Starting /dee2/code/volunteer_pipeline.sh SRR14322311 current disk space = 3051235721216 free memory = 1575637588 SRR14322311 SRAfilesize 094f6f0fcf932bd5f967f01515f9a573 SRR14322311.sra SRR14322311.sra file validated SRR14322311 is paired end SRR14322311 is conventional basespace SRR14322311 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14322311_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.375 37.0 37.0 37.0 37.0 37.0 2 36.4685 37.0 37.0 37.0 37.0 37.0 3 36.4995 37.0 37.0 37.0 37.0 37.0 4 36.5045 37.0 37.0 37.0 37.0 37.0 5 36.47 37.0 37.0 37.0 37.0 37.0 6 36.5875 37.0 37.0 37.0 37.0 37.0 7 36.529 37.0 37.0 37.0 37.0 37.0 8 36.453 37.0 37.0 37.0 37.0 37.0 9 36.462 37.0 37.0 37.0 37.0 37.0 10-14 36.54549999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.4836 37.0 37.0 37.0 37.0 37.0 20-24 36.46900000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.3942 37.0 37.0 37.0 37.0 37.0 30-34 36.325 37.0 37.0 37.0 37.0 37.0 35-39 36.2936 37.0 37.0 37.0 37.0 37.0 40-44 36.329499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.277100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2639 37.0 37.0 37.0 37.0 37.0 55-59 36.200399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.1872 37.0 37.0 37.0 37.0 37.0 65-69 36.126200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1365 37.0 37.0 37.0 37.0 37.0 75-79 36.0965 37.0 37.0 37.0 37.0 37.0 80-84 36.0909 37.0 37.0 37.0 37.0 37.0 85-89 36.0544 37.0 37.0 37.0 37.0 37.0 90-94 35.9006 37.0 37.0 37.0 37.0 37.0 95-99 35.950599999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.9191 37.0 37.0 37.0 37.0 37.0 105-109 35.9639 37.0 37.0 37.0 37.0 37.0 110-114 35.8982 37.0 37.0 37.0 37.0 37.0 115-119 35.9249 37.0 37.0 37.0 37.0 37.0 120-124 35.7745 37.0 37.0 37.0 37.0 37.0 125-129 35.801 37.0 37.0 37.0 37.0 37.0 130-134 35.6698 37.0 37.0 37.0 37.0 37.0 135-139 35.591899999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.652499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.5457 37.0 37.0 37.0 37.0 37.0 150 35.52 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 4.0 25 5.0 26 8.0 27 12.0 28 23.0 29 24.0 30 23.0 31 43.0 32 66.0 33 105.0 34 148.0 35 321.0 36 2923.0 37 290.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.2 16.925 14.575 34.300000000000004 2 23.3 19.775000000000002 32.525 24.4 3 22.0 20.525 28.825 28.65 4 26.724999999999998 25.074999999999996 20.9 27.3 5 28.499999999999996 27.625 23.425 20.45 6 21.099999999999998 36.75 22.975 19.175 7 18.075 24.3 38.324999999999996 19.3 8 18.675 25.974999999999998 31.45 23.9 9 19.875 23.925 32.65 23.549999999999997 10-14 21.349999999999998 29.439999999999998 27.025 22.185 15-19 20.95 28.02 28.299999999999997 22.73 20-24 21.7 27.675 27.845 22.78 25-29 21.2 27.845 27.725 23.23 30-34 21.525 27.839999999999996 27.529999999999998 23.105 35-39 20.995 28.09 27.365000000000002 23.549999999999997 40-44 21.195 27.575 27.815 23.415 45-49 21.265 27.615000000000002 28.18 22.939999999999998 50-54 22.255 28.055000000000003 26.815 22.875 55-59 21.375 28.16 27.279999999999998 23.185 60-64 22.055 27.334999999999997 27.405 23.205000000000002 65-69 22.205 27.455000000000002 27.474999999999998 22.865 70-74 22.040000000000003 27.015 27.650000000000002 23.294999999999998 75-79 22.535 27.905 26.490000000000002 23.07 80-84 21.975 27.794999999999998 27.05 23.18 85-89 22.8 27.765 26.740000000000002 22.695 90-94 21.955 27.639999999999997 26.68 23.724999999999998 95-99 22.05 27.744999999999997 27.47 22.735 100-104 22.36 27.36 27.355 22.925 105-109 22.264999999999997 27.73 27.060000000000002 22.945 110-114 22.31 27.284999999999997 27.150000000000002 23.255 115-119 22.215 27.72 26.76 23.305 120-124 22.45 27.075 27.615000000000002 22.86 125-129 22.395 26.97 28.235 22.400000000000002 130-134 22.81 27.22 27.474999999999998 22.495 135-139 22.245 26.745 28.050000000000004 22.96 140-144 23.080000000000002 27.195000000000004 27.415 22.31 145-149 23.01 27.224999999999998 27.68 22.085 150 23.575 26.200000000000003 26.450000000000003 23.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.5 27 5.0 28 6.5 29 9.0 30 9.5 31 15.5 32 29.0 33 30.0 34 31.5 35 44.0 36 68.0 37 93.5 38 112.0 39 139.0 40 171.5 41 200.5 42 229.0 43 255.5 44 282.0 45 278.0 46 257.5 47 250.0 48 239.0 49 224.5 50 193.5 51 168.0 52 146.5 53 119.0 54 95.5 55 65.0 56 51.0 57 49.0 58 35.0 59 21.0 60 17.5 61 16.0 62 10.5 63 6.0 64 6.0 65 6.5 66 2.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.175 #Duplication Level Percentage of deduplicated Percentage of total 1 87.97845194216048 77.575 2 10.80238162744542 19.05 3 1.1057555996597674 2.9250000000000003 4 0.08505812305075135 0.3 5 0.0 0.0 6 0.02835270768358378 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACCCCAAGTCTTTTAGATCATCCATCTAAGCTTA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.037500000000000006 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1125 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.15 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.175 0.0 0.0 0.0 0.0 132-133 0.225 0.0 0.0 0.0 0.0 134-135 0.2375 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCTTT 10 0.006973645 144.0 1 >>END_MODULE SRR14322311 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14322311_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.276 37.0 37.0 37.0 37.0 37.0 2 36.0365 37.0 37.0 37.0 37.0 37.0 3 36.2435 37.0 37.0 37.0 37.0 37.0 4 36.273 37.0 37.0 37.0 37.0 37.0 5 36.25 37.0 37.0 37.0 37.0 37.0 6 36.2225 37.0 37.0 37.0 37.0 37.0 7 36.162 37.0 37.0 37.0 37.0 37.0 8 36.305 37.0 37.0 37.0 37.0 37.0 9 36.245 37.0 37.0 37.0 37.0 37.0 10-14 36.221199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2497 37.0 37.0 37.0 37.0 37.0 20-24 36.2063 37.0 37.0 37.0 37.0 37.0 25-29 36.1289 37.0 37.0 37.0 37.0 37.0 30-34 36.1414 37.0 37.0 37.0 37.0 37.0 35-39 36.200399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.090900000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.054700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0323 37.0 37.0 37.0 37.0 37.0 55-59 36.003499999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9669 37.0 37.0 37.0 37.0 37.0 65-69 35.8911 37.0 37.0 37.0 37.0 37.0 70-74 35.92470000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.925599999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.775099999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.84689999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.7596 37.0 37.0 37.0 37.0 37.0 95-99 35.70719999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.701800000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.6403 37.0 37.0 37.0 37.0 37.0 110-114 35.57190000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.5776 37.0 37.0 37.0 37.0 37.0 120-124 35.4953 37.0 37.0 37.0 37.0 37.0 125-129 35.44075 37.0 37.0 37.0 37.0 37.0 130-134 35.414899999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.404799999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.23270000000001 37.0 37.0 37.0 29.8 37.0 145-149 35.2033 37.0 37.0 37.0 29.8 37.0 150 35.127 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 4.0 16 4.0 17 2.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 4.0 24 8.0 25 9.0 26 7.0 27 7.0 28 15.0 29 22.0 30 29.0 31 50.0 32 65.0 33 96.0 34 178.0 35 596.0 36 2770.0 37 126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.55 15.65 13.725000000000001 35.075 2 23.025000000000002 20.375 32.875 23.724999999999998 3 24.05 20.05 27.425 28.475 4 25.124999999999996 25.074999999999996 21.575 28.225 5 25.4 28.9 24.125 21.575 6 21.625 35.125 23.724999999999998 19.525000000000002 7 18.375 23.65 39.050000000000004 18.925 8 19.45 25.624999999999996 31.624999999999996 23.3 9 20.0 25.8 31.674999999999997 22.525000000000002 10-14 20.735 30.064999999999998 27.415 21.785 15-19 21.43 28.249999999999996 27.865000000000002 22.455 20-24 21.87 28.694999999999997 26.795 22.64 25-29 21.19 28.384999999999998 27.63 22.795 30-34 21.95 27.875 27.584999999999997 22.59 35-39 21.37 27.415 28.215 23.0 40-44 21.775 27.994999999999997 27.49 22.74 45-49 22.335 27.950000000000003 26.939999999999998 22.775000000000002 50-54 22.215 27.87 27.38 22.535 55-59 22.2 28.444999999999997 27.02 22.335 60-64 22.259999999999998 26.939999999999998 27.089999999999996 23.71 65-69 21.4 27.855 27.235 23.51 70-74 22.325 27.36 27.12 23.195 75-79 21.81 27.565 27.115000000000002 23.51 80-84 21.255 27.939999999999998 27.98 22.825 85-89 22.1 28.15 26.61 23.14 90-94 21.555 27.400000000000002 27.735 23.31 95-99 21.995 27.839999999999996 27.36 22.805 100-104 22.375 27.1 27.150000000000002 23.375 105-109 22.68 28.000000000000004 26.724999999999998 22.595000000000002 110-114 21.925 28.1 27.49 22.485 115-119 22.58 27.98 27.365000000000002 22.075 120-124 22.009999999999998 27.845 27.284999999999997 22.86 125-129 22.521126056302815 27.966398319915996 26.74633731686584 22.766138306915344 130-134 22.905 28.565 26.31 22.220000000000002 135-139 22.96 27.529999999999998 26.865 22.645 140-144 22.755 27.439999999999998 27.18 22.625 145-149 22.564999999999998 27.529999999999998 26.82 23.085 150 22.225 27.35 27.975 22.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.5 24 2.5 25 3.0 26 4.5 27 4.5 28 3.0 29 5.5 30 12.0 31 18.0 32 28.0 33 39.0 34 45.0 35 54.0 36 75.0 37 101.0 38 127.0 39 150.5 40 169.0 41 208.0 42 234.5 43 236.5 44 246.5 45 250.0 46 264.5 47 258.5 48 228.5 49 206.0 50 178.0 51 167.0 52 139.0 53 111.0 54 101.5 55 76.0 56 61.0 57 53.0 58 36.5 59 23.0 60 21.5 61 18.0 62 8.0 63 5.0 64 3.5 65 0.5 66 0.0 67 2.0 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.55 #Duplication Level Percentage of deduplicated Percentage of total 1 88.25522303783173 78.14999999999999 2 10.67193675889328 18.9 3 1.0163749294184077 2.7 4 0.0282326369282891 0.1 5 0.0 0.0 6 0.0282326369282891 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.037500000000000006 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.0875 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.21250000000000002 0.0 0.0 0.0 0.0 136-137 0.25 0.0 0.0 0.0 0.0 138 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTATTT 10 0.006973645 144.0 8 CTGAAAA 10 0.006973645 144.0 6 ATTAAGA 10 0.006973645 144.0 7 >>END_MODULE Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra Read 3462720 spots for SRR14322311.sra Written 3462720 spots for SRR14322311.sra SRR ids: ['SRR14322311.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wn74nlk0 SRR14322311.sra spots: 69254400 blocks: [[1, 3462720], [3462721, 6925440], [6925441, 10388160], [10388161, 13850880], [13850881, 17313600], [17313601, 20776320], [20776321, 24239040], [24239041, 27701760], [27701761, 31164480], [31164481, 34627200], [34627201, 38089920], [38089921, 41552640], [41552641, 45015360], [45015361, 48478080], [48478081, 51940800], [51940801, 55403520], [55403521, 58866240], [58866241, 62328960], [62328961, 65791680], [65791681, 69254400]] SRR14322311 file size 23378712 SRR14322311 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14322311 SRR14322311_1.fastq SRR14322311_2.fastq Input file: SRR14322311_1.fastq Paired file: SRR14322311_2.fastq trimmed: SRR14322311-trimmed-pair1.fastq, SRR14322311-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:42:34 2025 >> started Wed Feb 12 13:43:46 2025 >> done (72.154s) 69254400 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 2867 ( 0.00%) empty read pairs filtered out after trimming by size control 69251501 (100.00%) read pairs available; of these: 279345 ( 0.40%) trimmed read pairs available after processing 68972156 (99.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 7 0.00% 22 5 0.00% 23 9 0.00% 24 9 0.00% 25 12 0.00% 26 10 0.00% 27 12 0.00% 28 20 0.00% 29 18 0.00% 30 23 0.00% 31 22 0.00% 32 29 0.00% 33 28 0.00% 34 30 0.00% 35 38 0.00% 36 33 0.00% 37 43 0.00% 38 35 0.00% 39 50 0.00% 40 31 0.00% 41 50 0.00% 42 47 0.00% 43 63 0.00% 44 43 0.00% 45 43 0.00% 46 58 0.00% 47 41 0.00% 48 50 0.00% 49 69 0.00% 50 59 0.00% 51 58 0.00% 52 53 0.00% 53 77 0.00% 54 78 0.00% 55 77 0.00% 56 74 0.00% 57 83 0.00% 58 79 0.00% 59 90 0.00% 60 100 0.00% 61 103 0.00% 62 103 0.00% 63 115 0.00% 64 121 0.00% 65 115 0.00% 66 147 0.00% 67 138 0.00% 68 154 0.00% 69 175 0.00% 70 180 0.00% 71 199 0.00% 72 217 0.00% 73 249 0.00% 74 256 0.00% 75 265 0.00% 76 266 0.00% 77 304 0.00% 78 259 0.00% 79 360 0.00% 80 339 0.00% 81 372 0.00% 82 439 0.00% 83 464 0.00% 84 492 0.00% 85 474 0.00% 86 485 0.00% 87 529 0.00% 88 548 0.00% 89 590 0.00% 90 619 0.00% 91 642 0.00% 92 721 0.00% 93 805 0.00% 94 835 0.00% 95 883 0.00% 96 956 0.00% 97 949 0.00% 98 964 0.00% 99 1068 0.00% 100 1072 0.00% 101 1212 0.00% 102 1304 0.00% 103 1407 0.00% 104 1414 0.00% 105 1537 0.00% 106 1637 0.00% 107 1558 0.00% 108 1721 0.00% 109 1786 0.00% 110 1930 0.00% 111 2040 0.00% 112 2157 0.00% 113 2306 0.00% 114 2431 0.00% 115 2531 0.00% 116 2731 0.00% 117 2918 0.00% 118 2954 0.00% 119 3050 0.00% 120 3200 0.00% 121 3345 0.00% 122 3690 0.01% 123 4007 0.01% 124 4250 0.01% 125 4484 0.01% 126 4446 0.01% 127 4649 0.01% 128 4924 0.01% 129 5106 0.01% 130 5231 0.01% 131 5655 0.01% 132 5873 0.01% 133 6363 0.01% 134 6676 0.01% 135 6949 0.01% 136 7304 0.01% 137 7849 0.01% 138 7918 0.01% 139 8377 0.01% 140 8488 0.01% 141 8964 0.01% 142 9562 0.01% 143 10103 0.01% 144 10626 0.02% 145 11221 0.02% 146 11837 0.02% 147 12483 0.02% 148 13251 0.02% 149 14153 0.02% 150 68972156 99.60% 69251501 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.71 prefix-fanout=2.0 sequence=ATCCCACATCACACATGGTAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCACTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGAGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=28.18 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.3 sequence=AGCTGTTGCCATATTTACTGAAGCCCTCCCTGTCTTGACATATACAATAGAAGAACCGTTGAGTGTCCCGCTATGGAACCTTCTGCCCGCAATGTCTACAGAGGAGTCTTCACTGTCAGGGCTATAGAGTCCGGAGTCTTTCAGAGCCCTTTCGTTGACATCAGAGGTAAAAACTAGCCCTAAGCG criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.69 prefix-fanout=2.0 sequence=ATCCCACATCACACATGGTAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCACTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGAGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=38.31 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=6.0 sequence=CCATCTCTTCAATCGTAAATCACAAGTACATACACGTTTACTCATCAGCTCGAAAATGGCAGCAG SRR14322311 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:44:41 Started mapping on | Feb 12 13:44:41 Finished on | Feb 12 14:00:51 Mapping speed, Million of reads per hour | 257.02 Number of input reads | 69251501 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 62055071 Uniquely mapped reads % | 89.61% Average mapped length | 292.84 Number of splices: Total | 64844764 Number of splices: Annotated (sjdb) | 63414340 Number of splices: GT/AG | 63424732 Number of splices: GC/AG | 955258 Number of splices: AT/AC | 39054 Number of splices: Non-canonical | 425720 Mismatch rate per base, % | 1.95% Deletion rate per base | 0.10% Deletion average length | 3.28 Insertion rate per base | 0.07% Insertion average length | 3.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3015427 % of reads mapped to multiple loci | 4.35% Number of reads mapped to too many loci | 239776 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.35% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4181003 4181003 4181003 N_multimapping 3015427 3015427 3015427 N_noFeature 1215766 31098763 31308439 N_ambiguous 1399580 270004 268293 UnstrandedReadsAssigned:59439725 PositiveStrandReadsAssigned:30686304 NegativeStrandReadsAssigned:30478339 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14322311 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14322311-trimmed-pair1.fastq SRR14322311-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 69,251,501 reads, 55,389,633 reads pseudoaligned [quant] estimated average fragment length: 297.31 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52401 SRR14322311.ke.tsv 34699 SRR14322311.se.tsv 87100 total ==> SRR14322311.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.69 2818 18.881 Potri.005G024800.1.v4.1 1035 738.69 1381 21.566 Potri.004G059700.1.v4.1 961 664.701 9 0.156191 Potri.007G009000.2.v4.1 1416 1119.69 0 0 Potri.003G141000.2.v4.1 2943 2646.69 838 3.65241 Potri.016G087400.1.v4.1 270 45.415 1333 338.586 Potri.015G069301.1.v4.1 564 268.839 0 0 Potri.010G195200.1.v4.1 1773 1476.69 185 1.44518 Potri.012G127500.1.v4.1 977 680.696 7848 132.998 ==> SRR14322311.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 132 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 642 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR14322311 completed mapping pipeline successfully