Starting /dee2/code/volunteer_pipeline.sh SRR14040100 current disk space = 3049653547008 free memory = 1482383172 SRR14040100 SRAfilesize bde995e35609954adce0382428097479 SRR14040100.sra SRR14040100.sra file validated SRR14040100 is paired end SRR14040100 is conventional basespace SRR14040100 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040100_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2875 37.0 37.0 37.0 37.0 37.0 2 36.40375 37.0 37.0 37.0 37.0 37.0 3 36.4465 37.0 37.0 37.0 37.0 37.0 4 36.4435 37.0 37.0 37.0 37.0 37.0 5 36.5965 37.0 37.0 37.0 37.0 37.0 6 36.459 37.0 37.0 37.0 37.0 37.0 7 36.4325 37.0 37.0 37.0 37.0 37.0 8 36.471 37.0 37.0 37.0 37.0 37.0 9 36.4855 37.0 37.0 37.0 37.0 37.0 10-14 36.4265 37.0 37.0 37.0 37.0 37.0 15-19 36.3683 37.0 37.0 37.0 37.0 37.0 20-24 36.381150000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3004 37.0 37.0 37.0 37.0 37.0 30-34 36.195299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.13985 37.0 37.0 37.0 37.0 37.0 40-44 36.147800000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.887299999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.728 37.0 37.0 37.0 37.0 37.0 55-59 35.61415000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.584900000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.5039 37.0 37.0 37.0 37.0 37.0 70-74 35.535700000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.6899 37.0 37.0 37.0 37.0 37.0 80-84 35.7321 37.0 37.0 37.0 37.0 37.0 85-89 35.6773 37.0 37.0 37.0 37.0 37.0 90-94 35.62400000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.705299999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.50070000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.4318 37.0 37.0 37.0 37.0 37.0 110-114 35.4533 37.0 37.0 37.0 37.0 37.0 115-119 35.3112 37.0 37.0 37.0 37.0 37.0 120-124 35.17659999999999 37.0 37.0 37.0 29.8 37.0 125-129 35.1197 37.0 37.0 37.0 27.4 37.0 130-134 34.9825 37.0 37.0 37.0 25.0 37.0 135-139 34.913250000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.84654999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.648450000000004 37.0 37.0 37.0 25.0 37.0 150 34.525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 2.0 21 4.0 22 2.0 23 7.0 24 5.0 25 9.0 26 17.0 27 23.0 28 35.0 29 52.0 30 50.0 31 60.0 32 141.0 33 153.0 34 184.0 35 408.0 36 2622.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.25 14.975 14.524999999999999 32.25 2 21.530382595648913 23.93098274568642 31.732933233308323 22.80570142535634 3 22.2 25.074999999999996 29.525000000000002 23.200000000000003 4 26.575 28.499999999999996 19.425 25.5 5 26.650000000000002 33.1 22.175 18.075 6 20.599999999999998 36.625 23.549999999999997 19.225 7 18.25 22.650000000000002 41.05 18.05 8 19.975 23.175 30.325000000000003 26.525 9 23.075000000000003 23.9 30.375000000000004 22.650000000000002 10-14 22.005 29.845 25.985000000000003 22.165000000000003 15-19 21.77 28.625 27.089999999999996 22.515 20-24 21.771088554427724 28.56642832141607 27.27136356817841 22.3911195559778 25-29 21.525 27.88 27.389999999999997 23.205000000000002 30-34 21.855 29.07 26.945000000000004 22.13 35-39 22.056102805140256 28.046402320116005 27.69138456922846 22.206110305515274 40-44 21.815 28.645 26.88 22.66 45-49 22.955000000000002 27.435 26.815 22.795 50-54 23.335 27.565 27.155 21.945 55-59 23.881194059702985 27.826391319565978 26.466323316165806 21.826091304565228 60-64 23.41 27.21 26.935 22.445 65-69 23.06 27.994999999999997 26.875 22.07 70-74 23.505000000000003 27.400000000000002 26.889999999999997 22.205 75-79 24.154999999999998 27.229999999999997 26.945000000000004 21.67 80-84 23.665 27.474999999999998 26.735 22.125 85-89 24.21 27.794999999999998 25.825 22.17 90-94 23.79 27.525 26.27 22.415 95-99 23.565 27.275 26.595000000000002 22.564999999999998 100-104 24.12 27.485 26.435 21.959999999999997 105-109 23.96 27.060000000000002 26.805 22.175 110-114 24.615000000000002 27.98 25.66 21.745 115-119 23.849999999999998 27.134999999999998 26.919999999999998 22.095000000000002 120-124 24.715 27.22 25.674999999999997 22.39 125-129 24.915000000000003 27.975 25.635 21.475 130-134 24.865000000000002 27.589999999999996 25.990000000000002 21.555 135-139 24.616230811540575 27.101355067753385 25.99629981499075 22.286114305715284 140-144 24.73123656182809 26.616330816540827 26.366318315915795 22.286114305715284 145-149 26.07630381519076 26.64633231661583 25.34126706335317 21.93609680484024 150 25.224999999999998 26.825 26.5 21.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 4.0 26 6.0 27 6.0 28 6.5 29 11.0 30 13.0 31 19.5 32 30.0 33 33.5 34 48.0 35 54.5 36 69.0 37 101.5 38 117.0 39 133.0 40 161.5 41 188.5 42 214.5 43 245.0 44 261.5 45 275.0 46 269.5 47 261.0 48 262.5 49 225.0 50 177.5 51 147.5 52 117.0 53 104.0 54 87.0 55 62.0 56 46.0 57 35.0 58 28.5 59 19.0 60 15.5 61 13.5 62 11.5 63 9.0 64 8.5 65 8.0 66 5.5 67 2.0 68 2.0 69 6.0 70 8.5 71 5.0 72 3.5 73 6.0 74 10.5 75 16.0 76 15.5 77 8.5 78 2.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.375 #Duplication Level Percentage of deduplicated Percentage of total 1 95.78807947019867 90.4 2 3.8410596026490067 7.249999999999999 3 0.23841059602649006 0.675 4 0.0 0.0 5 0.026490066225165563 0.125 6 0.0 0.0 7 0.0 0.0 8 0.052980132450331126 0.4 9 0.0 0.0 >10 0.052980132450331126 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTATGCAATCTCGGGT 33 0.8250000000000001 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTATGCAATCTCGGGG 13 0.325 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTATGCAATCGCGGGT 8 0.2 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTATGCAATCGCGGGG 8 0.2 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTATGCAATCTCGGTT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.1875 0.0 0.0 0.0 0.0 62-63 0.2375 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.2875 0.0 0.0 0.0 0.0 68-69 0.3375 0.0 0.0 0.0 0.0 70-71 0.4 0.0 0.0 0.0 0.0 72-73 0.5125 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.675 0.0 0.0 0.0 0.0 78-79 0.8125 0.0 0.0 0.0 0.0 80-81 0.925 0.0 0.0 0.0 0.0 82-83 0.9875 0.0 0.0 0.0 0.0 84-85 1.2125 0.0 0.0 0.0 0.0 86-87 1.3125 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.6375 0.0 0.0 0.0 0.0 94-95 1.9125 0.0 0.0 0.0 0.0 96-97 2.1500000000000004 0.0 0.0 0.0 0.0 98-99 2.4625 0.0 0.0 0.0 0.0 100-101 2.7249999999999996 0.0 0.0 0.0 0.0 102-103 2.9124999999999996 0.0 0.0 0.0 0.0 104-105 3.1125 0.0 0.0 0.0 0.0 106-107 3.3375 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 3.8499999999999996 0.0 0.0 0.0 0.0 112-113 4.175 0.0 0.0 0.0 0.0 114-115 4.6875 0.0 0.0 0.0 0.0 116-117 5.075 0.0 0.0 0.0 0.0 118-119 5.4625 0.0 0.0 0.0 0.0 120-121 5.875 0.0 0.0 0.0 0.0 122-123 6.275 0.0 0.0 0.0 0.0 124-125 6.525 0.0 0.0 0.0 0.0 126-127 6.9 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 7.925 0.0 0.0 0.0 0.0 134-135 8.2375 0.0 0.0 0.0 0.0 136-137 8.8875 0.0 0.0 0.0 0.0 138 9.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14040100 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040100_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8095 37.0 37.0 37.0 37.0 37.0 2 35.7865 37.0 37.0 37.0 37.0 37.0 3 35.9125 37.0 37.0 37.0 37.0 37.0 4 35.9655 37.0 37.0 37.0 37.0 37.0 5 35.982 37.0 37.0 37.0 37.0 37.0 6 35.954 37.0 37.0 37.0 37.0 37.0 7 35.7965 37.0 37.0 37.0 37.0 37.0 8 35.9335 37.0 37.0 37.0 37.0 37.0 9 35.9285 37.0 37.0 37.0 37.0 37.0 10-14 35.9486 37.0 37.0 37.0 37.0 37.0 15-19 35.89 37.0 37.0 37.0 37.0 37.0 20-24 35.8928 37.0 37.0 37.0 37.0 37.0 25-29 35.733000000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.6866 37.0 37.0 37.0 37.0 37.0 35-39 35.5989 37.0 37.0 37.0 37.0 37.0 40-44 35.593900000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.550200000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.467600000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.4841 37.0 37.0 37.0 37.0 37.0 60-64 35.505399999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.513999999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.3591 37.0 37.0 37.0 37.0 37.0 75-79 35.262600000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.3557 37.0 37.0 37.0 37.0 37.0 85-89 35.2975 37.0 37.0 37.0 37.0 37.0 90-94 35.2349 37.0 37.0 37.0 37.0 37.0 95-99 35.323699999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.2549 37.0 37.0 37.0 37.0 37.0 105-109 35.220099999999995 37.0 37.0 37.0 34.6 37.0 110-114 35.2479 37.0 37.0 37.0 34.6 37.0 115-119 35.113749999999996 37.0 37.0 37.0 27.4 37.0 120-124 35.0343 37.0 37.0 37.0 27.4 37.0 125-129 34.92385 37.0 37.0 37.0 27.4 37.0 130-134 34.98635 37.0 37.0 37.0 25.0 37.0 135-139 34.78005 37.0 37.0 37.0 25.0 37.0 140-144 34.66005 37.0 37.0 37.0 25.0 37.0 145-149 34.64325 37.0 37.0 37.0 25.0 37.0 150 34.4315 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 5.0 15 7.0 16 8.0 17 3.0 18 8.0 19 3.0 20 4.0 21 7.0 22 20.0 23 17.0 24 21.0 25 20.0 26 27.0 27 24.0 28 24.0 29 34.0 30 39.0 31 61.0 32 73.0 33 108.0 34 198.0 35 545.0 36 2481.0 37 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.324999999999996 13.775 13.775 34.125 2 23.65 20.275000000000002 31.874999999999996 24.2 3 25.474999999999998 22.55 27.750000000000004 24.224999999999998 4 29.7 26.325 19.75 24.224999999999998 5 28.1 31.75 22.0 18.15 6 21.675 34.65 25.45 18.224999999999998 7 20.8 19.8 41.099999999999994 18.3 8 23.325000000000003 22.925 30.25 23.5 9 23.175 25.05 29.599999999999998 22.175 10-14 23.78 29.285 25.845000000000002 21.09 15-19 23.53 28.060000000000002 27.33 21.08 20-24 23.665 28.09 26.63 21.615000000000002 25-29 23.69 28.455000000000002 26.345000000000002 21.51 30-34 24.355 28.07 26.545 21.029999999999998 35-39 23.335 28.4 26.240000000000002 22.025 40-44 22.89 28.804999999999996 27.07 21.235 45-49 23.494999999999997 27.965 26.575 21.965 50-54 23.785 28.910000000000004 26.195 21.11 55-59 23.810000000000002 28.59 25.83 21.77 60-64 23.380000000000003 28.084999999999997 26.39 22.145 65-69 23.76 28.000000000000004 26.545 21.695 70-74 24.095 28.189999999999998 26.13 21.584999999999997 75-79 23.24 28.43 26.895000000000003 21.435000000000002 80-84 23.915 28.005000000000003 26.474999999999998 21.605 85-89 24.435000000000002 27.405 26.895000000000003 21.265 90-94 24.18 28.03 26.11 21.68 95-99 24.169999999999998 27.735 26.314999999999998 21.78 100-104 24.435000000000002 28.625 25.94 21.0 105-109 25.005 27.72 26.005 21.27 110-114 25.119999999999997 27.99 25.480000000000004 21.41 115-119 25.04125206260313 27.986399319965997 25.971298564928247 21.001050052502627 120-124 25.365 27.715 25.785000000000004 21.135 125-129 25.951297564878246 27.376368818440923 25.601280064003202 21.071053552677636 130-134 26.346317315865793 27.561378068903448 25.281264063203164 20.811040552027603 135-139 26.116305815290765 27.541377068853446 25.26626331316566 21.076053802690133 140-144 26.306315315765787 27.83639181959098 25.36626831341567 20.49102455122756 145-149 27.636381819090953 27.621381069053452 24.8162408120406 19.92599629981499 150 27.275 27.650000000000002 25.674999999999997 19.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 2.0 5 3.0 6 2.0 7 3.0 8 4.0 9 2.5 10 3.0 11 4.5 12 4.0 13 3.0 14 2.0 15 1.5 16 2.0 17 1.5 18 1.0 19 1.5 20 2.0 21 2.0 22 2.5 23 3.5 24 5.5 25 7.0 26 6.5 27 5.0 28 5.5 29 7.0 30 13.5 31 25.0 32 30.5 33 32.0 34 44.0 35 53.0 36 67.5 37 94.0 38 113.0 39 139.0 40 163.5 41 202.0 42 228.5 43 243.0 44 253.0 45 247.0 46 247.0 47 248.0 48 249.5 49 210.0 50 168.5 51 148.0 52 125.0 53 107.0 54 86.0 55 64.0 56 52.5 57 43.0 58 24.0 59 17.0 60 15.5 61 13.5 62 11.0 63 7.0 64 6.0 65 3.5 66 2.0 67 3.5 68 4.5 69 3.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.5 75 0.5 76 1.0 77 1.5 78 1.0 79 1.5 80 1.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 1.0 88 1.0 89 0.5 90 1.0 91 1.5 92 1.0 93 2.0 94 2.5 95 2.0 96 2.5 97 3.0 98 3.0 99 8.5 100 33.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.005 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 96.30216587427364 91.14999999999999 2 3.4601162176439515 6.550000000000001 3 0.21130480718436345 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02641310089804543 1.7000000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 68 1.7000000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.1875 0.0 0.0 0.0 0.0 62-63 0.2625 0.0 0.0 0.0 0.0 64-65 0.275 0.0 0.0 0.0 0.0 66-67 0.3125 0.0 0.0 0.0 0.0 68-69 0.3625 0.0 0.0 0.0 0.0 70-71 0.42500000000000004 0.0 0.0 0.0 0.0 72-73 0.5125 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.675 0.0 0.0 0.0 0.0 78-79 0.8 0.0 0.0 0.0 0.0 80-81 0.9 0.0 0.0 0.0 0.0 82-83 0.9624999999999999 0.0 0.0 0.0 0.0 84-85 1.1875 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.6125 0.0 0.0 0.0 0.0 94-95 1.8875000000000002 0.0 0.0 0.0 0.0 96-97 2.1125 0.0 0.0 0.0 0.0 98-99 2.4125 0.0 0.0 0.0 0.0 100-101 2.6875 0.0 0.0 0.0 0.0 102-103 2.8875 0.0 0.0 0.0 0.0 104-105 3.0875 0.0 0.0 0.0 0.0 106-107 3.3125 0.0 0.0 0.0 0.0 108-109 3.5375 0.0 0.0 0.0 0.0 110-111 3.8375 0.0 0.0 0.0 0.0 112-113 4.199999999999999 0.0 0.0 0.0 0.0 114-115 4.7125 0.0 0.0 0.0 0.0 116-117 5.125 0.0 0.0 0.0 0.0 118-119 5.525 0.0 0.0 0.0 0.0 120-121 5.9625 0.0 0.0 0.0 0.0 122-123 6.35 0.0 0.0 0.0 0.0 124-125 6.6125 0.0 0.0 0.0 0.0 126-127 7.0625 0.0 0.0 0.0 0.0 128-129 7.35 0.0 0.0 0.0 0.0 130-131 7.75 0.0 0.0 0.0 0.0 132-133 8.125 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 9.100000000000001 0.0 0.0 0.0 0.0 138 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra Read 1259248 spots for SRR14040100.sra Written 1259248 spots for SRR14040100.sra Read 1259240 spots for SRR14040100.sra Written 1259240 spots for SRR14040100.sra SRR ids: ['SRR14040100.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x6krs3_k SRR14040100.sra spots: 25184808 blocks: [[1, 1259240], [1259241, 2518480], [2518481, 3777720], [3777721, 5036960], [5036961, 6296200], [6296201, 7555440], [7555441, 8814680], [8814681, 10073920], [10073921, 11333160], [11333161, 12592400], [12592401, 13851640], [13851641, 15110880], [15110881, 16370120], [16370121, 17629360], [17629361, 18888600], [18888601, 20147840], [20147841, 21407080], [21407081, 22666320], [22666321, 23925560], [23925561, 25184808]] SRR14040100 file size 8488010 SRR14040100 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14040100 SRR14040100_1.fastq SRR14040100_2.fastq Input file: SRR14040100_1.fastq Paired file: SRR14040100_2.fastq trimmed: SRR14040100-trimmed-pair1.fastq, SRR14040100-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:51:46 2025 >> started Wed Feb 12 05:52:14 2025 >> done (27.542s) 25184808 read pairs processed; of these: 225 ( 0.00%) short read pairs filtered out after trimming by size control 396661 ( 1.58%) empty read pairs filtered out after trimming by size control 24787922 (98.42%) read pairs available; of these: 3196441 (12.90%) trimmed read pairs available after processing 21591481 (87.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 22 0.00% 20 23 0.00% 21 19 0.00% 22 30 0.00% 23 34 0.00% 24 31 0.00% 25 37 0.00% 26 34 0.00% 27 95 0.00% 28 88 0.00% 29 422 0.00% 30 116 0.00% 31 106 0.00% 32 122 0.00% 33 149 0.00% 34 188 0.00% 35 200 0.00% 36 243 0.00% 37 296 0.00% 38 400 0.00% 39 483 0.00% 40 619 0.00% 41 679 0.00% 42 676 0.00% 43 677 0.00% 44 701 0.00% 45 868 0.00% 46 959 0.00% 47 1091 0.00% 48 1334 0.01% 49 1549 0.01% 50 1687 0.01% 51 1845 0.01% 52 2052 0.01% 53 2137 0.01% 54 2068 0.01% 55 2342 0.01% 56 2575 0.01% 57 2860 0.01% 58 3180 0.01% 59 3643 0.01% 60 4021 0.02% 61 4404 0.02% 62 4568 0.02% 63 4910 0.02% 64 5140 0.02% 65 5271 0.02% 66 5552 0.02% 67 6073 0.02% 68 6662 0.03% 69 7151 0.03% 70 7828 0.03% 71 8553 0.03% 72 9033 0.04% 73 9450 0.04% 74 9771 0.04% 75 10145 0.04% 76 10491 0.04% 77 11081 0.04% 78 11920 0.05% 79 12499 0.05% 80 13456 0.05% 81 14298 0.06% 82 15245 0.06% 83 15916 0.06% 84 16317 0.07% 85 17142 0.07% 86 17188 0.07% 87 17982 0.07% 88 18926 0.08% 89 19498 0.08% 90 20584 0.08% 91 21721 0.09% 92 22940 0.09% 93 23678 0.10% 94 24372 0.10% 95 24987 0.10% 96 25687 0.10% 97 25928 0.10% 98 26872 0.11% 99 27730 0.11% 100 28849 0.12% 101 29781 0.12% 102 31863 0.13% 103 32901 0.13% 104 33277 0.13% 105 34136 0.14% 106 34673 0.14% 107 35121 0.14% 108 35906 0.14% 109 36436 0.15% 110 37494 0.15% 111 39300 0.16% 112 40864 0.16% 113 42149 0.17% 114 43228 0.17% 115 43633 0.18% 116 44224 0.18% 117 44597 0.18% 118 45132 0.18% 119 46068 0.19% 120 46653 0.19% 121 48655 0.20% 122 49775 0.20% 123 51153 0.21% 124 52510 0.21% 125 53241 0.21% 126 54142 0.22% 127 54973 0.22% 128 54426 0.22% 129 55916 0.23% 130 56591 0.23% 131 57824 0.23% 132 59032 0.24% 133 60171 0.24% 134 61541 0.25% 135 62782 0.25% 136 62081 0.25% 137 63997 0.26% 138 64151 0.26% 139 65149 0.26% 140 65836 0.27% 141 66632 0.27% 142 67835 0.27% 143 68783 0.28% 144 70364 0.28% 145 71849 0.29% 146 71720 0.29% 147 71810 0.29% 148 72224 0.29% 149 73309 0.30% 150 21591481 87.10% 24787922 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=26 prefix-density=0.16 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=143.80 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=20.5 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=30 prefix-density=0.15 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=128.19 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=19.8 sequence=CCACCACCATGGGCT SRR14040100 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:53:59 Started mapping on | Feb 12 05:53:59 Finished on | Feb 12 05:56:07 Mapping speed, Million of reads per hour | 697.16 Number of input reads | 24787922 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 22905788 Uniquely mapped reads % | 92.41% Average mapped length | 290.32 Number of splices: Total | 19797517 Number of splices: Annotated (sjdb) | 19477367 Number of splices: GT/AG | 19507279 Number of splices: GC/AG | 231656 Number of splices: AT/AC | 17271 Number of splices: Non-canonical | 41311 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494105 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 192601 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1388029 1388029 1388029 N_multimapping 494105 494105 494105 N_noFeature 515780 11606811 11585364 N_ambiguous 320778 46137 45946 UnstrandedReadsAssigned:22069230 PositiveStrandReadsAssigned:11252840 NegativeStrandReadsAssigned:11274478 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14040100 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14040100-trimmed-pair1.fastq SRR14040100-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,787,922 reads, 22,976,109 reads pseudoaligned [quant] estimated average fragment length: 221.802 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52401 SRR14040100.ke.tsv 34699 SRR14040100.se.tsv 87100 total ==> SRR14040100.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.2 607 14.2474 Potri.005G024800.1.v4.1 1035 814.198 60 3.10859 Potri.004G059700.1.v4.1 961 740.198 23 1.31076 Potri.007G009000.2.v4.1 1416 1195.2 0 0 Potri.003G141000.2.v4.1 2943 2722.2 383.248 5.93885 Potri.016G087400.1.v4.1 270 89.4926 2305 1086.49 Potri.015G069301.1.v4.1 564 343.657 0 0 Potri.010G195200.1.v4.1 1773 1552.2 84 2.28284 Potri.012G127500.1.v4.1 977 756.198 7369 411.07 ==> SRR14040100.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2982 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 606 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 69 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR14040100 completed mapping pipeline successfully