Starting /dee2/code/volunteer_pipeline.sh SRR14322310 current disk space = 3051205246976 free memory = 1578739684 SRR14322310 SRAfilesize f3ef48b71e561f512c7c41105b11d8ab SRR14322310.sra SRR14322310.sra file validated SRR14322310 is paired end SRR14322310 is conventional basespace SRR14322310 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14322310_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.401 37.0 37.0 37.0 37.0 37.0 2 36.392 37.0 37.0 37.0 37.0 37.0 3 36.4395 37.0 37.0 37.0 37.0 37.0 4 36.469 37.0 37.0 37.0 37.0 37.0 5 36.5 37.0 37.0 37.0 37.0 37.0 6 36.4845 37.0 37.0 37.0 37.0 37.0 7 36.462 37.0 37.0 37.0 37.0 37.0 8 36.4755 37.0 37.0 37.0 37.0 37.0 9 36.4175 37.0 37.0 37.0 37.0 37.0 10-14 36.4952 37.0 37.0 37.0 37.0 37.0 15-19 36.4348 37.0 37.0 37.0 37.0 37.0 20-24 36.387299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.3409 37.0 37.0 37.0 37.0 37.0 30-34 36.294799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.259299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2549 37.0 37.0 37.0 37.0 37.0 45-49 36.2693 37.0 37.0 37.0 37.0 37.0 50-54 36.1497 37.0 37.0 37.0 37.0 37.0 55-59 36.127500000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.0723 37.0 37.0 37.0 37.0 37.0 65-69 36.013999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0473 37.0 37.0 37.0 37.0 37.0 75-79 35.9934 37.0 37.0 37.0 37.0 37.0 80-84 35.968 37.0 37.0 37.0 37.0 37.0 85-89 35.8923 37.0 37.0 37.0 37.0 37.0 90-94 35.81609999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.8272 37.0 37.0 37.0 37.0 37.0 100-104 35.8247 37.0 37.0 37.0 37.0 37.0 105-109 35.852 37.0 37.0 37.0 37.0 37.0 110-114 35.753 37.0 37.0 37.0 37.0 37.0 115-119 35.7996 37.0 37.0 37.0 37.0 37.0 120-124 35.6413 37.0 37.0 37.0 37.0 37.0 125-129 35.6644 37.0 37.0 37.0 37.0 37.0 130-134 35.5313 37.0 37.0 37.0 37.0 37.0 135-139 35.4731 37.0 37.0 37.0 37.0 37.0 140-144 35.491600000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.394099999999995 37.0 37.0 37.0 34.6 37.0 150 35.426 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 1.0 25 4.0 26 10.0 27 10.0 28 26.0 29 39.0 30 58.0 31 56.0 32 78.0 33 104.0 34 114.0 35 339.0 36 2948.0 37 211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.175 16.1 15.049999999999999 33.675 2 23.525 18.9 33.6 23.974999999999998 3 22.900000000000002 21.275 28.7 27.125 4 25.95 25.25 21.099999999999998 27.700000000000003 5 25.374999999999996 29.599999999999998 24.075 20.95 6 20.95 36.85 23.674999999999997 18.525 7 18.3 22.975 39.0 19.725 8 18.525 25.924999999999997 30.3 25.25 9 20.8 24.3 32.95 21.95 10-14 21.13 30.075000000000003 27.015 21.78 15-19 21.82 28.110000000000003 27.950000000000003 22.12 20-24 21.34 28.294999999999998 27.794999999999998 22.57 25-29 21.65 27.939999999999998 27.265 23.145 30-34 21.09 27.96 28.084999999999997 22.865 35-39 21.41 28.07 27.57 22.95 40-44 21.34 28.294999999999998 27.625 22.74 45-49 21.529999999999998 28.355000000000004 27.85 22.264999999999997 50-54 22.17 28.189999999999998 27.16 22.48 55-59 21.67 27.279999999999998 28.035 23.015 60-64 21.55 27.439999999999998 28.134999999999998 22.875 65-69 22.16 27.894999999999996 27.61 22.335 70-74 21.905 28.12 27.405 22.57 75-79 22.07 28.03 26.845000000000002 23.055 80-84 22.384999999999998 28.494999999999997 27.284999999999997 21.834999999999997 85-89 22.259999999999998 26.77 27.865000000000002 23.105 90-94 22.705000000000002 27.965 27.235 22.095000000000002 95-99 22.585 27.565 27.41 22.439999999999998 100-104 22.63 27.500000000000004 27.779999999999998 22.09 105-109 22.625 27.675 27.445000000000004 22.255 110-114 22.705000000000002 27.71 27.265 22.32 115-119 22.255 27.900000000000002 26.99 22.855 120-124 21.965 27.224999999999998 28.405 22.405 125-129 22.605 27.865000000000002 27.134999999999998 22.395 130-134 21.76717671767177 26.887688768876888 28.18781878187819 23.157315731573156 135-139 22.695 27.375 27.395000000000003 22.535 140-144 22.035 27.439999999999998 28.125 22.400000000000002 145-149 22.48 26.640000000000004 28.24 22.64 150 21.325 28.4 28.7 21.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.0 25 1.0 26 1.5 27 3.5 28 5.0 29 11.0 30 23.0 31 26.0 32 27.0 33 37.0 34 47.5 35 61.0 36 81.5 37 87.5 38 113.0 39 157.0 40 192.5 41 205.0 42 215.5 43 254.0 44 279.5 45 288.0 46 256.0 47 238.0 48 240.0 49 216.5 50 192.5 51 151.0 52 119.0 53 98.5 54 77.5 55 62.5 56 55.0 57 44.0 58 32.0 59 26.0 60 12.5 61 9.5 62 11.5 63 9.0 64 5.0 65 4.0 66 4.5 67 3.0 68 2.0 69 1.5 70 0.5 71 1.0 72 1.0 73 1.5 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.25 #Duplication Level Percentage of deduplicated Percentage of total 1 89.66386554621849 80.025 2 8.823529411764707 15.75 3 1.3725490196078431 3.675 4 0.08403361344537816 0.3 5 0.05602240896358543 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGCTTCAAGTGCCTTTTGATTGAATCTCTTAGAGCCATCACGCCTTG 5 0.125 No Hit CTACAGTGCAAGGGCTGGGGTGTCCCTCCCAACACCCTAGCAGAATATGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.025 0.025 0.0 0.0 0.0 118-119 0.0875 0.025 0.0 0.0 0.0 120-121 0.1 0.025 0.0 0.0 0.0 122-123 0.1 0.025 0.0 0.0 0.0 124-125 0.1 0.025 0.0 0.0 0.0 126-127 0.1 0.025 0.0 0.0 0.0 128-129 0.1 0.025 0.0 0.0 0.0 130-131 0.1 0.025 0.0 0.0 0.0 132-133 0.1 0.025 0.0 0.0 0.0 134-135 0.1 0.025 0.0 0.0 0.0 136-137 0.15 0.025 0.0 0.0 0.0 138 0.15 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14322310 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14322310_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0925 37.0 37.0 37.0 37.0 37.0 2 35.9195 37.0 37.0 37.0 37.0 37.0 3 36.014 37.0 37.0 37.0 37.0 37.0 4 36.19 37.0 37.0 37.0 37.0 37.0 5 36.1075 37.0 37.0 37.0 37.0 37.0 6 36.078 37.0 37.0 37.0 37.0 37.0 7 36.0695 37.0 37.0 37.0 37.0 37.0 8 36.041 37.0 37.0 37.0 37.0 37.0 9 36.279 37.0 37.0 37.0 37.0 37.0 10-14 36.0826 37.0 37.0 37.0 37.0 37.0 15-19 36.0954 37.0 37.0 37.0 37.0 37.0 20-24 36.11280000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.023599999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.0545 37.0 37.0 37.0 37.0 37.0 35-39 36.0477 37.0 37.0 37.0 37.0 37.0 40-44 35.9381 37.0 37.0 37.0 37.0 37.0 45-49 35.958800000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.79350000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.8729 37.0 37.0 37.0 37.0 37.0 60-64 35.8268 37.0 37.0 37.0 37.0 37.0 65-69 35.7983 37.0 37.0 37.0 37.0 37.0 70-74 35.8396 37.0 37.0 37.0 37.0 37.0 75-79 35.7749 37.0 37.0 37.0 37.0 37.0 80-84 35.678 37.0 37.0 37.0 37.0 37.0 85-89 35.64790000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.5349 37.0 37.0 37.0 37.0 37.0 95-99 35.436099999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.483700000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.400999999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.4797 37.0 37.0 37.0 37.0 37.0 115-119 35.4147 37.0 37.0 37.0 34.6 37.0 120-124 35.3351 37.0 37.0 37.0 32.2 37.0 125-129 35.1471 37.0 37.0 37.0 27.4 37.0 130-134 35.3356 37.0 37.0 37.0 34.6 37.0 135-139 35.148700000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.923899999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.9695 37.0 37.0 37.0 25.0 37.0 150 34.837 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 3.0 19 1.0 20 1.0 21 3.0 22 3.0 23 3.0 24 5.0 25 2.0 26 17.0 27 22.0 28 23.0 29 38.0 30 44.0 31 49.0 32 78.0 33 106.0 34 203.0 35 751.0 36 2561.0 37 83.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.2 16.425 15.35 35.025 2 22.35 19.675 32.05 25.924999999999997 3 22.400000000000002 20.375 27.85 29.375 4 25.124999999999996 25.775 21.95 27.150000000000002 5 27.400000000000002 29.675 22.2 20.724999999999998 6 20.95 35.099999999999994 22.75 21.2 7 18.0 23.375 39.25 19.375 8 19.475 25.474999999999998 31.15 23.9 9 20.375 24.95 32.625 22.05 10-14 21.48 29.715000000000003 27.755000000000003 21.05 15-19 20.974999999999998 28.29 27.955000000000002 22.78 20-24 21.295 28.904999999999998 27.265 22.535 25-29 20.8970897089709 27.86278627862786 28.397839783978394 22.842284228422844 30-34 21.33 28.139999999999997 28.455000000000002 22.075 35-39 21.115000000000002 27.915 27.389999999999997 23.580000000000002 40-44 21.952195219521954 28.04280428042804 27.75777577757776 22.247224722472247 45-49 21.955 28.294999999999998 27.05 22.7 50-54 21.77153145943783 28.55856757027108 27.463238971691506 22.206661998599582 55-59 22.205 28.749999999999996 26.314999999999998 22.73 60-64 21.727172717271728 28.267826782678267 27.462746274627463 22.542254225422543 65-69 21.91219121912191 27.88278827882788 27.247724772477248 22.95729572957296 70-74 22.555 27.815 26.979999999999997 22.650000000000002 75-79 21.789357871574314 28.155631126225245 27.18043608721744 22.874574914982997 80-84 21.697169716971697 28.11781178117812 27.22772277227723 22.95729572957296 85-89 22.255 28.249999999999996 26.68 22.814999999999998 90-94 21.857185718571856 28.377837783778375 27.17271727172717 22.592259225922593 95-99 22.717271727172715 27.607760776077605 27.707770777077705 21.967196719671968 100-104 22.425 27.955000000000002 27.045 22.575 105-109 22.487248724872487 28.457845784578456 26.777677767776776 22.277227722772277 110-114 23.03230323032303 27.547754775477546 26.972697269726975 22.447244724472448 115-119 22.685 28.34 26.525 22.45 120-124 22.645 29.09 26.150000000000002 22.115000000000002 125-129 22.29891956782713 27.85614245698279 26.925770308123248 22.919167667066827 130-134 22.775000000000002 28.27 26.365 22.59 135-139 22.71 27.860000000000003 27.095000000000002 22.335 140-144 22.349469893978796 28.380676135227045 27.025405081016203 22.244448889777956 145-149 22.415 27.555000000000003 27.63 22.400000000000002 150 22.1 29.125 26.825 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 2.5 27 5.0 28 8.0 29 12.0 30 14.0 31 19.0 32 30.0 33 39.0 34 47.0 35 54.0 36 66.5 37 102.5 38 134.0 39 154.0 40 185.5 41 216.0 42 244.0 43 272.0 44 276.0 45 257.0 46 255.5 47 246.0 48 223.5 49 209.5 50 178.5 51 135.5 52 118.5 53 111.0 54 90.0 55 70.5 56 55.0 57 42.5 58 26.5 59 16.5 60 13.5 61 13.0 62 12.0 63 7.5 64 4.0 65 2.5 66 2.5 67 1.5 68 1.0 69 1.5 70 1.5 71 0.5 72 2.0 73 2.0 74 0.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.03 55-59 0.0 60-64 0.01 65-69 0.01 70-74 0.0 75-79 0.02 80-84 0.01 85-89 0.0 90-94 0.01 95-99 0.01 100-104 0.0 105-109 0.01 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.04 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.51952795729137 79.65 2 8.850800786737848 15.75 3 1.4329867940432706 3.8249999999999997 4 0.112391121101433 0.4 5 0.08429334082607474 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCC 5 0.125 No Hit AAAGAAAATCGTTGAGTTCAGTACTGTTGAAGGTTTTTGGGTCTGCTATT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0125 0.0 0.0 0.0 0.0 118-119 0.0625 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.1 0.0 0.0 0.0 0.0 132-133 0.1 0.0 0.0 0.0 0.0 134-135 0.1 0.0 0.0 0.0 0.0 136-137 0.15 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439294 spots for SRR14322310.sra Written 3439294 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra Read 3439280 spots for SRR14322310.sra Written 3439280 spots for SRR14322310.sra SRR ids: ['SRR14322310.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ns_q6i5c SRR14322310.sra spots: 68785614 blocks: [[1, 3439280], [3439281, 6878560], [6878561, 10317840], [10317841, 13757120], [13757121, 17196400], [17196401, 20635680], [20635681, 24074960], [24074961, 27514240], [27514241, 30953520], [30953521, 34392800], [34392801, 37832080], [37832081, 41271360], [41271361, 44710640], [44710641, 48149920], [48149921, 51589200], [51589201, 55028480], [55028481, 58467760], [58467761, 61907040], [61907041, 65346320], [65346321, 68785614]] SRR14322310 file size 23220313 SRR14322310 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14322310 SRR14322310_1.fastq SRR14322310_2.fastq Input file: SRR14322310_1.fastq Paired file: SRR14322310_2.fastq trimmed: SRR14322310-trimmed-pair1.fastq, SRR14322310-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:37:13 2025 >> started Wed Feb 12 13:38:33 2025 >> done (79.831s) 68785614 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 1902 ( 0.00%) empty read pairs filtered out after trimming by size control 68783693 (100.00%) read pairs available; of these: 292251 ( 0.42%) trimmed read pairs available after processing 68491442 (99.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 0 0.00% 20 5 0.00% 21 6 0.00% 22 8 0.00% 23 10 0.00% 24 8 0.00% 25 11 0.00% 26 10 0.00% 27 12 0.00% 28 23 0.00% 29 20 0.00% 30 32 0.00% 31 21 0.00% 32 32 0.00% 33 21 0.00% 34 27 0.00% 35 37 0.00% 36 42 0.00% 37 36 0.00% 38 45 0.00% 39 45 0.00% 40 38 0.00% 41 33 0.00% 42 46 0.00% 43 49 0.00% 44 47 0.00% 45 55 0.00% 46 52 0.00% 47 61 0.00% 48 63 0.00% 49 44 0.00% 50 60 0.00% 51 71 0.00% 52 55 0.00% 53 77 0.00% 54 76 0.00% 55 71 0.00% 56 75 0.00% 57 88 0.00% 58 82 0.00% 59 100 0.00% 60 121 0.00% 61 124 0.00% 62 99 0.00% 63 127 0.00% 64 106 0.00% 65 132 0.00% 66 137 0.00% 67 126 0.00% 68 134 0.00% 69 161 0.00% 70 149 0.00% 71 177 0.00% 72 220 0.00% 73 229 0.00% 74 276 0.00% 75 247 0.00% 76 248 0.00% 77 296 0.00% 78 264 0.00% 79 317 0.00% 80 337 0.00% 81 342 0.00% 82 348 0.00% 83 417 0.00% 84 486 0.00% 85 509 0.00% 86 496 0.00% 87 499 0.00% 88 522 0.00% 89 597 0.00% 90 593 0.00% 91 662 0.00% 92 676 0.00% 93 803 0.00% 94 813 0.00% 95 871 0.00% 96 889 0.00% 97 878 0.00% 98 942 0.00% 99 997 0.00% 100 1011 0.00% 101 1134 0.00% 102 1207 0.00% 103 1300 0.00% 104 1518 0.00% 105 1541 0.00% 106 1584 0.00% 107 1629 0.00% 108 1663 0.00% 109 1793 0.00% 110 1822 0.00% 111 1980 0.00% 112 2139 0.00% 113 2357 0.00% 114 2405 0.00% 115 2629 0.00% 116 2691 0.00% 117 2899 0.00% 118 3038 0.00% 119 3076 0.00% 120 3338 0.00% 121 3492 0.01% 122 3743 0.01% 123 3960 0.01% 124 4173 0.01% 125 4513 0.01% 126 4904 0.01% 127 4785 0.01% 128 5210 0.01% 129 5222 0.01% 130 5516 0.01% 131 6035 0.01% 132 6213 0.01% 133 6559 0.01% 134 6890 0.01% 135 7620 0.01% 136 8127 0.01% 137 8393 0.01% 138 8631 0.01% 139 8774 0.01% 140 9216 0.01% 141 9611 0.01% 142 10343 0.02% 143 10976 0.02% 144 11414 0.02% 145 12264 0.02% 146 12910 0.02% 147 13299 0.02% 148 13993 0.02% 149 14643 0.02% 150 68491442 99.58% 68783693 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=1.9 sequence=CGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTGACTGGAGCAACTCCGGCAATGATCGTCTGACTTGTGGTGGTCTCGGAGAAGCTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=34.08 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=2.9 sequence=TGCAAGTGCAGTTAGCGCCGCACTTGCA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=1.9 sequence=CGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTGACTGGAGCAACTCCGGCAATGATCGTCTGACTTGTGGTGGTCTCGGAGAAGCTCAAGTCTGGGTACATGCTGCATCCATTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=101.54 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.5 sequence=AAAGCAGCAGGAAACACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGCGGCCATGGCTAGCTAACTGTACTCTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCG SRR14322310 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 12 14:21:19 Started mapping on | Feb 12 14:21:22 Finished on | Feb 12 14:31:20 Mapping speed, Million of reads per hour | 414.08 Number of input reads | 68783325 Average input read length | 259 UNIQUE READS: Uniquely mapped reads number | 60994642 Uniquely mapped reads % | 88.68% Average mapped length | 255.04 Number of splices: Total | 54863375 Number of splices: Annotated (sjdb) | 53625320 Number of splices: GT/AG | 53719084 Number of splices: GC/AG | 761000 Number of splices: AT/AC | 43648 Number of splices: Non-canonical | 339643 Mismatch rate per base, % | 1.96% Deletion rate per base | 0.10% Deletion average length | 3.27 Insertion rate per base | 0.07% Insertion average length | 3.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2624847 % of reads mapped to multiple loci | 3.82% Number of reads mapped to too many loci | 840147 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.84% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5163836 5163836 5163836 N_multimapping 2624847 2624847 2624847 N_noFeature 1483829 30919822 31069909 N_ambiguous 1017083 265645 264424 UnstrandedReadsAssigned:58493730 PositiveStrandReadsAssigned:29809175 NegativeStrandReadsAssigned:29660309 Dataset is classified unstranded MeadianReadLen=130 20thPercentileLength=130 echo kmer=125 SRR14322310 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14322310-trimmed-pair1.fastq SRR14322310-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 68,783,325 reads, 56,423,244 reads pseudoaligned [quant] estimated average fragment length: 268.188 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52401 SRR14322310.ke.tsv 34699 SRR14322310.se.tsv 87100 total ==> SRR14322310.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.81 3111 26.5106 Potri.005G024800.1.v4.1 1035 767.812 824 16.0115 Potri.004G059700.1.v4.1 961 693.832 1 0.0215033 Potri.007G009000.2.v4.1 1416 1148.81 0 0 Potri.003G141000.2.v4.1 2943 2675.81 1031.8 5.75308 Potri.016G087400.1.v4.1 270 59.4296 1809 454.145 Potri.015G069301.1.v4.1 564 297.713 0 0 Potri.010G195200.1.v4.1 1773 1505.81 334.916 3.31836 Potri.012G127500.1.v4.1 977 709.827 29350 616.899 ==> SRR14322310.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 943 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR14322310 completed mapping pipeline successfully