Starting /dee2/code/volunteer_pipeline.sh SRR14639570 current disk space = 3117999161344 free memory = 1488500800 SRR14639570 SRAfilesize 45a99536b63c0b1ee9d37730afe28b96 SRR14639570.sra SRR14639570.sra file validated SRR14639570 is paired end SRR14639570 is conventional basespace SRR14639570 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639570_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70625 32.0 32.0 32.0 32.0 32.0 2 31.5275 32.0 32.0 32.0 32.0 32.0 3 35.3175 37.0 32.0 37.0 32.0 37.0 4 36.13125 37.0 37.0 37.0 32.0 37.0 5 36.35625 37.0 37.0 37.0 37.0 37.0 6 39.754 41.0 41.0 41.0 37.0 41.0 7 39.883 41.0 41.0 41.0 37.0 41.0 8 40.18275 41.0 41.0 41.0 37.0 41.0 9 40.19225 41.0 41.0 41.0 37.0 41.0 10-14 40.251799999999996 41.0 41.0 41.0 39.4 41.0 15-19 40.2667 41.0 41.0 41.0 41.0 41.0 20-24 40.2152 41.0 41.0 41.0 38.6 41.0 25-29 40.2168 41.0 41.0 41.0 40.2 41.0 30-34 40.1826 41.0 41.0 41.0 41.0 41.0 35-39 40.13415 41.0 41.0 41.0 37.8 41.0 40-44 40.11925 41.0 41.0 41.0 37.8 41.0 45-49 40.07835 41.0 41.0 41.0 37.0 41.0 50-54 39.9645 41.0 41.0 41.0 37.0 41.0 55-59 39.9221 41.0 41.0 41.0 37.0 41.0 60-64 39.883950000000006 41.0 41.0 41.0 37.0 41.0 65-69 39.82645000000001 41.0 41.0 41.0 37.0 41.0 70-74 39.7096 41.0 41.0 41.0 37.0 41.0 75-79 39.256150000000005 41.0 40.2 41.0 36.0 41.0 80-84 39.6511 41.0 41.0 41.0 37.0 41.0 85-89 39.645649999999996 41.0 41.0 41.0 37.0 41.0 90-94 39.5621 41.0 41.0 41.0 37.0 41.0 95-99 39.456300000000006 41.0 41.0 41.0 37.0 41.0 100-104 39.44255 41.0 41.0 41.0 37.0 41.0 105-109 39.330799999999996 41.0 41.0 41.0 37.0 41.0 110-114 39.28295 41.0 41.0 41.0 37.0 41.0 115-119 39.296949999999995 41.0 41.0 41.0 37.0 41.0 120-124 39.2254 41.0 41.0 41.0 37.0 41.0 125-129 39.190549999999995 41.0 41.0 41.0 37.0 41.0 130-134 38.94325 41.0 41.0 41.0 34.0 41.0 135-139 38.649649999999994 41.0 41.0 41.0 32.0 41.0 140-144 38.38995 41.0 40.2 41.0 32.0 41.0 145-149 38.19154999999999 41.0 37.0 41.0 32.0 41.0 150 37.96775 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 2.0 24 1.0 25 2.0 26 7.0 27 9.0 28 11.0 29 14.0 30 20.0 31 43.0 32 35.0 33 61.0 34 67.0 35 82.0 36 121.0 37 140.0 38 241.0 39 481.0 40 2659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.15853963490873 13.728432108027006 9.777444361090271 42.335583895974 2 13.075000000000001 13.275 44.85 28.799999999999997 3 14.725 18.375 30.375000000000004 36.525 4 20.65 27.05 24.725 27.575 5 20.45 34.25 25.674999999999997 19.625 6 17.0 34.475 27.825 20.7 7 14.249999999999998 26.674999999999997 41.949999999999996 17.125 8 12.85 24.525 37.724999999999994 24.9 9 15.825 25.2 35.875 23.1 10-14 18.445 29.580000000000002 28.425 23.549999999999997 15-19 18.335 28.58 28.685 24.4 20-24 18.634999999999998 28.000000000000004 29.085 24.279999999999998 25-29 18.459999999999997 28.395 29.270000000000003 23.875 30-34 18.855 28.02 28.875 24.25 35-39 18.82 29.15 28.349999999999998 23.68 40-44 18.605 29.080000000000002 28.485 23.830000000000002 45-49 18.91 28.575 28.265 24.25 50-54 18.665000000000003 29.265 27.939999999999998 24.13 55-59 18.834999999999997 29.160000000000004 27.900000000000002 24.104999999999997 60-64 19.18 29.110000000000003 28.305000000000003 23.405 65-69 18.77 29.325000000000003 28.21 23.695 70-74 18.945 29.205 27.694999999999997 24.154999999999998 75-79 19.185 29.265 27.525 24.025 80-84 19.16 28.785 28.03 24.025 85-89 19.32 29.01 28.035 23.635 90-94 18.985 28.904999999999998 27.765 24.345 95-99 19.365 28.33 27.925 24.38 100-104 18.725 28.725 28.95 23.599999999999998 105-109 19.315965798289913 28.346417320866042 28.72143607180359 23.61618080904045 110-114 18.884999999999998 28.865000000000002 28.325 23.925 115-119 19.575 28.52 28.28 23.625 120-124 19.475 28.265 28.134999999999998 24.125 125-129 19.125 28.285 28.675 23.915 130-134 20.165 28.375 28.18 23.28 135-139 19.45 28.599999999999998 28.125 23.825 140-144 19.12286843026454 28.944341651247683 28.354253137970698 23.57853678051708 145-149 19.665 28.310000000000002 28.23 23.794999999999998 150 18.7 27.950000000000003 28.025 25.324999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 3.0 23 6.0 24 5.0 25 4.0 26 7.0 27 9.0 28 8.0 29 10.0 30 24.0 31 35.0 32 34.5 33 47.5 34 65.0 35 85.0 36 114.5 37 144.5 38 177.5 39 189.5 40 190.0 41 234.5 42 280.5 43 275.0 44 267.0 45 268.0 46 258.5 47 245.0 48 221.0 49 181.5 50 146.0 51 120.5 52 88.5 53 64.0 54 54.5 55 39.0 56 23.5 57 18.0 58 13.5 59 8.0 60 7.5 61 6.0 62 3.5 63 3.5 64 2.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.25 #Duplication Level Percentage of deduplicated Percentage of total 1 95.17060367454067 90.64999999999999 2 4.671916010498688 8.9 3 0.15748031496062992 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.0625 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0125 0.0 124-125 0.15 0.0 0.0 0.025 0.0 126-127 0.175 0.0 0.0 0.025 0.0 128-129 0.21250000000000002 0.0 0.0 0.025 0.0 130-131 0.225 0.0 0.0 0.025 0.0 132-133 0.225 0.0 0.0 0.025 0.0 134-135 0.2375 0.0 0.0 0.025 0.0 136-137 0.275 0.0 0.0 0.025 0.0 138 0.275 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGGAT 10 0.006973645 144.0 1 TTTACTT 10 0.006973645 144.0 8 GGGGGGG 40 0.007966741 18.0 40-44 >>END_MODULE SRR14639570 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639570_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.66875 32.0 32.0 32.0 32.0 32.0 2 30.8375 32.0 32.0 32.0 32.0 32.0 3 34.21625 37.0 32.0 37.0 32.0 37.0 4 35.02375 37.0 37.0 37.0 32.0 37.0 5 35.29875 37.0 37.0 37.0 32.0 37.0 6 38.35725 41.0 37.0 41.0 32.0 41.0 7 38.25775 41.0 41.0 41.0 32.0 41.0 8 38.164 41.0 41.0 41.0 32.0 41.0 9 38.4895 41.0 41.0 41.0 32.0 41.0 10-14 38.526 41.0 41.0 41.0 32.0 41.0 15-19 38.211800000000004 41.0 41.0 41.0 30.0 41.0 20-24 38.17100000000001 41.0 41.0 41.0 31.0 41.0 25-29 37.84885 41.0 39.4 41.0 29.0 41.0 30-34 37.7121 41.0 37.0 41.0 27.0 41.0 35-39 37.6092 41.0 37.0 41.0 27.0 41.0 40-44 37.4479 41.0 37.0 41.0 27.0 41.0 45-49 37.2975 41.0 37.0 41.0 27.0 41.0 50-54 37.1993 41.0 37.0 41.0 27.0 41.0 55-59 37.1794 41.0 37.0 41.0 27.0 41.0 60-64 37.077749999999995 41.0 37.0 41.0 27.0 41.0 65-69 36.7197 41.0 37.0 41.0 24.0 41.0 70-74 36.52720000000001 41.0 37.0 41.0 24.0 41.0 75-79 35.7789 40.2 35.0 41.0 23.0 41.0 80-84 36.7799 41.0 37.0 41.0 22.0 41.0 85-89 36.69095 41.0 37.0 41.0 22.0 41.0 90-94 36.4875 41.0 37.0 41.0 22.0 41.0 95-99 36.6212 41.0 37.0 41.0 22.0 41.0 100-104 36.333749999999995 41.0 37.0 41.0 22.0 41.0 105-109 36.174150000000004 41.0 37.0 41.0 22.0 41.0 110-114 36.2241 41.0 37.0 41.0 22.0 41.0 115-119 35.8712 41.0 36.0 41.0 20.0 41.0 120-124 35.9482 41.0 37.0 41.0 22.0 41.0 125-129 35.29915 41.0 34.0 41.0 18.0 41.0 130-134 35.28185 41.0 32.0 41.0 20.0 41.0 135-139 35.04575 41.0 33.0 41.0 20.0 41.0 140-144 34.69155 41.0 32.0 41.0 18.0 41.0 145-149 34.508500000000005 41.0 31.0 41.0 12.0 41.0 150 33.83225 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 2.0 16 8.0 17 15.0 18 24.0 19 26.0 20 26.0 21 25.0 22 41.0 23 41.0 24 42.0 25 44.0 26 54.0 27 59.0 28 75.0 29 67.0 30 78.0 31 77.0 32 77.0 33 134.0 34 136.0 35 167.0 36 177.0 37 233.0 38 358.0 39 523.0 40 1488.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.283208020050125 28.020050125313283 9.598997493734336 29.097744360902254 2 19.625 27.05 38.925 14.399999999999999 3 16.0 27.150000000000002 35.75 21.099999999999998 4 20.974999999999998 36.175000000000004 23.575 19.275000000000002 5 24.25 38.775 22.575 14.399999999999999 6 18.7 39.125 24.325 17.849999999999998 7 19.400000000000002 23.1 38.475 19.025 8 17.9 23.3 33.4 25.4 9 20.0 23.599999999999998 33.475 22.925 10-14 21.935 28.754999999999995 27.66 21.65 15-19 22.625 27.43 28.88 21.065 20-24 21.975 28.96 28.345 20.72 25-29 22.39 28.185 28.89 20.535 30-34 22.29 28.060000000000002 28.615000000000002 21.035 35-39 21.52 28.37 28.895 21.215 40-44 22.09 28.34 28.345 21.224999999999998 45-49 22.82 27.915 28.660000000000004 20.605 50-54 22.355 28.625 28.185 20.835 55-59 22.3 28.585 28.110000000000003 21.005 60-64 22.58 28.18 28.305000000000003 20.935000000000002 65-69 22.900000000000002 28.375 27.98 20.745 70-74 22.91 28.42 27.529999999999998 21.14 75-79 23.0 27.21 28.599999999999998 21.19 80-84 22.445 28.48 28.075 21.0 85-89 23.06 28.105000000000004 27.794999999999998 21.04 90-94 22.675 28.08 27.77 21.475 95-99 23.34 28.155 27.725 20.78 100-104 22.82 29.14 27.145000000000003 20.895 105-109 22.84 28.34 27.875 20.945 110-114 23.23 27.76 28.48 20.53 115-119 23.585 28.565 27.200000000000003 20.65 120-124 23.055 28.815 27.655 20.474999999999998 125-129 22.869999999999997 29.17 27.18 20.78 130-134 23.25 28.384999999999998 27.875 20.49 135-139 23.330000000000002 28.035 27.705000000000002 20.93 140-144 23.22 28.585 27.529999999999998 20.665 145-149 23.61 28.415000000000003 27.065 20.91 150 23.525 27.925 28.65 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.0 17 1.5 18 0.5 19 0.5 20 0.0 21 1.5 22 2.0 23 0.5 24 3.0 25 7.5 26 8.5 27 11.5 28 16.0 29 15.5 30 21.0 31 26.5 32 32.5 33 49.5 34 65.0 35 80.0 36 97.5 37 120.0 38 149.0 39 188.5 40 224.5 41 249.5 42 257.5 43 264.0 44 278.0 45 258.5 46 244.5 47 244.0 48 216.5 49 183.0 50 143.5 51 116.5 52 104.0 53 76.5 54 54.5 55 47.5 56 37.0 57 27.5 58 20.0 59 15.0 60 12.0 61 7.5 62 5.5 63 2.5 64 1.0 65 1.0 66 1.0 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.09679937548789 92.325 2 3.721051262034868 7.1499999999999995 3 0.18214936247723132 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.32499999999999996 0.0 0.0 0.0 0.0 128-129 0.3875 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.4 0.0 0.0 0.0 0.0 134-135 0.4 0.0 0.0 0.0 0.0 136-137 0.425 0.0 0.0 0.0 0.0 138 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGCT 10 0.006973645 144.0 7 >>END_MODULE Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra Read 1250004 spots for SRR14639570.sra Written 1250004 spots for SRR14639570.sra Read 1249991 spots for SRR14639570.sra Written 1249991 spots for SRR14639570.sra SRR ids: ['SRR14639570.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iafuhtj4 SRR14639570.sra spots: 24999833 blocks: [[1, 1249991], [1249992, 2499982], [2499983, 3749973], [3749974, 4999964], [4999965, 6249955], [6249956, 7499946], [7499947, 8749937], [8749938, 9999928], [9999929, 11249919], [11249920, 12499910], [12499911, 13749901], [13749902, 14999892], [14999893, 16249883], [16249884, 17499874], [17499875, 18749865], [18749866, 19999856], [19999857, 21249847], [21249848, 22499838], [22499839, 23749829], [23749830, 24999833]] SRR14639570 file size 9255058 SRR14639570 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639570 SRR14639570_1.fastq SRR14639570_2.fastq Input file: SRR14639570_1.fastq Paired file: SRR14639570_2.fastq trimmed: SRR14639570-trimmed-pair1.fastq, SRR14639570-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:30:27 2025 >> started Fri Feb 14 08:31:02 2025 >> done (34.815s) 24999833 read pairs processed; of these: 165 ( 0.00%) short read pairs filtered out after trimming by size control 32 ( 0.00%) empty read pairs filtered out after trimming by size control 24999636 (100.00%) read pairs available; of these: 490526 ( 1.96%) trimmed read pairs available after processing 24509110 (98.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 36 0.00% 20 22 0.00% 21 27 0.00% 22 33 0.00% 23 43 0.00% 24 43 0.00% 25 43 0.00% 26 29 0.00% 27 58 0.00% 28 40 0.00% 29 42 0.00% 30 46 0.00% 31 55 0.00% 32 59 0.00% 33 68 0.00% 34 59 0.00% 35 56 0.00% 36 66 0.00% 37 66 0.00% 38 92 0.00% 39 52 0.00% 40 67 0.00% 41 68 0.00% 42 122 0.00% 43 71 0.00% 44 81 0.00% 45 83 0.00% 46 90 0.00% 47 96 0.00% 48 76 0.00% 49 98 0.00% 50 119 0.00% 51 107 0.00% 52 121 0.00% 53 106 0.00% 54 97 0.00% 55 142 0.00% 56 104 0.00% 57 124 0.00% 58 128 0.00% 59 121 0.00% 60 130 0.00% 61 122 0.00% 62 135 0.00% 63 145 0.00% 64 169 0.00% 65 138 0.00% 66 149 0.00% 67 163 0.00% 68 156 0.00% 69 160 0.00% 70 178 0.00% 71 181 0.00% 72 215 0.00% 73 203 0.00% 74 190 0.00% 75 214 0.00% 76 220 0.00% 77 219 0.00% 78 240 0.00% 79 269 0.00% 80 244 0.00% 81 256 0.00% 82 263 0.00% 83 300 0.00% 84 328 0.00% 85 314 0.00% 86 336 0.00% 87 353 0.00% 88 375 0.00% 89 387 0.00% 90 410 0.00% 91 440 0.00% 92 473 0.00% 93 474 0.00% 94 508 0.00% 95 555 0.00% 96 540 0.00% 97 536 0.00% 98 616 0.00% 99 689 0.00% 100 701 0.00% 101 707 0.00% 102 792 0.00% 103 816 0.00% 104 813 0.00% 105 902 0.00% 106 931 0.00% 107 1008 0.00% 108 1015 0.00% 109 1103 0.00% 110 1125 0.00% 111 1198 0.00% 112 1265 0.01% 113 1378 0.01% 114 1337 0.01% 115 1466 0.01% 116 1504 0.01% 117 1616 0.01% 118 1691 0.01% 119 1689 0.01% 120 1821 0.01% 121 1937 0.01% 122 2064 0.01% 123 2078 0.01% 124 2208 0.01% 125 2260 0.01% 126 2464 0.01% 127 2536 0.01% 128 2637 0.01% 129 2797 0.01% 130 2840 0.01% 131 3042 0.01% 132 3025 0.01% 133 3141 0.01% 134 3287 0.01% 135 3570 0.01% 136 3546 0.01% 137 3865 0.02% 138 3936 0.02% 139 4122 0.02% 140 4208 0.02% 141 4493 0.02% 142 4560 0.02% 143 4756 0.02% 144 4991 0.02% 145 5271 0.02% 146 6022 0.02% 147 8729 0.03% 148 24440 0.10% 149 327751 1.31% 150 24509110 98.04% 24999636 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=31 prefix-density=0.52 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=152.84 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=24.2 sequence=TCATCTTCTTCT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=33 prefix-density=0.71 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=108.31 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.3 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639570 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:31:53 Started mapping on | Feb 14 08:31:54 Finished on | Feb 14 08:34:56 Mapping speed, Million of reads per hour | 494.50 Number of input reads | 24999636 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 23099038 Uniquely mapped reads % | 92.40% Average mapped length | 297.10 Number of splices: Total | 23657288 Number of splices: Annotated (sjdb) | 23053544 Number of splices: GT/AG | 23212533 Number of splices: GC/AG | 351539 Number of splices: AT/AC | 17577 Number of splices: Non-canonical | 75639 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.03% Deletion average length | 3.15 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 531758 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 16957 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.36% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1368840 1368840 1368840 N_multimapping 531758 531758 531758 N_noFeature 859003 22793578 926034 N_ambiguous 394780 1304 155883 UnstrandedReadsAssigned:21845255 PositiveStrandReadsAssigned:304156 NegativeStrandReadsAssigned:22017121 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639570 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639570-trimmed-pair1.fastq SRR14639570-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,999,636 reads, 22,317,055 reads pseudoaligned [quant] estimated average fragment length: 376.361 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR14639570.ke.tsv 34699 SRR14639570.se.tsv 87100 total ==> SRR14639570.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1642.64 1365 33.9541 Potri.005G024800.1.v4.1 1035 659.639 395 24.4676 Potri.004G059700.1.v4.1 961 586.159 43 2.99746 Potri.007G009000.2.v4.1 1416 1040.64 0 0 Potri.003G141000.2.v4.1 2943 2567.64 2200.68 35.0207 Potri.016G087400.1.v4.1 270 47.755 1377 1178.19 Potri.015G069301.1.v4.1 564 223.935 0 0 Potri.010G195200.1.v4.1 1773 1397.64 322 9.41374 Potri.012G127500.1.v4.1 977 601.903 55 3.73368 ==> SRR14639570.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 125 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 108 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR14639570 completed mapping pipeline successfully