR13857051_2.fastq Input file: SRR13857051_1.fastq Paired file: SRR13857051_2.fastq trimmed: SRR13857051-trimmed-pair1.fastq, SRR13857051-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TTTGTGTTTGAG -- paired 3' end adapter sequence (-y): TTTGTGTTTGAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:20:44 2025 >> started Tue Feb 11 22:21:04 2025 >> done (19.784s) 18945886 read pairs processed; of these: 119093 ( 0.63%) short read pairs filtered out after trimming by size control 93253 ( 0.49%) empty read pairs filtered out after trimming by size control 18733540 (98.88%) read pairs available; of these: 9139 ( 0.05%) trimmed read pairs available after processing 18724401 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 7 0.00% 25 10 0.00% 26 11 0.00% 27 7 0.00% 28 11 0.00% 29 12 0.00% 30 14 0.00% 31 10 0.00% 32 9 0.00% 33 20 0.00% 34 17 0.00% 35 17 0.00% 36 15 0.00% 37 18 0.00% 38 25 0.00% 39 24 0.00% 40 16 0.00% 41 27 0.00% 42 21 0.00% 43 29 0.00% 44 25 0.00% 45 41 0.00% 46 27 0.00% 47 41 0.00% 48 35 0.00% 49 38 0.00% 50 44 0.00% 51 78 0.00% 52 66 0.00% 53 61 0.00% 54 39 0.00% 55 66 0.00% 56 68 0.00% 57 72 0.00% 58 75 0.00% 59 87 0.00% 60 57 0.00% 61 101 0.00% 62 87 0.00% 63 155 0.00% 64 84 0.00% 65 158 0.00% 66 117 0.00% 67 183 0.00% 68 175 0.00% 69 112 0.00% 70 148 0.00% 71 113 0.00% 72 369 0.00% 73 169 0.00% 74 109 0.00% 75 132 0.00% 76 113 0.00% 77 109 0.00% 78 114 0.00% 79 125 0.00% 80 115 0.00% 81 107 0.00% 82 91 0.00% 83 129 0.00% 84 116 0.00% 85 102 0.00% 86 102 0.00% 87 136 0.00% 88 143 0.00% 89 115 0.00% 90 112 0.00% 91 175 0.00% 92 98 0.00% 93 110 0.00% 94 83 0.00% 95 85 0.00% 96 118 0.00% 97 120 0.00% 98 115 0.00% 99 102 0.00% 100 102 0.00% 101 119 0.00% 102 100 0.00% 103 109 0.00% 104 99 0.00% 105 102 0.00% 106 92 0.00% 107 110 0.00% 108 127 0.00% 109 139 0.00% 110 126 0.00% 111 153 0.00% 112 142 0.00% 113 166 0.00% 114 142 0.00% 115 133 0.00% 116 153 0.00% 117 187 0.00% 118 169 0.00% 119 218 0.00% 120 215 0.00% 121 249 0.00% 122 300 0.00% 123 283 0.00% 124 301 0.00% 125 327 0.00% 126 348 0.00% 127 315 0.00% 128 336 0.00% 129 407 0.00% 130 345 0.00% 131 346 0.00% 132 381 0.00% 133 954 0.01% 134 83461 0.45% 135 87669 0.47% 136 88368 0.47% 137 91098 0.49% 138 94007 0.50% 139 99164 0.53% 140 97760 0.52% 141 102914 0.55% 142 102168 0.55% 143 107397 0.57% 144 107415 0.57% 145 110751 0.59% 146 116403 0.62% 147 124266 0.66% 148 169979 0.91% 149 728624 3.89% 150 16408096 87.59% criterion=sequence-density sequence-density=2.74 sequence-density-rank=1 fanout-score=1.07 fanout-score-rank=36 prefix-density=1.58 prefix-fanout=1.1 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=70.18 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=1.5 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCTGGGCATTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTT criterion=sequence-density sequence-density=7.07 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=42 prefix-density=11.34 prefix-fanout=1.5 sequence=TTTGTGTTTGAG criterion=fanout-score sequence-density=0.46 sequence-density-rank=32 fanout-score=53.98 fanout-score-rank=1 prefix-density=13.33 prefix-fanout=1.9 sequence=TTGTGTTTGATA SRR13857051 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 22:43:39 Started mapping on | Feb 11 22:43:39 Finished on | Feb 11 22:51:25 Mapping speed, Million of reads per hour | 217.90 Number of input reads | 28206201 Average input read length | 278 UNIQUE READS: Uniquely mapped reads number | 12492683 Uniquely mapped reads % | 44.29% Average mapped length | 265.50 Number of splices: Total | 5408605 Number of splices: Annotated (sjdb) | 5186180 Number of splices: GT/AG | 5238329 Number of splices: GC/AG | 71408 Number of splices: AT/AC | 10164 Number of splices: Non-canonical | 88704 Mismatch rate per base, % | 0.82% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.02% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 737818 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 7956155 % of reads mapped to too many loci | 28.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.92% % of reads unmapped: other | 6.97% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 14975715 14975715 14975715 N_multimapping 737818 737818 737818 N_noFeature 3770979 8425770 7737759 N_ambiguous 208753 52644 56444 UnstrandedReadsAssigned:8512951 PositiveStrandReadsAssigned:4014269 NegativeStrandReadsAssigned:4698480 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR13857051 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR13857051-trimmed-pair1.fastq SRR13857051-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,206,201 reads, 20,734,751 reads pseudoaligned [quant] estimated average fragment length: 178.369 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR13857051.ke.tsv 34699 SRR13857051.se.tsv 87100 total ==> SRR13857051.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1840.63 784.584 13.5936 Potri.005G024800.1.v4.1 1035 857.631 52 1.9336 Potri.004G059700.1.v4.1 961 783.631 22 0.895311 Potri.007G009000.2.v4.1 1416 1238.63 0 0 Potri.003G141000.2.v4.1 2943 2765.63 261.448 3.01477 Potri.016G087400.1.v4.1 270 104.713 539 164.153 Potri.015G069301.1.v4.1 564 386.719 0 0 Potri.010G195200.1.v4.1 1773 1595.63 0 0 Potri.012G127500.1.v4.1 977 799.631 88 3.50959 ==> SRR13857051.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 150 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 121 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR13857051 completed mapping pipeline successfully