Starting /dee2/code/volunteer_pipeline.sh SRR14040101 current disk space = 3050302164992 free memory = 1381824692 SRR14040101 SRAfilesize f743fc45c31ab4ac04b3ee85dbcd82aa SRR14040101.sra SRR14040101.sra file validated SRR14040101 is paired end SRR14040101 is conventional basespace SRR14040101 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040101_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1895 37.0 37.0 37.0 37.0 37.0 2 36.25725 37.0 37.0 37.0 37.0 37.0 3 36.374 37.0 37.0 37.0 37.0 37.0 4 36.4955 37.0 37.0 37.0 37.0 37.0 5 36.5035 37.0 37.0 37.0 37.0 37.0 6 36.471 37.0 37.0 37.0 37.0 37.0 7 36.417 37.0 37.0 37.0 37.0 37.0 8 36.414 37.0 37.0 37.0 37.0 37.0 9 36.4805 37.0 37.0 37.0 37.0 37.0 10-14 36.4376 37.0 37.0 37.0 37.0 37.0 15-19 36.413 37.0 37.0 37.0 37.0 37.0 20-24 36.3469 37.0 37.0 37.0 37.0 37.0 25-29 36.22430000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2371 37.0 37.0 37.0 37.0 37.0 35-39 36.13135 37.0 37.0 37.0 37.0 37.0 40-44 36.103899999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.8866 37.0 37.0 37.0 37.0 37.0 50-54 35.852999999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.6348 37.0 37.0 37.0 37.0 37.0 60-64 35.6818 37.0 37.0 37.0 37.0 37.0 65-69 35.59250000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.7607 37.0 37.0 37.0 37.0 37.0 75-79 35.8089 37.0 37.0 37.0 37.0 37.0 80-84 35.7685 37.0 37.0 37.0 37.0 37.0 85-89 35.638299999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.668600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.549400000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.466899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.44840000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.457100000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.370000000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.1491 37.0 37.0 37.0 32.2 37.0 125-129 35.0798 37.0 37.0 37.0 27.4 37.0 130-134 34.928399999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.9068 37.0 37.0 37.0 25.0 37.0 140-144 34.68075 37.0 37.0 37.0 25.0 37.0 145-149 34.56425 37.0 37.0 37.0 25.0 37.0 150 34.3635 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 1.0 19 2.0 20 2.0 21 1.0 22 6.0 23 12.0 24 4.0 25 4.0 26 17.0 27 28.0 28 22.0 29 45.0 30 60.0 31 94.0 32 92.0 33 172.0 34 180.0 35 363.0 36 2651.0 37 242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.625 17.375 12.9 32.1 2 22.18054513628407 22.05551387846962 29.9074768692173 25.85646411602901 3 24.3 21.3 27.750000000000004 26.650000000000002 4 27.875 26.474999999999998 19.7 25.95 5 28.025 30.15 21.85 19.975 6 21.95 35.675000000000004 23.474999999999998 18.9 7 18.75 23.925 38.975 18.35 8 20.325 25.55 29.175 24.95 9 23.0 24.349999999999998 29.425 23.225 10-14 22.13 30.014999999999997 26.215 21.64 15-19 21.965 28.355000000000004 27.365000000000002 22.314999999999998 20-24 22.34 28.645 26.87 22.145 25-29 22.02 28.4 26.900000000000002 22.68 30-34 21.92 28.42 27.245 22.415 35-39 22.106105305265263 28.32641632081604 26.616330816540827 22.95114755737787 40-44 22.155 28.125 26.87 22.85 45-49 22.45 27.655 27.3 22.595000000000002 50-54 22.235 27.860000000000003 27.095000000000002 22.81 55-59 22.825 28.01 27.250000000000004 21.915000000000003 60-64 22.715 27.169999999999998 27.365000000000002 22.75 65-69 22.45 27.49 27.634999999999998 22.425 70-74 23.765 27.27 26.974999999999998 21.990000000000002 75-79 23.669999999999998 27.500000000000004 26.265 22.564999999999998 80-84 23.625 26.93 26.919999999999998 22.525000000000002 85-89 23.724999999999998 27.74 26.36 22.175 90-94 23.405 27.455000000000002 26.810000000000002 22.33 95-99 23.544999999999998 28.095 25.805 22.555 100-104 23.695 27.22 26.840000000000003 22.245 105-109 24.060000000000002 27.6 25.805 22.535 110-114 23.919999999999998 27.805000000000003 26.045 22.23 115-119 23.794999999999998 27.83 25.669999999999998 22.705000000000002 120-124 23.794999999999998 27.400000000000002 26.240000000000002 22.564999999999998 125-129 24.41 26.91 25.835 22.845 130-134 24.095 27.52 25.95 22.435 135-139 24.465 27.634999999999998 25.96 21.94 140-144 24.661233061653082 27.456372818640933 25.631281564078208 22.25111255562778 145-149 25.10625531276564 26.696334816740837 25.35626781339067 22.841142057102857 150 24.175 26.674999999999997 26.0 23.150000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 2.0 24 0.0 25 0.5 26 3.5 27 5.0 28 8.0 29 11.5 30 11.5 31 22.0 32 26.0 33 26.0 34 39.0 35 58.0 36 72.0 37 87.5 38 113.5 39 151.0 40 189.5 41 197.0 42 196.0 43 228.0 44 256.0 45 270.5 46 282.5 47 260.5 48 228.0 49 196.5 50 177.0 51 167.5 52 144.5 53 112.5 54 84.0 55 61.0 56 46.0 57 36.5 58 33.0 59 32.0 60 23.5 61 14.5 62 9.5 63 7.0 64 5.0 65 4.5 66 4.0 67 6.5 68 11.5 69 12.0 70 9.0 71 8.5 72 10.5 73 11.5 74 9.5 75 6.5 76 2.5 77 1.5 78 1.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.66939529970954 90.575 2 3.9081066807499343 7.3999999999999995 3 0.2640612622128334 0.75 4 0.052812252442566675 0.2 5 0.026406126221283337 0.125 6 0.026406126221283337 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.052812252442566675 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGACAGTGCATCTCGTTT 21 0.525 TruSeq Adapter, Index 6 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGACAGTGCATCTCGGTT 11 0.27499999999999997 TruSeq Adapter, Index 6 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGACAGTGCATCGCGGTT 6 0.15 TruSeq Adapter, Index 6 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGACAGTGCATCTCGGAT 5 0.125 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0875 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.025 0.0 0.0 0.0 52-53 0.1125 0.025 0.0 0.0 0.0 54-55 0.15 0.025 0.0 0.0 0.0 56-57 0.15 0.025 0.0 0.0 0.0 58-59 0.15 0.025 0.0 0.0 0.0 60-61 0.1875 0.025 0.0 0.0 0.0 62-63 0.275 0.025 0.0 0.0 0.0 64-65 0.325 0.025 0.0 0.0 0.0 66-67 0.3375 0.025 0.0 0.0 0.0 68-69 0.35 0.025 0.0 0.0 0.0 70-71 0.4 0.025 0.0 0.0 0.0 72-73 0.5125 0.025 0.0 0.0 0.0 74-75 0.65 0.025 0.0 0.0 0.0 76-77 0.8 0.025 0.0 0.0 0.0 78-79 0.925 0.025 0.0 0.0 0.0 80-81 0.925 0.025 0.0 0.0 0.0 82-83 1.125 0.025 0.0 0.0 0.0 84-85 1.2875 0.025 0.0 0.0 0.0 86-87 1.45 0.025 0.0 0.0 0.0 88-89 1.7375 0.025 0.0 0.0 0.0 90-91 2.0625 0.025 0.0 0.0 0.0 92-93 2.2 0.025 0.0 0.0 0.0 94-95 2.3499999999999996 0.025 0.0 0.0 0.0 96-97 2.475 0.025 0.0 0.0 0.0 98-99 2.7750000000000004 0.025 0.0 0.0 0.0 100-101 3.1 0.025 0.0 0.0 0.0 102-103 3.3499999999999996 0.025 0.0 0.0 0.0 104-105 3.5375 0.025 0.0 0.0 0.0 106-107 3.85 0.025 0.0 0.0 0.0 108-109 4.2875 0.025 0.0 0.0 0.0 110-111 4.5875 0.025 0.0 0.0 0.0 112-113 4.875 0.025 0.0 0.0 0.0 114-115 5.137499999999999 0.025 0.0 0.0 0.0 116-117 5.4875 0.025 0.0 0.0 0.0 118-119 5.675 0.025 0.0 0.0 0.0 120-121 6.05 0.025 0.0 0.0 0.0 122-123 6.3125 0.025 0.0 0.0 0.0 124-125 6.675 0.025 0.0 0.0 0.0 126-127 7.15 0.025 0.0 0.0 0.0 128-129 7.5375 0.025 0.0 0.0 0.0 130-131 7.8625 0.025 0.0 0.0 0.0 132-133 8.275 0.025 0.0 0.0 0.0 134-135 8.8125 0.025 0.0 0.0 0.0 136-137 9.3125 0.025 0.0 0.0 0.0 138 9.65 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATAGA 10 0.006973645 144.0 1 GAGCACA 40 0.005777437 54.0 9 AAGAGCA 45 0.009205684 48.0 7 GAAGAGC 45 0.009205684 48.0 6 ATCGGAA 45 0.009205684 48.0 2 >>END_MODULE SRR14040101 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040101_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0525 37.0 37.0 37.0 37.0 37.0 2 36.017 37.0 37.0 37.0 37.0 37.0 3 36.109 37.0 37.0 37.0 37.0 37.0 4 36.2165 37.0 37.0 37.0 37.0 37.0 5 36.219 37.0 37.0 37.0 37.0 37.0 6 36.128 37.0 37.0 37.0 37.0 37.0 7 35.9995 37.0 37.0 37.0 37.0 37.0 8 36.1405 37.0 37.0 37.0 37.0 37.0 9 36.1665 37.0 37.0 37.0 37.0 37.0 10-14 36.0731 37.0 37.0 37.0 37.0 37.0 15-19 36.099599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.0044 37.0 37.0 37.0 37.0 37.0 25-29 35.8971 37.0 37.0 37.0 37.0 37.0 30-34 35.821999999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.716899999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.6685 37.0 37.0 37.0 37.0 37.0 45-49 35.621 37.0 37.0 37.0 37.0 37.0 50-54 35.6289 37.0 37.0 37.0 37.0 37.0 55-59 35.543400000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.5786 37.0 37.0 37.0 37.0 37.0 65-69 35.5481 37.0 37.0 37.0 37.0 37.0 70-74 35.474399999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.3719 37.0 37.0 37.0 37.0 37.0 80-84 35.419799999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.426199999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.42829999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.3965 37.0 37.0 37.0 37.0 37.0 100-104 35.376400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.2531 37.0 37.0 37.0 34.6 37.0 110-114 35.3061 37.0 37.0 37.0 37.0 37.0 115-119 35.20955 37.0 37.0 37.0 34.6 37.0 120-124 35.1202 37.0 37.0 37.0 32.2 37.0 125-129 34.95765 37.0 37.0 37.0 25.0 37.0 130-134 34.9855 37.0 37.0 37.0 25.0 37.0 135-139 34.840849999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.71545 37.0 37.0 37.0 25.0 37.0 145-149 34.65304999999999 37.0 37.0 37.0 25.0 37.0 150 34.611 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 7.0 16 7.0 17 5.0 18 5.0 19 8.0 20 6.0 21 12.0 22 18.0 23 19.0 24 18.0 25 23.0 26 19.0 27 26.0 28 30.0 29 44.0 30 29.0 31 61.0 32 60.0 33 84.0 34 159.0 35 426.0 36 2637.0 37 293.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.875 16.025 13.8 31.3 2 24.55 21.4 28.825 25.224999999999998 3 26.1 21.375 26.1 26.424999999999997 4 28.000000000000004 25.7 20.225 26.075 5 28.025 29.775000000000002 22.95 19.25 6 23.425 35.65 22.5 18.425 7 20.65 23.25 38.2 17.9 8 23.225 24.349999999999998 27.950000000000003 24.474999999999998 9 21.975 25.4 29.625 23.0 10-14 23.685000000000002 29.7 25.924999999999997 20.69 15-19 24.055 27.67 27.305 20.97 20-24 23.695 28.485 26.634999999999998 21.185000000000002 25-29 23.11 28.765 26.08 22.045 30-34 22.975 28.215 26.82 21.990000000000002 35-39 23.369999999999997 28.970000000000002 26.135 21.525 40-44 22.725 28.74 26.900000000000002 21.634999999999998 45-49 23.105 28.544999999999998 26.325 22.025 50-54 23.435 28.065 26.11 22.39 55-59 23.285 28.715000000000003 26.400000000000002 21.6 60-64 23.580000000000002 27.975 26.875 21.57 65-69 23.645 28.275 26.625 21.455 70-74 23.79 28.244999999999997 26.590000000000003 21.375 75-79 23.27 27.955000000000002 26.895000000000003 21.88 80-84 23.72 28.57 25.874999999999996 21.834999999999997 85-89 23.905 28.775000000000002 26.11 21.21 90-94 23.799999999999997 28.560000000000002 26.729999999999997 20.91 95-99 24.755 28.449999999999996 25.41 21.385 100-104 24.38 28.044999999999998 26.169999999999998 21.404999999999998 105-109 24.68 28.32 26.055 20.945 110-114 24.75 28.265 25.7 21.285 115-119 25.11125556277814 28.461423071153558 25.891294564728234 20.536026801340068 120-124 25.319999999999997 27.625 25.775 21.279999999999998 125-129 25.771288564428225 27.976398819940997 25.65128256412821 20.601030051502576 130-134 26.155 27.22 26.565 20.06 135-139 26.79133956697835 27.236361818090906 25.5962798139907 20.376018800940045 140-144 27.156357817890896 27.03635181759088 25.43127156357818 20.376018800940045 145-149 27.236361818090906 27.02135106755338 25.631281564078208 20.111005550277515 150 28.000000000000004 26.775 25.174999999999997 20.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 3.0 6 4.0 7 2.5 8 2.5 9 1.5 10 2.0 11 2.0 12 2.0 13 2.0 14 0.5 15 1.0 16 2.5 17 2.5 18 2.0 19 2.5 20 1.0 21 0.0 22 1.0 23 3.5 24 3.0 25 1.5 26 5.0 27 5.5 28 9.0 29 15.0 30 18.0 31 26.0 32 34.0 33 41.0 34 54.0 35 61.0 36 65.0 37 93.0 38 120.0 39 137.5 40 164.0 41 185.5 42 219.0 43 247.0 44 246.5 45 253.0 46 270.0 47 256.5 48 222.5 49 186.0 50 172.5 51 167.5 52 133.5 53 97.0 54 74.5 55 60.0 56 39.0 57 37.0 58 32.0 59 17.5 60 16.5 61 14.0 62 13.0 63 11.0 64 9.5 65 7.5 66 5.5 67 5.0 68 4.0 69 6.0 70 5.0 71 3.5 72 4.5 73 5.0 74 4.0 75 3.0 76 2.5 77 1.0 78 0.0 79 0.5 80 1.0 81 1.0 82 0.5 83 1.5 84 2.0 85 1.0 86 1.0 87 1.0 88 1.5 89 2.0 90 1.5 91 1.5 92 1.5 93 1.5 94 2.0 95 1.5 96 4.0 97 5.0 98 3.0 99 5.5 100 17.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.86297760210803 90.95 2 3.8735177865612647 7.35 3 0.1844532279314888 0.525 4 0.026350461133069828 0.1 5 0.026350461133069828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026350461133069828 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 38 0.95 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0875 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.1875 0.0 0.0 0.0 0.0 62-63 0.275 0.0 0.0 0.0 0.0 64-65 0.325 0.0 0.0 0.0 0.0 66-67 0.3375 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.4 0.0 0.0 0.0 0.0 72-73 0.5125 0.0 0.0 0.0 0.0 74-75 0.65 0.0 0.0 0.0 0.0 76-77 0.7875 0.0 0.0 0.0 0.0 78-79 0.9 0.0 0.0 0.0 0.0 80-81 0.9 0.0 0.0 0.0 0.0 82-83 1.1 0.0 0.0 0.0 0.0 84-85 1.2625 0.0 0.0 0.0 0.0 86-87 1.4625 0.0 0.0 0.0 0.0 88-89 1.7999999999999998 0.0 0.0 0.0 0.0 90-91 2.1375 0.0 0.0 0.0 0.0 92-93 2.3 0.0 0.0 0.0 0.0 94-95 2.45 0.0 0.0 0.0 0.0 96-97 2.6375 0.0 0.0 0.0 0.0 98-99 2.9749999999999996 0.0 0.0 0.0 0.0 100-101 3.3 0.0 0.0 0.0 0.0 102-103 3.55 0.0 0.0 0.0 0.0 104-105 3.7375 0.0 0.0 0.0 0.0 106-107 4.0375 0.0 0.0 0.0 0.0 108-109 4.5625 0.0 0.0 0.0 0.0 110-111 4.8625 0.0 0.0 0.0 0.0 112-113 5.15 0.0 0.0 0.0 0.0 114-115 5.387499999999999 0.0 0.0 0.0 0.0 116-117 5.7625 0.0 0.0 0.0 0.0 118-119 5.925 0.0 0.0 0.0 0.0 120-121 6.3125 0.0 0.0 0.0 0.0 122-123 6.6 0.0 0.0 0.0 0.0 124-125 6.975 0.0 0.0 0.0 0.0 126-127 7.475 0.0 0.0 0.0 0.0 128-129 7.862500000000001 0.0 0.0 0.0 0.0 130-131 8.2125 0.0 0.0 0.0 0.0 132-133 8.6375 0.0 0.0 0.0 0.0 134-135 9.2125 0.0 0.0 0.0 0.0 136-137 9.7375 0.0 0.0 0.0 0.0 138 10.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257085 spots for SRR14040101.sra Written 1257085 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra Read 1257082 spots for SRR14040101.sra Written 1257082 spots for SRR14040101.sra SRR ids: ['SRR14040101.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qtk80xnk SRR14040101.sra spots: 25141643 blocks: [[1, 1257082], [1257083, 2514164], [2514165, 3771246], [3771247, 5028328], [5028329, 6285410], [6285411, 7542492], [7542493, 8799574], [8799575, 10056656], [10056657, 11313738], [11313739, 12570820], [12570821, 13827902], [13827903, 15084984], [15084985, 16342066], [16342067, 17599148], [17599149, 18856230], [18856231, 20113312], [20113313, 21370394], [21370395, 22627476], [22627477, 23884558], [23884559, 25141643]] SRR14040101 file size 8473425 SRR14040101 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14040101 SRR14040101_1.fastq SRR14040101_2.fastq Input file: SRR14040101_1.fastq Paired file: SRR14040101_2.fastq trimmed: SRR14040101-trimmed-pair1.fastq, SRR14040101-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:13:46 2025 >> started Wed Feb 12 06:14:12 2025 >> done (26.338s) 25141643 read pairs processed; of these: 235 ( 0.00%) short read pairs filtered out after trimming by size control 359111 ( 1.43%) empty read pairs filtered out after trimming by size control 24782297 (98.57%) read pairs available; of these: 2914887 (11.76%) trimmed read pairs available after processing 21867410 (88.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 31 0.00% 20 28 0.00% 21 15 0.00% 22 31 0.00% 23 39 0.00% 24 37 0.00% 25 46 0.00% 26 46 0.00% 27 122 0.00% 28 105 0.00% 29 644 0.00% 30 154 0.00% 31 122 0.00% 32 150 0.00% 33 157 0.00% 34 200 0.00% 35 206 0.00% 36 287 0.00% 37 367 0.00% 38 468 0.00% 39 492 0.00% 40 636 0.00% 41 675 0.00% 42 766 0.00% 43 883 0.00% 44 864 0.00% 45 930 0.00% 46 1127 0.00% 47 1307 0.01% 48 1550 0.01% 49 1780 0.01% 50 2073 0.01% 51 2315 0.01% 52 2398 0.01% 53 2481 0.01% 54 2623 0.01% 55 2806 0.01% 56 3114 0.01% 57 3546 0.01% 58 4066 0.02% 59 4452 0.02% 60 5091 0.02% 61 5603 0.02% 62 5932 0.02% 63 6353 0.03% 64 6395 0.03% 65 6605 0.03% 66 6835 0.03% 67 7510 0.03% 68 7938 0.03% 69 8571 0.03% 70 9638 0.04% 71 10435 0.04% 72 10815 0.04% 73 11488 0.05% 74 11857 0.05% 75 12030 0.05% 76 12504 0.05% 77 13118 0.05% 78 13604 0.05% 79 14712 0.06% 80 15358 0.06% 81 16109 0.07% 82 17373 0.07% 83 18224 0.07% 84 18314 0.07% 85 18660 0.08% 86 18953 0.08% 87 19277 0.08% 88 19925 0.08% 89 20966 0.08% 90 22056 0.09% 91 22713 0.09% 92 24280 0.10% 93 24668 0.10% 94 25552 0.10% 95 26082 0.11% 96 25859 0.10% 97 25955 0.10% 98 26866 0.11% 99 27406 0.11% 100 28395 0.11% 101 29446 0.12% 102 30385 0.12% 103 31555 0.13% 104 32093 0.13% 105 32609 0.13% 106 32687 0.13% 107 32840 0.13% 108 33571 0.14% 109 34325 0.14% 110 35151 0.14% 111 35949 0.15% 112 36878 0.15% 113 38149 0.15% 114 38818 0.16% 115 39975 0.16% 116 39786 0.16% 117 39841 0.16% 118 39692 0.16% 119 40603 0.16% 120 41425 0.17% 121 41999 0.17% 122 43480 0.18% 123 44379 0.18% 124 45335 0.18% 125 46200 0.19% 126 46611 0.19% 127 46317 0.19% 128 46574 0.19% 129 46810 0.19% 130 48036 0.19% 131 48286 0.19% 132 49925 0.20% 133 51430 0.21% 134 52228 0.21% 135 52581 0.21% 136 53110 0.21% 137 53848 0.22% 138 54072 0.22% 139 53461 0.22% 140 54585 0.22% 141 54662 0.22% 142 55714 0.22% 143 57067 0.23% 144 58303 0.24% 145 59567 0.24% 146 59699 0.24% 147 60025 0.24% 148 60000 0.24% 149 60621 0.24% 150 21867410 88.24% 24782297 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=43 prefix-density=0.16 prefix-fanout=1.9 sequence=CAGTTGGGCACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=36 fanout-score=187.48 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=14.8 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=43 prefix-density=0.15 prefix-fanout=2.0 sequence=CAGTTGGGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=21.71 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.0 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTTACCGCCCGATTGGGGCTGCATTCCCAAACAACCCGACTCGCAGACAGCGCCTCGTGGTGCGGCAGGGTCCAGCCACGACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCTGGTCCGCCGCTGAGGACGCTTCTCCAGACTACAATTCGGACGCCGCAGGCGCCAGATTCTCAAGCT SRR14040101 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:14:57 Started mapping on | Feb 12 06:14:58 Finished on | Feb 12 06:17:19 Mapping speed, Million of reads per hour | 632.74 Number of input reads | 24782297 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 22054212 Uniquely mapped reads % | 88.99% Average mapped length | 290.33 Number of splices: Total | 17881105 Number of splices: Annotated (sjdb) | 17596115 Number of splices: GT/AG | 17633319 Number of splices: GC/AG | 197457 Number of splices: AT/AC | 14296 Number of splices: Non-canonical | 36033 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461453 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 1008012 % of reads mapped to too many loci | 4.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 1.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2266632 2266632 2266632 N_multimapping 461453 461453 461453 N_noFeature 444299 11175095 11039711 N_ambiguous 371757 44156 44613 UnstrandedReadsAssigned:21238156 PositiveStrandReadsAssigned:10834961 NegativeStrandReadsAssigned:10969888 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14040101 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14040101-trimmed-pair1.fastq SRR14040101-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,782,297 reads, 23,005,080 reads pseudoaligned [quant] estimated average fragment length: 225.903 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52401 SRR14040101.ke.tsv 34699 SRR14040101.se.tsv 87100 total ==> SRR14040101.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.1 608 14.601 Potri.005G024800.1.v4.1 1035 810.097 39 2.07306 Potri.004G059700.1.v4.1 961 736.097 12 0.701988 Potri.007G009000.2.v4.1 1416 1191.1 0 0 Potri.003G141000.2.v4.1 2943 2718.1 351.066 5.5617 Potri.016G087400.1.v4.1 270 86.1149 1948 974.079 Potri.015G069301.1.v4.1 564 339.417 0 0 Potri.010G195200.1.v4.1 1773 1548.1 101 2.80936 Potri.012G127500.1.v4.1 977 752.097 3303 189.112 ==> SRR14040101.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3416 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 711 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 68 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR14040101 completed mapping pipeline successfully