Starting /dee2/code/volunteer_pipeline.sh SRR14040098 current disk space = 3049654800384 free memory = 1581237632 SRR14040098 SRAfilesize bf9ba9f1ea5118f55b883c793e8e5cf5 SRR14040098.sra SRR14040098.sra file validated SRR14040098 is paired end SRR14040098 is conventional basespace SRR14040098 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040098_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.138 37.0 37.0 37.0 37.0 37.0 2 36.286 37.0 37.0 37.0 37.0 37.0 3 36.381 37.0 37.0 37.0 37.0 37.0 4 36.4275 37.0 37.0 37.0 37.0 37.0 5 36.488 37.0 37.0 37.0 37.0 37.0 6 36.465 37.0 37.0 37.0 37.0 37.0 7 36.409 37.0 37.0 37.0 37.0 37.0 8 36.4415 37.0 37.0 37.0 37.0 37.0 9 36.474 37.0 37.0 37.0 37.0 37.0 10-14 36.4413 37.0 37.0 37.0 37.0 37.0 15-19 36.3911 37.0 37.0 37.0 37.0 37.0 20-24 36.3022 37.0 37.0 37.0 37.0 37.0 25-29 36.250600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.206 37.0 37.0 37.0 37.0 37.0 35-39 36.22 37.0 37.0 37.0 37.0 37.0 40-44 36.1308 37.0 37.0 37.0 37.0 37.0 45-49 36.025099999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.9332 37.0 37.0 37.0 37.0 37.0 55-59 35.873000000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.836299999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.7249 37.0 37.0 37.0 37.0 37.0 70-74 35.75750000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.803000000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.7762 37.0 37.0 37.0 37.0 37.0 85-89 35.73350000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.6947 37.0 37.0 37.0 37.0 37.0 95-99 35.6676 37.0 37.0 37.0 37.0 37.0 100-104 35.627500000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.571 37.0 37.0 37.0 37.0 37.0 110-114 35.54899999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.418000000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.250600000000006 37.0 37.0 37.0 34.6 37.0 125-129 35.2442 37.0 37.0 37.0 32.2 37.0 130-134 35.0978 37.0 37.0 37.0 27.4 37.0 135-139 35.0179 37.0 37.0 37.0 25.0 37.0 140-144 35.0142 37.0 37.0 37.0 27.4 37.0 145-149 34.823 37.0 37.0 37.0 25.0 37.0 150 34.848 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 1.0 24 10.0 25 11.0 26 23.0 27 23.0 28 25.0 29 42.0 30 70.0 31 59.0 32 94.0 33 164.0 34 170.0 35 377.0 36 2623.0 37 305.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.375 15.85 13.775 33.0 2 21.125 21.475 34.0 23.400000000000002 3 22.925 22.7 29.049999999999997 25.324999999999996 4 25.35 27.675 21.325 25.650000000000002 5 27.925 29.825000000000003 23.400000000000002 18.85 6 21.0 35.699999999999996 24.375 18.925 7 18.025 21.7 40.699999999999996 19.575 8 19.675 24.474999999999998 29.799999999999997 26.05 9 21.6 24.375 30.3 23.724999999999998 10-14 21.445 29.970000000000002 26.229999999999997 22.355 15-19 21.645 27.61 27.915 22.830000000000002 20-24 22.16 28.360000000000003 26.875 22.605 25-29 21.895 28.050000000000004 27.665 22.39 30-34 22.34 27.755000000000003 27.37 22.535 35-39 21.42 27.965 27.16 23.455000000000002 40-44 22.384999999999998 28.549999999999997 26.8 22.264999999999997 45-49 22.775000000000002 27.605 27.015 22.605 50-54 22.975 27.505000000000003 27.05 22.470000000000002 55-59 23.04 27.439999999999998 27.02 22.5 60-64 23.09 28.435 26.19 22.285 65-69 22.54 27.93 27.235 22.295 70-74 23.150000000000002 27.950000000000003 26.669999999999998 22.23 75-79 23.445 27.525 26.865 22.165000000000003 80-84 23.150000000000002 27.1 27.495000000000005 22.255 85-89 23.080000000000002 27.46 26.584999999999997 22.875 90-94 23.255 27.67 26.889999999999997 22.185 95-99 23.525 27.48 27.095000000000002 21.9 100-104 23.54 27.68 26.979999999999997 21.8 105-109 23.965 26.685 26.939999999999998 22.41 110-114 23.630000000000003 27.265 26.884999999999998 22.220000000000002 115-119 23.28 27.584999999999997 27.165 21.97 120-124 23.990000000000002 27.644999999999996 26.325 22.040000000000003 125-129 23.43 27.455000000000002 26.634999999999998 22.48 130-134 24.03 27.255000000000003 26.41 22.305 135-139 24.07 27.145000000000003 26.355 22.43 140-144 24.112411241124114 27.39273927392739 26.072607260726073 22.422242224222423 145-149 23.705000000000002 27.415 26.465 22.415 150 24.7 26.35 25.775 23.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 2.0 26 2.5 27 5.0 28 8.5 29 12.5 30 14.5 31 14.5 32 22.5 33 31.5 34 42.0 35 54.0 36 72.5 37 89.5 38 111.5 39 139.5 40 164.0 41 194.0 42 223.5 43 250.5 44 264.5 45 259.5 46 267.0 47 281.5 48 262.5 49 227.5 50 185.5 51 143.0 52 125.0 53 105.0 54 82.5 55 71.5 56 54.5 57 38.0 58 28.0 59 21.5 60 16.5 61 18.0 62 14.0 63 6.0 64 5.0 65 5.0 66 4.5 67 3.5 68 3.0 69 3.0 70 2.0 71 1.0 72 2.0 73 3.5 74 5.0 75 6.0 76 8.0 77 10.0 78 6.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.49407114624506 90.60000000000001 2 4.163372859025033 7.9 3 0.2898550724637681 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.052700922266139656 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTAACGAATCTCGGGT 15 0.375 TruSeq Adapter, Index 6 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTAACGAATCTCGGGG 12 0.3 TruSeq Adapter, Index 6 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.4500000000000002 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 3.975 0.0 0.0 0.0 0.0 136-137 4.1875 0.0 0.0 0.0 0.0 138 4.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCATC 10 0.006973645 144.0 2 TCGAGAA 10 0.006973645 144.0 7 TTTTTTT 65 0.007995365 13.292308 95-99 >>END_MODULE SRR14040098 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040098_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.085 37.0 37.0 37.0 37.0 37.0 2 36.0315 37.0 37.0 37.0 37.0 37.0 3 36.154 37.0 37.0 37.0 37.0 37.0 4 36.09 37.0 37.0 37.0 37.0 37.0 5 36.1905 37.0 37.0 37.0 37.0 37.0 6 36.055 37.0 37.0 37.0 37.0 37.0 7 36.011 37.0 37.0 37.0 37.0 37.0 8 36.076 37.0 37.0 37.0 37.0 37.0 9 36.0405 37.0 37.0 37.0 37.0 37.0 10-14 36.0548 37.0 37.0 37.0 37.0 37.0 15-19 36.0858 37.0 37.0 37.0 37.0 37.0 20-24 36.0598 37.0 37.0 37.0 37.0 37.0 25-29 35.9679 37.0 37.0 37.0 37.0 37.0 30-34 35.8718 37.0 37.0 37.0 37.0 37.0 35-39 35.8737 37.0 37.0 37.0 37.0 37.0 40-44 35.851800000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.752300000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.6819 37.0 37.0 37.0 37.0 37.0 55-59 35.761700000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.659099999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.66029999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.575900000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.4936 37.0 37.0 37.0 37.0 37.0 80-84 35.5391 37.0 37.0 37.0 37.0 37.0 85-89 35.555099999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.55120000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.532500000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.533699999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.4013 37.0 37.0 37.0 37.0 37.0 110-114 35.4255 37.0 37.0 37.0 37.0 37.0 115-119 35.3908 37.0 37.0 37.0 37.0 37.0 120-124 35.23650000000001 37.0 37.0 37.0 34.6 37.0 125-129 35.180899999999994 37.0 37.0 37.0 29.8 37.0 130-134 35.1605 37.0 37.0 37.0 32.2 37.0 135-139 35.1093 37.0 37.0 37.0 29.8 37.0 140-144 34.97619999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.996500000000005 37.0 37.0 37.0 25.0 37.0 150 34.8085 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 7.0 17 5.0 18 7.0 19 7.0 20 9.0 21 12.0 22 14.0 23 14.0 24 18.0 25 16.0 26 22.0 27 15.0 28 26.0 29 35.0 30 36.0 31 44.0 32 60.0 33 96.0 34 143.0 35 421.0 36 2661.0 37 329.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.449999999999996 16.875 14.399999999999999 32.275 2 22.875 20.95 30.25 25.924999999999997 3 24.6 24.175 27.85 23.375 4 29.15 28.299999999999997 19.825 22.725 5 28.925 30.525000000000002 21.425 19.125 6 22.1 35.775 23.275000000000002 18.85 7 20.875 21.25 39.125 18.75 8 21.575 24.375 29.75 24.3 9 21.425 24.175 31.324999999999996 23.075000000000003 10-14 22.975 29.835 25.865 21.325 15-19 23.09 27.815 27.095000000000002 22.0 20-24 22.79 28.485 27.295 21.43 25-29 22.735 28.105000000000004 26.905 22.255 30-34 22.88 28.73 26.365 22.025 35-39 23.23 28.389999999999997 26.21 22.17 40-44 23.810000000000002 28.875 25.669999999999998 21.645 45-49 23.54 27.994999999999997 26.490000000000002 21.975 50-54 23.605 28.315 26.25 21.83 55-59 23.445 28.435 26.405 21.715 60-64 22.795 27.750000000000004 27.185 22.27 65-69 23.315 27.845 27.07 21.77 70-74 23.05 28.625 26.445 21.88 75-79 23.09 28.389999999999997 26.265 22.255 80-84 23.369999999999997 28.13 26.38 22.12 85-89 23.465 27.515 26.715 22.305 90-94 22.785 28.000000000000004 26.790000000000003 22.425 95-99 23.625 28.63 26.290000000000003 21.455 100-104 23.78 28.365000000000002 26.3 21.555 105-109 23.74 28.560000000000002 26.340000000000003 21.36 110-114 23.919999999999998 27.894999999999996 26.405 21.78 115-119 23.32233223322332 27.947794779477945 26.222622262226224 22.50725072507251 120-124 24.29 27.62 26.474999999999998 21.615000000000002 125-129 24.349999999999998 27.439999999999998 26.419999999999998 21.790000000000003 130-134 24.44 27.74 26.57 21.25 135-139 24.722472247224722 27.93779377937794 26.247624762476246 21.09210921092109 140-144 24.277427742774275 28.197819781978197 26.37763776377638 21.147114711471147 145-149 24.93249324932493 27.872787278727873 25.90759075907591 21.287128712871286 150 24.8 27.125 26.8 21.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.5 3 2.5 4 1.5 5 2.5 6 4.0 7 2.5 8 2.5 9 2.0 10 1.0 11 1.5 12 1.5 13 2.5 14 2.0 15 1.5 16 2.0 17 0.5 18 0.5 19 3.5 20 3.5 21 4.0 22 5.0 23 2.0 24 1.0 25 2.0 26 5.0 27 6.5 28 7.5 29 10.5 30 14.5 31 19.5 32 24.0 33 29.0 34 39.0 35 57.5 36 74.5 37 95.0 38 112.5 39 128.5 40 166.0 41 203.5 42 222.0 43 242.0 44 263.0 45 259.5 46 258.5 47 261.5 48 229.0 49 194.5 50 176.5 51 161.0 52 144.0 53 108.0 54 76.5 55 58.5 56 40.0 57 35.5 58 34.0 59 26.0 60 17.0 61 13.5 62 12.5 63 9.0 64 7.5 65 6.0 66 4.5 67 4.0 68 4.5 69 5.0 70 3.5 71 2.0 72 2.0 73 1.5 74 1.0 75 2.0 76 3.0 77 2.5 78 2.5 79 1.0 80 0.0 81 0.5 82 0.5 83 1.5 84 1.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 1.0 94 1.5 95 1.0 96 1.5 97 1.5 98 2.5 99 5.5 100 20.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.01 145-149 0.01 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.85861250329728 90.85 2 3.9039831179108413 7.3999999999999995 3 0.21102611448166714 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026378264310208392 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 46 1.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.5 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 4.0 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGTCA 10 0.006973645 144.0 9 CGAGGTC 10 0.006973645 144.0 8 ACGAGGT 10 0.006973645 144.0 7 >>END_MODULE Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra Read 1120961 spots for SRR14040098.sra Written 1120961 spots for SRR14040098.sra SRR ids: ['SRR14040098.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xmuqdzl1 SRR14040098.sra spots: 22419220 blocks: [[1, 1120961], [1120962, 2241922], [2241923, 3362883], [3362884, 4483844], [4483845, 5604805], [5604806, 6725766], [6725767, 7846727], [7846728, 8967688], [8967689, 10088649], [10088650, 11209610], [11209611, 12330571], [12330572, 13451532], [13451533, 14572493], [14572494, 15693454], [15693455, 16814415], [16814416, 17935376], [17935377, 19056337], [19056338, 20177298], [20177299, 21298259], [21298260, 22419220]] SRR14040098 file size 7553543 SRR14040098 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14040098 SRR14040098_1.fastq SRR14040098_2.fastq Input file: SRR14040098_1.fastq Paired file: SRR14040098_2.fastq trimmed: SRR14040098-trimmed-pair1.fastq, SRR14040098-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:54:41 2025 >> started Wed Feb 12 05:55:16 2025 >> done (35.065s) 22419220 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 210012 ( 0.94%) empty read pairs filtered out after trimming by size control 22209101 (99.06%) read pairs available; of these: 1521030 ( 6.85%) trimmed read pairs available after processing 20688071 (93.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 11 0.00% 21 11 0.00% 22 8 0.00% 23 12 0.00% 24 17 0.00% 25 20 0.00% 26 19 0.00% 27 44 0.00% 28 38 0.00% 29 163 0.00% 30 55 0.00% 31 48 0.00% 32 74 0.00% 33 57 0.00% 34 77 0.00% 35 104 0.00% 36 107 0.00% 37 114 0.00% 38 155 0.00% 39 187 0.00% 40 200 0.00% 41 218 0.00% 42 282 0.00% 43 286 0.00% 44 264 0.00% 45 298 0.00% 46 380 0.00% 47 409 0.00% 48 463 0.00% 49 565 0.00% 50 633 0.00% 51 692 0.00% 52 663 0.00% 53 742 0.00% 54 714 0.00% 55 835 0.00% 56 871 0.00% 57 1059 0.00% 58 1116 0.01% 59 1200 0.01% 60 1329 0.01% 61 1467 0.01% 62 1551 0.01% 63 1641 0.01% 64 1709 0.01% 65 1659 0.01% 66 1841 0.01% 67 2032 0.01% 68 2188 0.01% 69 2367 0.01% 70 2631 0.01% 71 2757 0.01% 72 3018 0.01% 73 3072 0.01% 74 3286 0.01% 75 3426 0.02% 76 3534 0.02% 77 3814 0.02% 78 3955 0.02% 79 4345 0.02% 80 4565 0.02% 81 4734 0.02% 82 5236 0.02% 83 5420 0.02% 84 5644 0.03% 85 5890 0.03% 86 6060 0.03% 87 6255 0.03% 88 6240 0.03% 89 6764 0.03% 90 7438 0.03% 91 7747 0.03% 92 7967 0.04% 93 8455 0.04% 94 8898 0.04% 95 8962 0.04% 96 9393 0.04% 97 9468 0.04% 98 9857 0.04% 99 10275 0.05% 100 10628 0.05% 101 11140 0.05% 102 11998 0.05% 103 12566 0.06% 104 12833 0.06% 105 13270 0.06% 106 13615 0.06% 107 13478 0.06% 108 14218 0.06% 109 14724 0.07% 110 15295 0.07% 111 16333 0.07% 112 16718 0.08% 113 17669 0.08% 114 18398 0.08% 115 18939 0.09% 116 19034 0.09% 117 19591 0.09% 118 20108 0.09% 119 20659 0.09% 120 21408 0.10% 121 22310 0.10% 122 22874 0.10% 123 24021 0.11% 124 24851 0.11% 125 25449 0.11% 126 26102 0.12% 127 26624 0.12% 128 27239 0.12% 129 27828 0.13% 130 28864 0.13% 131 29583 0.13% 132 30738 0.14% 133 31588 0.14% 134 33016 0.15% 135 33930 0.15% 136 34681 0.16% 137 34956 0.16% 138 35955 0.16% 139 36332 0.16% 140 37225 0.17% 141 38186 0.17% 142 39327 0.18% 143 40627 0.18% 144 42334 0.19% 145 43168 0.19% 146 44058 0.20% 147 45077 0.20% 148 45350 0.20% 149 46003 0.21% 150 20688071 93.15% 22209101 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=30 prefix-density=0.17 prefix-fanout=2.7 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=118.14 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=18.5 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=33 prefix-density=0.16 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=10 fanout-score=128.04 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=19.6 sequence=CCACCACCATGGGCTCCCCAGCCACC SRR14040098 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:55:57 Started mapping on | Feb 12 05:55:58 Finished on | Feb 12 05:58:01 Mapping speed, Million of reads per hour | 650.02 Number of input reads | 22209101 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20383101 Uniquely mapped reads % | 91.78% Average mapped length | 294.63 Number of splices: Total | 17829925 Number of splices: Annotated (sjdb) | 17553753 Number of splices: GT/AG | 17572773 Number of splices: GC/AG | 205188 Number of splices: AT/AC | 16256 Number of splices: Non-canonical | 35708 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 447473 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 307905 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1378527 1378527 1378527 N_multimapping 447473 447473 447473 N_noFeature 438806 10325311 10284921 N_ambiguous 293862 41388 41363 UnstrandedReadsAssigned:19650433 PositiveStrandReadsAssigned:10016402 NegativeStrandReadsAssigned:10056817 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14040098 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14040098-trimmed-pair1.fastq SRR14040098-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,209,101 reads, 20,563,002 reads pseudoaligned [quant] estimated average fragment length: 236.743 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR14040098.ke.tsv 34699 SRR14040098.se.tsv 87100 total ==> SRR14040098.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.26 554 13.7139 Potri.005G024800.1.v4.1 1035 799.257 66 3.64318 Potri.004G059700.1.v4.1 961 725.263 24 1.45995 Potri.007G009000.2.v4.1 1416 1180.26 0 0 Potri.003G141000.2.v4.1 2943 2707.26 266.102 4.33651 Potri.016G087400.1.v4.1 270 75.2217 2040 1196.49 Potri.015G069301.1.v4.1 564 328.784 0 0 Potri.010G195200.1.v4.1 1773 1537.26 91.5428 2.62725 Potri.012G127500.1.v4.1 977 741.263 6652 395.916 ==> SRR14040098.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2527 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 561 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 59 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR14040098 completed mapping pipeline successfully