Starting /dee2/code/volunteer_pipeline.sh SRR14040103 current disk space = 3050341871616 free memory = 1388253180 SRR14040103 SRAfilesize f52610763f8478062e2f7fe72ce7056b SRR14040103.sra SRR14040103.sra file validated SRR14040103 is paired end SRR14040103 is conventional basespace SRR14040103 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040103_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2435 37.0 37.0 37.0 37.0 37.0 2 36.38275 37.0 37.0 37.0 37.0 37.0 3 36.38 37.0 37.0 37.0 37.0 37.0 4 36.499 37.0 37.0 37.0 37.0 37.0 5 36.544 37.0 37.0 37.0 37.0 37.0 6 36.481 37.0 37.0 37.0 37.0 37.0 7 36.472 37.0 37.0 37.0 37.0 37.0 8 36.5485 37.0 37.0 37.0 37.0 37.0 9 36.4225 37.0 37.0 37.0 37.0 37.0 10-14 36.4473 37.0 37.0 37.0 37.0 37.0 15-19 36.4668 37.0 37.0 37.0 37.0 37.0 20-24 36.392399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.3258 37.0 37.0 37.0 37.0 37.0 30-34 36.283300000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2466 37.0 37.0 37.0 37.0 37.0 40-44 36.2072 37.0 37.0 37.0 37.0 37.0 45-49 36.009299999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9676 37.0 37.0 37.0 37.0 37.0 55-59 35.8045 37.0 37.0 37.0 37.0 37.0 60-64 35.7676 37.0 37.0 37.0 37.0 37.0 65-69 35.6397 37.0 37.0 37.0 37.0 37.0 70-74 35.822500000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.9229 37.0 37.0 37.0 37.0 37.0 80-84 35.842499999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.8208 37.0 37.0 37.0 37.0 37.0 90-94 35.738600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.7299 37.0 37.0 37.0 37.0 37.0 100-104 35.6781 37.0 37.0 37.0 37.0 37.0 105-109 35.5749 37.0 37.0 37.0 37.0 37.0 110-114 35.572199999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.4636 37.0 37.0 37.0 37.0 37.0 120-124 35.2875 37.0 37.0 37.0 34.6 37.0 125-129 35.250099999999996 37.0 37.0 37.0 29.8 37.0 130-134 35.1337 37.0 37.0 37.0 27.4 37.0 135-139 35.0932 37.0 37.0 37.0 27.4 37.0 140-144 35.02275 37.0 37.0 37.0 25.0 37.0 145-149 34.8256 37.0 37.0 37.0 25.0 37.0 150 34.7585 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 4.0 23 8.0 24 4.0 25 7.0 26 15.0 27 18.0 28 34.0 29 47.0 30 52.0 31 67.0 32 82.0 33 146.0 34 204.0 35 323.0 36 2727.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.974999999999994 16.2 13.700000000000001 32.125 2 21.605401350337583 22.330582645661416 30.732683170792697 25.331332833208304 3 23.025000000000002 22.675 29.5 24.8 4 25.825 28.4 20.575 25.2 5 26.724999999999998 32.125 22.925 18.224999999999998 6 21.825 37.025000000000006 23.925 17.224999999999998 7 17.8 22.825 40.725 18.65 8 18.3 26.875 29.25 25.575 9 22.2 23.799999999999997 30.975 23.025000000000002 10-14 22.285 29.509999999999998 26.314999999999998 21.89 15-19 21.435000000000002 28.549999999999997 27.595 22.42 20-24 21.91 29.625 26.790000000000003 21.675 25-29 21.695 28.449999999999996 27.36 22.495 30-34 21.9 28.93 27.224999999999998 21.945 35-39 22.165000000000003 29.365000000000002 26.279999999999998 22.189999999999998 40-44 21.81 28.904999999999998 27.215 22.07 45-49 22.115000000000002 28.12 27.689999999999998 22.075 50-54 22.24 28.095 26.705000000000002 22.96 55-59 22.185 27.845 27.36 22.61 60-64 22.27 27.66 27.950000000000003 22.12 65-69 22.17 28.720000000000002 27.16 21.95 70-74 23.669999999999998 27.54 26.75 22.040000000000003 75-79 23.5 27.405 27.075 22.02 80-84 23.799999999999997 27.700000000000003 26.765 21.735 85-89 23.3 28.155 26.5 22.045 90-94 23.225 27.785 27.015 21.975 95-99 23.585 28.215 26.44 21.759999999999998 100-104 23.44 27.77 26.334999999999997 22.455 105-109 23.28 28.139999999999997 26.46 22.12 110-114 23.11 27.97 26.424999999999997 22.495 115-119 23.735 27.800000000000004 26.27 22.195 120-124 24.02 27.725 26.540000000000003 21.715 125-129 23.27 27.615000000000002 26.77 22.345000000000002 130-134 23.77 27.169999999999998 26.779999999999998 22.28 135-139 24.044999999999998 27.32 26.32 22.314999999999998 140-144 24.381219060953047 27.681384069203457 26.056302815140757 21.881094054702736 145-149 24.34 27.49 26.155 22.015 150 23.724999999999998 28.475 26.125 21.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 2.0 24 2.0 25 2.5 26 2.5 27 5.0 28 10.5 29 11.0 30 13.0 31 23.0 32 28.0 33 35.0 34 46.5 35 64.0 36 76.0 37 96.5 38 131.0 39 156.5 40 172.5 41 183.0 42 228.0 43 262.0 44 255.5 45 265.0 46 263.0 47 255.5 48 241.0 49 218.0 50 196.5 51 166.0 52 127.0 53 93.0 54 76.5 55 63.0 56 47.0 57 29.5 58 21.5 59 15.5 60 11.5 61 7.0 62 7.5 63 8.0 64 7.0 65 5.5 66 3.0 67 8.0 68 12.0 69 14.0 70 12.5 71 7.0 72 4.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.77947771036665 90.77499999999999 2 3.877604853600633 7.35 3 0.21102611448166714 0.6 4 0.026378264310208392 0.1 5 0.026378264310208392 0.125 6 0.026378264310208392 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026378264310208392 0.22499999999999998 >10 0.026378264310208392 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGACACATCTCGTAT 27 0.675 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGACACATCTCGTTT 9 0.22499999999999998 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGACACATCGCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGGACACATCGCGTTT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.55 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 0.9624999999999999 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.525 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.6500000000000004 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.0999999999999996 0.0 0.0 0.0 0.0 112-113 3.45 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.0625 0.0 0.0 0.0 0.0 118-119 4.362500000000001 0.0 0.0 0.0 0.0 120-121 4.550000000000001 0.0 0.0 0.0 0.0 122-123 4.8875 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.35 0.0 0.0 0.0 0.0 128-129 5.775 0.0 0.0 0.0 0.0 130-131 6.175 0.0 0.0 0.0 0.0 132-133 6.487500000000001 0.0 0.0 0.0 0.0 134-135 6.9375 0.0 0.0 0.0 0.0 136-137 7.525 0.0 0.0 0.0 0.0 138 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 40 0.005777437 54.0 9 AGAGCAC 40 0.005777437 54.0 8 AAAAAAA 40 3.1003024E-4 21.599998 75-79 >>END_MODULE SRR14040103 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14040103_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.225 37.0 37.0 37.0 37.0 37.0 2 36.0575 37.0 37.0 37.0 37.0 37.0 3 36.15 37.0 37.0 37.0 37.0 37.0 4 36.0945 37.0 37.0 37.0 37.0 37.0 5 36.28 37.0 37.0 37.0 37.0 37.0 6 36.0785 37.0 37.0 37.0 37.0 37.0 7 36.1135 37.0 37.0 37.0 37.0 37.0 8 36.1975 37.0 37.0 37.0 37.0 37.0 9 36.1055 37.0 37.0 37.0 37.0 37.0 10-14 36.0754 37.0 37.0 37.0 37.0 37.0 15-19 36.072 37.0 37.0 37.0 37.0 37.0 20-24 36.0905 37.0 37.0 37.0 37.0 37.0 25-29 35.879900000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.8009 37.0 37.0 37.0 37.0 37.0 35-39 35.7795 37.0 37.0 37.0 37.0 37.0 40-44 35.6899 37.0 37.0 37.0 37.0 37.0 45-49 35.6336 37.0 37.0 37.0 37.0 37.0 50-54 35.564 37.0 37.0 37.0 37.0 37.0 55-59 35.55389999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.5626 37.0 37.0 37.0 37.0 37.0 65-69 35.4929 37.0 37.0 37.0 37.0 37.0 70-74 35.47580000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.412400000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.4739 37.0 37.0 37.0 37.0 37.0 85-89 35.451499999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.4194 37.0 37.0 37.0 37.0 37.0 95-99 35.447500000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.392399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.381099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.3845 37.0 37.0 37.0 37.0 37.0 115-119 35.289550000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.2155 37.0 37.0 37.0 34.6 37.0 125-129 35.09250000000001 37.0 37.0 37.0 27.4 37.0 130-134 35.1369 37.0 37.0 37.0 29.8 37.0 135-139 35.00055 37.0 37.0 37.0 27.4 37.0 140-144 34.81035 37.0 37.0 37.0 25.0 37.0 145-149 34.848150000000004 37.0 37.0 37.0 25.0 37.0 150 34.5915 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 7.0 15 2.0 16 1.0 17 7.0 18 5.0 19 7.0 20 12.0 21 9.0 22 21.0 23 23.0 24 18.0 25 15.0 26 22.0 27 19.0 28 20.0 29 29.0 30 42.0 31 57.0 32 69.0 33 96.0 34 158.0 35 406.0 36 2632.0 37 322.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.2 16.375 13.350000000000001 32.074999999999996 2 24.224999999999998 20.724999999999998 31.5 23.549999999999997 3 25.674999999999997 23.175 27.85 23.3 4 29.45 26.25 20.474999999999998 23.825 5 28.199999999999996 31.4 21.575 18.825 6 22.8 35.6 24.575 17.025000000000002 7 22.55 21.3 39.125 17.025000000000002 8 22.375 23.375 30.3 23.95 9 24.325 24.675 28.849999999999998 22.15 10-14 23.555 30.005 26.009999999999998 20.43 15-19 23.669999999999998 28.38 26.974999999999998 20.974999999999998 20-24 23.105 28.87 26.465 21.560000000000002 25-29 23.65 28.904999999999998 26.450000000000003 20.995 30-34 23.605 28.494999999999997 26.47 21.43 35-39 23.825 28.549999999999997 26.265 21.36 40-44 23.64 28.904999999999998 25.965 21.490000000000002 45-49 23.880000000000003 28.275 26.61 21.235 50-54 23.330000000000002 28.71 26.525 21.435000000000002 55-59 23.73 28.415000000000003 26.21 21.645 60-64 24.275 28.315 26.345000000000002 21.065 65-69 23.595 28.110000000000003 27.169999999999998 21.125 70-74 23.025000000000002 28.765 26.950000000000003 21.26 75-79 23.189999999999998 29.049999999999997 26.005 21.755 80-84 23.345 28.915000000000003 26.575 21.165 85-89 23.91 27.845 26.51 21.735 90-94 23.5 27.860000000000003 26.484999999999996 22.155 95-99 24.205 27.965 26.495 21.335 100-104 24.33 28.49 26.05 21.13 105-109 24.335 27.689999999999998 26.705000000000002 21.27 110-114 24.279999999999998 28.189999999999998 26.064999999999998 21.465 115-119 24.8112405620281 28.366418320916047 26.121306065303262 20.701035051752587 120-124 24.740000000000002 28.044999999999998 26.185000000000002 21.029999999999998 125-129 25.069999999999997 28.110000000000003 26.314999999999998 20.505000000000003 130-134 25.240000000000002 28.265 25.669999999999998 20.825 135-139 25.186259312965646 27.661383069153455 26.161308065403272 20.991049552477623 140-144 25.38126906345317 27.486374318715935 26.3913195659783 20.741037051852594 145-149 25.961298064903243 27.371368568428423 26.3963198159908 20.271013550677534 150 26.325 26.0 26.400000000000002 21.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 1.0 5 2.0 6 2.0 7 1.5 8 1.5 9 1.5 10 2.0 11 3.5 12 3.5 13 2.5 14 1.5 15 3.0 16 2.5 17 0.5 18 1.5 19 2.5 20 2.5 21 2.0 22 2.5 23 2.0 24 3.0 25 4.5 26 3.0 27 4.5 28 10.5 29 15.0 30 20.5 31 27.0 32 30.5 33 36.5 34 46.0 35 63.5 36 86.0 37 93.5 38 112.0 39 154.5 40 172.5 41 186.0 42 219.0 43 248.5 44 260.5 45 258.0 46 244.0 47 243.5 48 237.5 49 209.0 50 185.0 51 151.0 52 124.5 53 106.5 54 84.5 55 60.0 56 42.5 57 32.0 58 22.5 59 15.0 60 8.0 61 7.0 62 7.5 63 8.0 64 6.0 65 2.5 66 1.5 67 2.0 68 2.0 69 0.5 70 0.5 71 0.5 72 1.5 73 1.5 74 0.5 75 0.5 76 1.5 77 3.0 78 2.5 79 1.5 80 1.0 81 1.0 82 1.5 83 1.5 84 1.5 85 1.5 86 1.5 87 1.5 88 1.0 89 0.5 90 2.0 91 3.0 92 2.0 93 3.5 94 3.0 95 1.5 96 2.5 97 4.5 98 3.0 99 3.0 100 24.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.005 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.525 #Duplication Level Percentage of deduplicated Percentage of total 1 96.03279555673102 90.77499999999999 2 3.7027241470510446 7.000000000000001 3 0.23803226659613858 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026448029621793177 1.55 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 62 1.55 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.5874999999999999 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 0.9624999999999999 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.525 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.85 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.3499999999999996 0.0 0.0 0.0 0.0 106-107 2.6875 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.0999999999999996 0.0 0.0 0.0 0.0 112-113 3.4875 0.0 0.0 0.0 0.0 114-115 3.775 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.487500000000001 0.0 0.0 0.0 0.0 120-121 4.675000000000001 0.0 0.0 0.0 0.0 122-123 5.050000000000001 0.0 0.0 0.0 0.0 124-125 5.3 0.0 0.0 0.0 0.0 126-127 5.55 0.0 0.0 0.0 0.0 128-129 5.987500000000001 0.0 0.0 0.0 0.0 130-131 6.387499999999999 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.2 0.0 0.0 0.0 0.0 136-137 7.85 0.0 0.0 0.0 0.0 138 8.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319402 spots for SRR14040103.sra Written 1319402 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra Read 1319386 spots for SRR14040103.sra Written 1319386 spots for SRR14040103.sra SRR ids: ['SRR14040103.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8lz7qz0g SRR14040103.sra spots: 26387736 blocks: [[1, 1319386], [1319387, 2638772], [2638773, 3958158], [3958159, 5277544], [5277545, 6596930], [6596931, 7916316], [7916317, 9235702], [9235703, 10555088], [10555089, 11874474], [11874475, 13193860], [13193861, 14513246], [14513247, 15832632], [15832633, 17152018], [17152019, 18471404], [18471405, 19790790], [19790791, 21110176], [21110177, 22429562], [22429563, 23748948], [23748949, 25068334], [25068335, 26387736]] SRR14040103 file size 8894468 SRR14040103 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14040103 SRR14040103_1.fastq SRR14040103_2.fastq Input file: SRR14040103_1.fastq Paired file: SRR14040103_2.fastq trimmed: SRR14040103-trimmed-pair1.fastq, SRR14040103-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:31:19 2025 >> started Wed Feb 12 06:31:49 2025 >> done (29.117s) 26387736 read pairs processed; of these: 166 ( 0.00%) short read pairs filtered out after trimming by size control 327168 ( 1.24%) empty read pairs filtered out after trimming by size control 26060402 (98.76%) read pairs available; of these: 2762991 (10.60%) trimmed read pairs available after processing 23297411 (89.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 12 0.00% 20 22 0.00% 21 15 0.00% 22 18 0.00% 23 30 0.00% 24 35 0.00% 25 36 0.00% 26 30 0.00% 27 78 0.00% 28 62 0.00% 29 398 0.00% 30 102 0.00% 31 79 0.00% 32 62 0.00% 33 105 0.00% 34 120 0.00% 35 162 0.00% 36 172 0.00% 37 203 0.00% 38 297 0.00% 39 350 0.00% 40 396 0.00% 41 448 0.00% 42 465 0.00% 43 471 0.00% 44 480 0.00% 45 584 0.00% 46 644 0.00% 47 784 0.00% 48 1002 0.00% 49 1067 0.00% 50 1309 0.01% 51 1446 0.01% 52 1486 0.01% 53 1670 0.01% 54 1658 0.01% 55 1837 0.01% 56 2077 0.01% 57 2271 0.01% 58 2670 0.01% 59 3035 0.01% 60 3303 0.01% 61 3754 0.01% 62 3940 0.02% 63 4196 0.02% 64 4443 0.02% 65 4502 0.02% 66 4791 0.02% 67 5240 0.02% 68 5639 0.02% 69 6389 0.02% 70 6956 0.03% 71 7505 0.03% 72 8351 0.03% 73 8673 0.03% 74 8967 0.03% 75 9119 0.03% 76 9440 0.04% 77 9819 0.04% 78 10646 0.04% 79 11545 0.04% 80 12434 0.05% 81 13131 0.05% 82 14102 0.05% 83 14550 0.06% 84 14895 0.06% 85 15468 0.06% 86 15646 0.06% 87 16292 0.06% 88 16923 0.06% 89 17752 0.07% 90 18728 0.07% 91 19470 0.07% 92 20640 0.08% 93 21725 0.08% 94 22576 0.09% 95 22565 0.09% 96 22826 0.09% 97 23355 0.09% 98 24071 0.09% 99 24919 0.10% 100 25613 0.10% 101 26860 0.10% 102 28257 0.11% 103 29403 0.11% 104 29866 0.11% 105 30401 0.12% 106 30925 0.12% 107 31147 0.12% 108 31804 0.12% 109 32095 0.12% 110 32697 0.13% 111 34775 0.13% 112 35369 0.14% 113 36412 0.14% 114 37533 0.14% 115 38513 0.15% 116 38134 0.15% 117 38720 0.15% 118 38934 0.15% 119 39537 0.15% 120 40128 0.15% 121 41538 0.16% 122 42670 0.16% 123 43646 0.17% 124 45242 0.17% 125 45896 0.18% 126 45737 0.18% 127 46168 0.18% 128 46402 0.18% 129 47342 0.18% 130 47617 0.18% 131 48680 0.19% 132 50252 0.19% 133 51672 0.20% 134 52289 0.20% 135 53523 0.21% 136 53830 0.21% 137 54079 0.21% 138 53678 0.21% 139 54466 0.21% 140 54942 0.21% 141 56256 0.22% 142 56500 0.22% 143 58738 0.23% 144 59519 0.23% 145 61218 0.23% 146 60577 0.23% 147 61855 0.24% 148 61445 0.24% 149 62604 0.24% 150 23297411 89.40% 26060402 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=44 prefix-density=0.13 prefix-fanout=2.0 sequence=CCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=266.54 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=48 prefix-density=0.12 prefix-fanout=1.9 sequence=CCCCTCTTGAGATCCAGGTTGATGGTCATCATTCCAGGCCTAAAGTCAAAGCTCTCCTTCACAATCTTAAGGATCTCCTTGTCAGGAATTTTTCCAGTGCCATAGGTGTCCACAAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=48 fanout-score=292.57 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCC SRR14040103 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:32:33 Started mapping on | Feb 12 06:32:33 Finished on | Feb 12 06:34:51 Mapping speed, Million of reads per hour | 679.84 Number of input reads | 26060402 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 24211314 Uniquely mapped reads % | 92.90% Average mapped length | 291.65 Number of splices: Total | 19887116 Number of splices: Annotated (sjdb) | 19563373 Number of splices: GT/AG | 19612653 Number of splices: GC/AG | 218406 Number of splices: AT/AC | 16361 Number of splices: Non-canonical | 39696 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.02% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445005 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 175411 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1404083 1404083 1404083 N_multimapping 445005 445005 445005 N_noFeature 462120 12186526 12163790 N_ambiguous 420819 49295 49208 UnstrandedReadsAssigned:23328375 PositiveStrandReadsAssigned:11975493 NegativeStrandReadsAssigned:11998316 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14040103 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14040103-trimmed-pair1.fastq SRR14040103-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,060,402 reads, 24,266,431 reads pseudoaligned [quant] estimated average fragment length: 229.967 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR14040103.ke.tsv 34699 SRR14040103.se.tsv 87100 total ==> SRR14040103.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.03 662 14.6928 Potri.005G024800.1.v4.1 1035 806.033 49 2.41384 Potri.004G059700.1.v4.1 961 732.038 35 1.89845 Potri.007G009000.2.v4.1 1416 1187.03 0 0 Potri.003G141000.2.v4.1 2943 2714.03 345 5.04742 Potri.016G087400.1.v4.1 270 83.9727 2223 1051.16 Potri.015G069301.1.v4.1 564 335.448 0 0 Potri.010G195200.1.v4.1 1773 1544.03 80 2.05731 Potri.012G127500.1.v4.1 977 748.033 4601 244.229 ==> SRR14040103.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4170 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 894 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 59 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR14040103 completed mapping pipeline successfully