Starting /dee2/code/volunteer_pipeline.sh SRR14040099 current disk space = 3050316890112 free memory = 1582678396 SRR14040099 SRAfilesize a55e45a9b0958be9b28337f2ff74fb28 SRR14040099.sra SRR14040099.sra file validated SRR14040099 is paired end SRR14040099 is conventional basespace SRR14040099 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040099_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1385 37.0 37.0 37.0 37.0 37.0 2 36.33 37.0 37.0 37.0 37.0 37.0 3 36.3375 37.0 37.0 37.0 37.0 37.0 4 36.421 37.0 37.0 37.0 37.0 37.0 5 36.452 37.0 37.0 37.0 37.0 37.0 6 36.5115 37.0 37.0 37.0 37.0 37.0 7 36.3485 37.0 37.0 37.0 37.0 37.0 8 36.4825 37.0 37.0 37.0 37.0 37.0 9 36.356 37.0 37.0 37.0 37.0 37.0 10-14 36.4277 37.0 37.0 37.0 37.0 37.0 15-19 36.411 37.0 37.0 37.0 37.0 37.0 20-24 36.3639 37.0 37.0 37.0 37.0 37.0 25-29 36.2819 37.0 37.0 37.0 37.0 37.0 30-34 36.208000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.17345 37.0 37.0 37.0 37.0 37.0 40-44 36.1278 37.0 37.0 37.0 37.0 37.0 45-49 36.067400000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.9395 37.0 37.0 37.0 37.0 37.0 55-59 35.8652 37.0 37.0 37.0 37.0 37.0 60-64 35.8445 37.0 37.0 37.0 37.0 37.0 65-69 35.7185 37.0 37.0 37.0 37.0 37.0 70-74 35.7841 37.0 37.0 37.0 37.0 37.0 75-79 35.8635 37.0 37.0 37.0 37.0 37.0 80-84 35.79129999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.7735 37.0 37.0 37.0 37.0 37.0 90-94 35.7407 37.0 37.0 37.0 37.0 37.0 95-99 35.7347 37.0 37.0 37.0 37.0 37.0 100-104 35.6163 37.0 37.0 37.0 37.0 37.0 105-109 35.599199999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.5629 37.0 37.0 37.0 37.0 37.0 115-119 35.373599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.337599999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.281400000000005 37.0 37.0 37.0 34.6 37.0 130-134 35.1378 37.0 37.0 37.0 29.8 37.0 135-139 35.101099999999995 37.0 37.0 37.0 29.8 37.0 140-144 35.03135 37.0 37.0 37.0 25.0 37.0 145-149 34.76255 37.0 37.0 37.0 25.0 37.0 150 34.7105 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 2.0 22 2.0 23 1.0 24 7.0 25 10.0 26 13.0 27 24.0 28 23.0 29 43.0 30 51.0 31 74.0 32 107.0 33 152.0 34 167.0 35 376.0 36 2690.0 37 255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.025 15.225 13.375 32.375 2 22.175 22.75 31.2 23.875 3 24.25 23.775 29.15 22.825 4 26.55 27.150000000000002 20.599999999999998 25.7 5 26.924999999999997 32.6 21.45 19.025 6 20.925 36.05 24.75 18.275 7 18.525 22.925 39.050000000000004 19.5 8 19.900000000000002 25.825 28.725 25.55 9 22.25 23.974999999999998 30.9 22.875 10-14 21.625 31.09 25.485000000000003 21.8 15-19 21.695 28.4 27.589999999999996 22.314999999999998 20-24 21.64 28.575 27.195000000000004 22.59 25-29 21.615000000000002 29.134999999999998 26.96 22.29 30-34 21.905 28.83 27.229999999999997 22.035 35-39 21.246062303115156 28.831441572078603 27.241362068103403 22.681134056702835 40-44 21.875 28.625 26.825 22.675 45-49 22.5 28.199999999999996 26.99 22.31 50-54 22.11 28.005000000000003 27.485 22.400000000000002 55-59 22.505 28.27 26.655 22.57 60-64 22.645 27.58 26.895000000000003 22.88 65-69 22.64 28.165000000000003 26.99 22.205 70-74 23.575 27.744999999999997 26.915 21.765 75-79 23.09 27.689999999999998 27.250000000000004 21.97 80-84 22.615 27.894999999999996 27.185 22.305 85-89 23.47 28.095 26.26 22.175 90-94 22.900000000000002 28.48 26.38 22.24 95-99 22.825 28.139999999999997 27.125 21.91 100-104 23.580000000000002 27.985 26.779999999999998 21.654999999999998 105-109 23.41 27.93 26.38 22.28 110-114 23.630000000000003 27.37 26.790000000000003 22.21 115-119 24.310000000000002 27.16 26.484999999999996 22.045 120-124 23.375 27.675 26.834999999999997 22.115000000000002 125-129 23.044999999999998 28.065 26.625 22.264999999999997 130-134 23.494999999999997 28.035 25.69 22.78 135-139 24.07 28.189999999999998 25.814999999999998 21.925 140-144 24.8112405620281 27.326366318315916 25.67128356417821 22.191109555477773 145-149 24.021201060053002 27.881394069703486 25.416270813540677 22.681134056702835 150 24.9 27.3 25.174999999999997 22.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 3.0 25 4.5 26 2.0 27 3.0 28 11.5 29 15.0 30 13.0 31 20.5 32 28.0 33 29.5 34 44.5 35 59.5 36 72.5 37 90.5 38 109.5 39 142.5 40 179.5 41 215.5 42 247.0 43 262.5 44 260.5 45 259.0 46 269.0 47 262.5 48 237.5 49 217.5 50 179.5 51 148.0 52 140.5 53 118.5 54 87.5 55 57.5 56 37.0 57 37.5 58 29.5 59 12.0 60 10.0 61 11.5 62 7.5 63 4.5 64 5.5 65 5.5 66 3.0 67 1.0 68 2.0 69 3.5 70 3.5 71 2.5 72 3.0 73 2.5 74 3.0 75 6.0 76 5.5 77 2.5 78 3.5 79 3.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.39352461173993 90.60000000000001 2 4.211634640694919 8.0 3 0.34219531455646224 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.026322716504343247 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026322716504343247 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTCACCATCTCGGGT 10 0.25 TruSeq Adapter, Index 1 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTCACCATCGCGGGT 7 0.17500000000000002 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.36250000000000004 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.4875 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.0374999999999996 0.0 0.0 0.0 0.0 114-115 3.2625 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.375 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.15 0.0 0.0 0.0 0.0 130-131 5.6625 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.5375 0.0 0.0 0.0 0.0 138 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGATA 10 0.006973645 144.0 3 >>END_MODULE SRR14040099 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040099_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.979 37.0 37.0 37.0 37.0 37.0 2 35.9135 37.0 37.0 37.0 37.0 37.0 3 36.017 37.0 37.0 37.0 37.0 37.0 4 36.016 37.0 37.0 37.0 37.0 37.0 5 36.067 37.0 37.0 37.0 37.0 37.0 6 36.068 37.0 37.0 37.0 37.0 37.0 7 35.953 37.0 37.0 37.0 37.0 37.0 8 36.0005 37.0 37.0 37.0 37.0 37.0 9 36.072 37.0 37.0 37.0 37.0 37.0 10-14 36.057100000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.9949 37.0 37.0 37.0 37.0 37.0 20-24 35.970000000000006 37.0 37.0 37.0 37.0 37.0 25-29 35.880700000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.8504 37.0 37.0 37.0 37.0 37.0 35-39 35.830499999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.82950000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.7423 37.0 37.0 37.0 37.0 37.0 50-54 35.7611 37.0 37.0 37.0 37.0 37.0 55-59 35.65740000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.714800000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.6543 37.0 37.0 37.0 37.0 37.0 70-74 35.5322 37.0 37.0 37.0 37.0 37.0 75-79 35.5349 37.0 37.0 37.0 37.0 37.0 80-84 35.553999999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.5205 37.0 37.0 37.0 37.0 37.0 90-94 35.461 37.0 37.0 37.0 37.0 37.0 95-99 35.433499999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.3914 37.0 37.0 37.0 37.0 37.0 105-109 35.3018 37.0 37.0 37.0 37.0 37.0 110-114 35.3269 37.0 37.0 37.0 37.0 37.0 115-119 35.28655 37.0 37.0 37.0 37.0 37.0 120-124 35.2028 37.0 37.0 37.0 34.6 37.0 125-129 35.03855 37.0 37.0 37.0 29.8 37.0 130-134 35.105900000000005 37.0 37.0 37.0 27.4 37.0 135-139 34.948649999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.887950000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.798350000000006 37.0 37.0 37.0 25.0 37.0 150 34.648 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 3.0 15 2.0 16 3.0 17 3.0 18 5.0 19 7.0 20 9.0 21 18.0 22 13.0 23 9.0 24 10.0 25 18.0 26 16.0 27 26.0 28 28.0 29 30.0 30 43.0 31 58.0 32 79.0 33 94.0 34 163.0 35 427.0 36 2655.0 37 276.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.8 15.125 13.525 33.550000000000004 2 23.425 20.95 31.275 24.349999999999998 3 26.375 23.549999999999997 25.75 24.325 4 29.25 27.150000000000002 19.75 23.849999999999998 5 28.050000000000004 31.025000000000002 22.25 18.675 6 21.224999999999998 35.449999999999996 24.525 18.8 7 21.6 21.425 39.5 17.474999999999998 8 21.725 24.25 30.025000000000002 24.0 9 23.075000000000003 24.775 30.075000000000003 22.075 10-14 23.48 29.425 25.580000000000002 21.515 15-19 23.26 28.33 26.505000000000003 21.905 20-24 23.855 27.994999999999997 26.779999999999998 21.37 25-29 23.095 28.785 26.369999999999997 21.75 30-34 23.24 27.79 27.045 21.925 35-39 23.22 27.625 27.425 21.73 40-44 23.535 28.455000000000002 26.915 21.095 45-49 22.975 28.17 27.139999999999997 21.715 50-54 22.945 28.439999999999998 26.884999999999998 21.73 55-59 23.28 27.985 26.995 21.740000000000002 60-64 23.330000000000002 28.485 25.929999999999996 22.255 65-69 23.135 28.82 26.295 21.75 70-74 23.695 27.950000000000003 26.634999999999998 21.72 75-79 23.485 27.935 26.790000000000003 21.790000000000003 80-84 23.43 28.194999999999997 26.865 21.51 85-89 23.775 27.3 26.69 22.235 90-94 23.785 27.725 26.700000000000003 21.790000000000003 95-99 23.585 27.889999999999997 27.025 21.5 100-104 24.515 27.93 26.6 20.955 105-109 23.925 27.85 26.939999999999998 21.285 110-114 23.825 28.52 26.05 21.605 115-119 24.136206810340514 28.21141057052853 26.49632481624081 21.156057802890142 120-124 24.57 27.834999999999997 26.11 21.485000000000003 125-129 24.23121156057803 27.541377068853446 26.696334816740837 21.531076553827692 130-134 24.67 28.015 26.155 21.16 135-139 25.04125206260313 27.566378318915945 26.611330566528324 20.7810390519526 140-144 25.29626481324066 27.30636531826591 26.07630381519076 21.321066053302665 145-149 25.336266813340668 27.33136656832842 25.951297564878246 21.381069053452674 150 25.474999999999998 26.700000000000003 26.950000000000003 20.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.5 5 1.5 6 1.5 7 2.0 8 1.5 9 1.0 10 0.5 11 2.0 12 5.0 13 5.5 14 3.0 15 0.5 16 0.5 17 1.5 18 2.0 19 1.0 20 0.5 21 1.0 22 1.0 23 2.5 24 6.0 25 6.5 26 4.5 27 5.0 28 8.5 29 10.5 30 9.5 31 15.0 32 31.0 33 44.0 34 47.0 35 54.5 36 82.0 37 96.0 38 113.0 39 142.0 40 161.0 41 194.0 42 219.0 43 241.0 44 257.0 45 250.5 46 255.5 47 252.5 48 223.5 49 195.5 50 186.5 51 153.5 52 111.0 53 112.5 54 98.0 55 68.0 56 54.5 57 41.5 58 28.5 59 24.5 60 20.0 61 12.5 62 11.5 63 14.0 64 10.5 65 5.5 66 4.0 67 1.5 68 3.0 69 5.0 70 3.0 71 0.5 72 0.0 73 0.0 74 1.0 75 1.0 76 0.5 77 1.0 78 1.0 79 0.5 80 1.0 81 1.5 82 0.5 83 0.0 84 0.5 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 1.0 91 2.0 92 1.5 93 0.5 94 1.0 95 0.5 96 2.0 97 4.5 98 3.0 99 3.0 100 19.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.47139830508475 90.125 2 4.290254237288135 8.1 3 0.211864406779661 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026483050847457626 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 47 1.175 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.21250000000000002 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.4875 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.0374999999999996 0.0 0.0 0.0 0.0 114-115 3.2625 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 4.6375 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.2875 0.0 0.0 0.0 0.0 130-131 5.824999999999999 0.0 0.0 0.0 0.0 132-133 6.1375 0.0 0.0 0.0 0.0 134-135 6.3875 0.0 0.0 0.0 0.0 136-137 6.675 0.0 0.0 0.0 0.0 138 7.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.007966741 18.0 65-69 >>END_MODULE Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra Read 1246607 spots for SRR14040099.sra Written 1246607 spots for SRR14040099.sra Read 1246597 spots for SRR14040099.sra Written 1246597 spots for SRR14040099.sra SRR ids: ['SRR14040099.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0cag80yl SRR14040099.sra spots: 24931950 blocks: [[1, 1246597], [1246598, 2493194], [2493195, 3739791], [3739792, 4986388], [4986389, 6232985], [6232986, 7479582], [7479583, 8726179], [8726180, 9972776], [9972777, 11219373], [11219374, 12465970], [12465971, 13712567], [13712568, 14959164], [14959165, 16205761], [16205762, 17452358], [17452359, 18698955], [18698956, 19945552], [19945553, 21192149], [21192150, 22438746], [22438747, 23685343], [23685344, 24931950]] SRR14040099 file size 8402571 SRR14040099 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14040099 SRR14040099_1.fastq SRR14040099_2.fastq Input file: SRR14040099_1.fastq Paired file: SRR14040099_2.fastq trimmed: SRR14040099-trimmed-pair1.fastq, SRR14040099-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:09:51 2025 >> started Wed Feb 12 06:10:18 2025 >> done (27.095s) 24931950 read pairs processed; of these: 166 ( 0.00%) short read pairs filtered out after trimming by size control 270374 ( 1.08%) empty read pairs filtered out after trimming by size control 24661410 (98.91%) read pairs available; of these: 2483555 (10.07%) trimmed read pairs available after processing 22177855 (89.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 13 0.00% 20 18 0.00% 21 12 0.00% 22 15 0.00% 23 19 0.00% 24 22 0.00% 25 29 0.00% 26 18 0.00% 27 57 0.00% 28 59 0.00% 29 248 0.00% 30 80 0.00% 31 101 0.00% 32 83 0.00% 33 110 0.00% 34 105 0.00% 35 159 0.00% 36 158 0.00% 37 213 0.00% 38 268 0.00% 39 345 0.00% 40 402 0.00% 41 443 0.00% 42 449 0.00% 43 446 0.00% 44 500 0.00% 45 508 0.00% 46 649 0.00% 47 752 0.00% 48 924 0.00% 49 1007 0.00% 50 1134 0.00% 51 1153 0.00% 52 1307 0.01% 53 1241 0.01% 54 1289 0.01% 55 1488 0.01% 56 1672 0.01% 57 1851 0.01% 58 1956 0.01% 59 2266 0.01% 60 2620 0.01% 61 2685 0.01% 62 2951 0.01% 63 2967 0.01% 64 3253 0.01% 65 3319 0.01% 66 3468 0.01% 67 3789 0.02% 68 4093 0.02% 69 4498 0.02% 70 4791 0.02% 71 5139 0.02% 72 5557 0.02% 73 6050 0.02% 74 5973 0.02% 75 6367 0.03% 76 6611 0.03% 77 6963 0.03% 78 7574 0.03% 79 7915 0.03% 80 8318 0.03% 81 9042 0.04% 82 9544 0.04% 83 9982 0.04% 84 10190 0.04% 85 10768 0.04% 86 11046 0.04% 87 11492 0.05% 88 11926 0.05% 89 12529 0.05% 90 13217 0.05% 91 13987 0.06% 92 15068 0.06% 93 15442 0.06% 94 15794 0.06% 95 16468 0.07% 96 16860 0.07% 97 17176 0.07% 98 17602 0.07% 99 18770 0.08% 100 19403 0.08% 101 20122 0.08% 102 21520 0.09% 103 22447 0.09% 104 23023 0.09% 105 23734 0.10% 106 24351 0.10% 107 24686 0.10% 108 25309 0.10% 109 26593 0.11% 110 27157 0.11% 111 28226 0.11% 112 29415 0.12% 113 30227 0.12% 114 31545 0.13% 115 32446 0.13% 116 32836 0.13% 117 33505 0.14% 118 34111 0.14% 119 35441 0.14% 120 35771 0.15% 121 37302 0.15% 122 38320 0.16% 123 40101 0.16% 124 41220 0.17% 125 42397 0.17% 126 43104 0.17% 127 43174 0.18% 128 44349 0.18% 129 45486 0.18% 130 46075 0.19% 131 47590 0.19% 132 48712 0.20% 133 50669 0.21% 134 51235 0.21% 135 53053 0.22% 136 53595 0.22% 137 54844 0.22% 138 55397 0.22% 139 56194 0.23% 140 57089 0.23% 141 57938 0.23% 142 59321 0.24% 143 60977 0.25% 144 62527 0.25% 145 63843 0.26% 146 64089 0.26% 147 65164 0.26% 148 66012 0.27% 149 66527 0.27% 150 22177855 89.93% 24661410 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=27 prefix-density=0.16 prefix-fanout=2.9 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=7 fanout-score=115.61 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=18.5 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=28 prefix-density=0.16 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=136.11 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=20.5 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC SRR14040099 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:11:00 Started mapping on | Feb 12 06:11:00 Finished on | Feb 12 06:13:13 Mapping speed, Million of reads per hour | 667.53 Number of input reads | 24661410 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 22918707 Uniquely mapped reads % | 92.93% Average mapped length | 292.57 Number of splices: Total | 20044837 Number of splices: Annotated (sjdb) | 19727677 Number of splices: GT/AG | 19753930 Number of splices: GC/AG | 232633 Number of splices: AT/AC | 17823 Number of splices: Non-canonical | 40451 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 477692 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 105153 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1265011 1265011 1265011 N_multimapping 477692 477692 477692 N_noFeature 499080 11634607 11555522 N_ambiguous 319444 46305 46107 UnstrandedReadsAssigned:22100183 PositiveStrandReadsAssigned:11237795 NegativeStrandReadsAssigned:11317078 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14040099 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14040099-trimmed-pair1.fastq SRR14040099-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,661,410 reads, 22,857,545 reads pseudoaligned [quant] estimated average fragment length: 228.315 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR14040099.ke.tsv 34699 SRR14040099.se.tsv 87100 total ==> SRR14040099.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.69 671 15.7118 Potri.005G024800.1.v4.1 1035 807.685 73 3.78968 Potri.004G059700.1.v4.1 961 733.691 20 1.14298 Potri.007G009000.2.v4.1 1416 1188.69 0 0 Potri.003G141000.2.v4.1 2943 2715.69 355.056 5.482 Potri.016G087400.1.v4.1 270 83.2009 2162 1089.56 Potri.015G069301.1.v4.1 564 337.198 0 0 Potri.010G195200.1.v4.1 1773 1545.69 87 2.36004 Potri.012G127500.1.v4.1 977 749.685 8026 448.892 ==> SRR14040099.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2724 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 642 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 50 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR14040099 completed mapping pipeline successfully