Starting /dee2/code/volunteer_pipeline.sh SRR14639571 current disk space = 3116190171136 free memory = 1582335436 SRR14639571 SRAfilesize b14c73762259dbf4b7a38a6a06ad19b3 SRR14639571.sra SRR14639571.sra file validated SRR14639571 is paired end SRR14639571 is conventional basespace SRR14639571 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639571_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6575 32.0 32.0 32.0 32.0 32.0 2 31.61625 32.0 32.0 32.0 32.0 32.0 3 35.28375 37.0 32.0 37.0 32.0 37.0 4 36.05 37.0 37.0 37.0 32.0 37.0 5 36.30625 37.0 37.0 37.0 37.0 37.0 6 39.765 41.0 41.0 41.0 37.0 41.0 7 39.8705 41.0 41.0 41.0 37.0 41.0 8 40.15775 41.0 41.0 41.0 37.0 41.0 9 40.24975 41.0 41.0 41.0 37.0 41.0 10-14 40.1817 41.0 41.0 41.0 37.8 41.0 15-19 40.20139999999999 41.0 41.0 41.0 37.8 41.0 20-24 40.16925 41.0 41.0 41.0 37.0 41.0 25-29 40.173249999999996 41.0 41.0 41.0 37.8 41.0 30-34 40.159650000000006 41.0 41.0 41.0 38.6 41.0 35-39 40.04935 41.0 41.0 41.0 37.0 41.0 40-44 40.06275000000001 41.0 41.0 41.0 37.0 41.0 45-49 39.9901 41.0 41.0 41.0 37.0 41.0 50-54 39.936350000000004 41.0 41.0 41.0 37.0 41.0 55-59 39.86615 41.0 41.0 41.0 37.0 41.0 60-64 39.849199999999996 41.0 41.0 41.0 37.0 41.0 65-69 39.734649999999995 41.0 41.0 41.0 37.0 41.0 70-74 39.6189 41.0 41.0 41.0 37.0 41.0 75-79 39.19455 41.0 40.2 41.0 36.0 41.0 80-84 39.6155 41.0 41.0 41.0 37.0 41.0 85-89 39.58505 41.0 41.0 41.0 37.0 41.0 90-94 39.536500000000004 41.0 41.0 41.0 37.0 41.0 95-99 39.4813 41.0 41.0 41.0 37.0 41.0 100-104 39.3821 41.0 41.0 41.0 37.0 41.0 105-109 39.32645 41.0 41.0 41.0 37.0 41.0 110-114 39.371249999999996 41.0 41.0 41.0 37.0 41.0 115-119 39.2896 41.0 41.0 41.0 37.0 41.0 120-124 39.28765 41.0 41.0 41.0 37.0 41.0 125-129 39.3174 41.0 41.0 41.0 37.0 41.0 130-134 38.9816 41.0 41.0 41.0 34.0 41.0 135-139 38.817099999999996 41.0 41.0 41.0 32.0 41.0 140-144 38.5586 41.0 41.0 41.0 32.0 41.0 145-149 38.36344999999999 41.0 37.0 41.0 32.0 41.0 150 38.2965 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 4.0 24 2.0 25 3.0 26 7.0 27 13.0 28 16.0 29 22.0 30 27.0 31 30.0 32 39.0 33 50.0 34 65.0 35 78.0 36 95.0 37 158.0 38 244.0 39 470.0 40 2676.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.218609304652325 15.532766383191596 12.056028014007003 35.19259629814908 2 16.0 13.850000000000001 41.05 29.099999999999998 3 15.825 21.8 29.2 33.175 4 21.075 29.075 25.95 23.9 5 20.974999999999998 33.575 25.95 19.5 6 16.225 33.35 29.9 20.525 7 14.424999999999999 26.825 40.975 17.775 8 14.475 24.0 36.825 24.7 9 14.325 26.125 36.625 22.925 10-14 19.634999999999998 28.999999999999996 27.735 23.630000000000003 15-19 18.6 28.535 28.505000000000003 24.36 20-24 18.93 29.455 28.225 23.39 25-29 19.23 28.865000000000002 28.27 23.635 30-34 18.535 29.255 27.98 24.23 35-39 18.790000000000003 29.4 28.205000000000002 23.605 40-44 18.68 28.749999999999996 28.43 24.14 45-49 19.335 29.125 27.58 23.96 50-54 19.03 28.645 28.58 23.745 55-59 18.645 28.485 28.82 24.05 60-64 18.825 29.2 28.544999999999998 23.43 65-69 19.0 28.43 28.449999999999996 24.12 70-74 19.42 29.09 28.09 23.400000000000002 75-79 18.965 29.044999999999998 28.555000000000003 23.435 80-84 19.005 28.21 28.470000000000002 24.315 85-89 18.775 29.04 27.97 24.215 90-94 19.265 28.655 28.43 23.65 95-99 19.55 27.97 28.360000000000003 24.12 100-104 19.61 28.52 28.115000000000002 23.755000000000003 105-109 19.617942691403712 27.754163124468672 28.494274141121167 24.133620043006452 110-114 19.925 28.335 27.944999999999997 23.794999999999998 115-119 19.759999999999998 29.025000000000002 27.435 23.78 120-124 19.7 27.875 28.549999999999997 23.875 125-129 18.925 28.175 28.970000000000002 23.93 130-134 19.825 28.110000000000003 28.405 23.66 135-139 19.57 28.810000000000002 27.91 23.71 140-144 19.778955791158232 27.885577115423082 28.410682136427283 23.9247849569914 145-149 19.59 28.689999999999998 27.689999999999998 24.03 150 18.65 27.700000000000003 28.749999999999996 24.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 2.0 23 2.0 24 1.5 25 4.5 26 6.0 27 7.5 28 8.5 29 15.5 30 19.0 31 26.5 32 42.0 33 49.5 34 64.5 35 87.5 36 115.5 37 137.5 38 163.5 39 193.0 40 229.0 41 252.5 42 277.5 43 298.0 44 282.5 45 264.5 46 248.5 47 236.0 48 207.5 49 166.0 50 135.0 51 111.0 52 90.0 53 74.0 54 53.5 55 34.0 56 23.5 57 17.5 58 14.5 59 11.5 60 7.0 61 4.0 62 2.5 63 2.5 64 2.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 95.65558754252812 91.375 2 4.056529704265898 7.75 3 0.26171159382360637 0.75 4 0.0 0.0 5 0.026171159382360636 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.0625 0.0 0.0 0.0 0.0 122-123 0.0875 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1125 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.15 0.0 0.0 0.0 0.0 136-137 0.15 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639571 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639571_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.595 32.0 32.0 32.0 27.0 32.0 2 30.8925 32.0 32.0 32.0 32.0 32.0 3 34.13125 37.0 32.0 37.0 32.0 37.0 4 34.97625 37.0 37.0 37.0 32.0 37.0 5 35.25875 37.0 37.0 37.0 32.0 37.0 6 38.37125 41.0 41.0 41.0 32.0 41.0 7 38.358 41.0 41.0 41.0 32.0 41.0 8 38.30525 41.0 41.0 41.0 32.0 41.0 9 38.50225 41.0 41.0 41.0 32.0 41.0 10-14 38.48350000000001 41.0 41.0 41.0 32.0 41.0 15-19 38.226 41.0 41.0 41.0 31.0 41.0 20-24 38.0635 41.0 41.0 41.0 28.0 41.0 25-29 37.67960000000001 41.0 38.6 41.0 27.0 41.0 30-34 37.59884999999999 41.0 37.0 41.0 27.0 41.0 35-39 37.59325 41.0 37.0 41.0 27.0 41.0 40-44 37.34495 41.0 37.0 41.0 27.0 41.0 45-49 37.293549999999996 41.0 37.0 41.0 27.0 41.0 50-54 37.1378 41.0 37.0 41.0 27.0 41.0 55-59 37.0737 41.0 37.0 41.0 27.0 41.0 60-64 37.001099999999994 41.0 37.0 41.0 27.0 41.0 65-69 36.841649999999994 41.0 37.0 41.0 25.0 41.0 70-74 36.48425 41.0 37.0 41.0 23.0 41.0 75-79 35.78914999999999 40.2 35.0 41.0 22.0 41.0 80-84 36.76989999999999 41.0 37.0 41.0 22.0 41.0 85-89 36.76285 41.0 37.0 41.0 22.0 41.0 90-94 36.445049999999995 41.0 37.0 41.0 22.0 41.0 95-99 36.5804 41.0 37.0 41.0 22.0 41.0 100-104 36.309400000000004 41.0 37.0 41.0 20.0 41.0 105-109 36.3541 41.0 37.0 41.0 22.0 41.0 110-114 36.153949999999995 41.0 37.0 41.0 22.0 41.0 115-119 35.8104 41.0 35.0 41.0 20.0 41.0 120-124 35.95425 41.0 37.0 41.0 22.0 41.0 125-129 35.37975 41.0 34.0 41.0 20.0 41.0 130-134 35.441649999999996 41.0 35.0 41.0 22.0 41.0 135-139 35.01965 41.0 32.0 41.0 18.0 41.0 140-144 34.76775000000001 41.0 32.0 41.0 16.0 41.0 145-149 34.556799999999996 40.2 32.0 41.0 12.0 41.0 150 34.25925 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 6.0 16 12.0 17 21.0 18 30.0 19 33.0 20 37.0 21 33.0 22 35.0 23 35.0 24 39.0 25 48.0 26 35.0 27 71.0 28 47.0 29 72.0 30 87.0 31 73.0 32 84.0 33 96.0 34 130.0 35 129.0 36 179.0 37 240.0 38 326.0 39 542.0 40 1556.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.90480961923848 26.20240480961924 10.495991983967935 23.39679358717435 2 20.825 27.375 36.375 15.425 3 17.625 29.725 32.324999999999996 20.325 4 21.025 35.5 24.349999999999998 19.125 5 21.8 38.550000000000004 22.45 17.2 6 18.45 36.1 26.125 19.325 7 19.625 23.95 35.3 21.125 8 17.125 25.724999999999998 31.674999999999997 25.474999999999998 9 19.125 25.1 32.25 23.525 10-14 21.73 28.53 28.34 21.4 15-19 21.925 28.015 29.075 20.985 20-24 21.525 28.560000000000002 28.660000000000004 21.255 25-29 22.57 27.894999999999996 28.744999999999997 20.79 30-34 22.15 28.055000000000003 28.705000000000002 21.09 35-39 21.87 28.294999999999998 28.68 21.154999999999998 40-44 22.375 28.585 28.21 20.830000000000002 45-49 22.32 28.425 27.889999999999997 21.365000000000002 50-54 22.005 28.549999999999997 28.325 21.12 55-59 22.7 27.975 28.01 21.315 60-64 22.08 28.24 29.03 20.65 65-69 22.28 27.779999999999998 28.384999999999998 21.555 70-74 23.0 27.950000000000003 27.735 21.315 75-79 22.615 28.12 28.37 20.895 80-84 22.695 27.99 28.410000000000004 20.905 85-89 21.925 28.38 28.24 21.455 90-94 22.055 28.07 28.26 21.615000000000002 95-99 22.919999999999998 28.675 27.405 21.0 100-104 23.03 28.095 27.565 21.310000000000002 105-109 23.005 28.349999999999998 28.095 20.549999999999997 110-114 22.805 28.310000000000002 27.87 21.015 115-119 23.275000000000002 27.655 28.03 21.04 120-124 23.455000000000002 27.98 27.93 20.635 125-129 22.58 28.144999999999996 28.294999999999998 20.979999999999997 130-134 23.68 28.17 27.175 20.974999999999998 135-139 23.165 27.765 28.055000000000003 21.015 140-144 23.035 28.205000000000002 27.884999999999998 20.875 145-149 22.689999999999998 27.87 28.389999999999997 21.05 150 23.45 28.249999999999996 29.049999999999997 19.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 1.0 19 1.5 20 1.0 21 1.0 22 4.5 23 7.5 24 5.5 25 5.0 26 7.0 27 11.5 28 16.0 29 16.5 30 25.0 31 32.0 32 36.5 33 53.0 34 66.0 35 84.0 36 99.0 37 116.5 38 153.0 39 179.0 40 202.5 41 238.0 42 262.0 43 252.0 44 254.0 45 274.0 46 261.5 47 237.5 48 209.0 49 179.5 50 147.0 51 122.5 52 101.0 53 74.5 54 60.0 55 52.5 56 44.5 57 31.5 58 20.5 59 11.5 60 10.0 61 8.0 62 5.0 63 4.0 64 2.5 65 1.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.5 #Duplication Level Percentage of deduplicated Percentage of total 1 96.60621761658031 93.22500000000001 2 3.160621761658031 6.1 3 0.233160621761658 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.0875 0.0 0.0 0.0 0.0 122-123 0.1125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.1375 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.15 0.0 0.0 0.0 0.0 136-137 0.15 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257167 spots for SRR14639571.sra Written 1257167 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra Read 1257157 spots for SRR14639571.sra Written 1257157 spots for SRR14639571.sra SRR ids: ['SRR14639571.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qh086mvt SRR14639571.sra spots: 25143150 blocks: [[1, 1257157], [1257158, 2514314], [2514315, 3771471], [3771472, 5028628], [5028629, 6285785], [6285786, 7542942], [7542943, 8800099], [8800100, 10057256], [10057257, 11314413], [11314414, 12571570], [12571571, 13828727], [13828728, 15085884], [15085885, 16343041], [16343042, 17600198], [17600199, 18857355], [18857356, 20114512], [20114513, 21371669], [21371670, 22628826], [22628827, 23885983], [23885984, 25143150]] SRR14639571 file size 9308196 SRR14639571 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639571 SRR14639571_1.fastq SRR14639571_2.fastq Input file: SRR14639571_1.fastq Paired file: SRR14639571_2.fastq trimmed: SRR14639571-trimmed-pair1.fastq, SRR14639571-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:57:23 2025 >> started Fri Feb 14 09:58:01 2025 >> done (38.363s) 25143150 read pairs processed; of these: 120 ( 0.00%) short read pairs filtered out after trimming by size control 50 ( 0.00%) empty read pairs filtered out after trimming by size control 25142980 (100.00%) read pairs available; of these: 548872 ( 2.18%) trimmed read pairs available after processing 24594108 (97.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 17 0.00% 20 19 0.00% 21 18 0.00% 22 24 0.00% 23 27 0.00% 24 27 0.00% 25 20 0.00% 26 31 0.00% 27 24 0.00% 28 33 0.00% 29 29 0.00% 30 46 0.00% 31 43 0.00% 32 66 0.00% 33 31 0.00% 34 33 0.00% 35 48 0.00% 36 35 0.00% 37 51 0.00% 38 43 0.00% 39 52 0.00% 40 50 0.00% 41 45 0.00% 42 58 0.00% 43 55 0.00% 44 63 0.00% 45 64 0.00% 46 88 0.00% 47 63 0.00% 48 65 0.00% 49 76 0.00% 50 72 0.00% 51 81 0.00% 52 82 0.00% 53 68 0.00% 54 82 0.00% 55 102 0.00% 56 103 0.00% 57 102 0.00% 58 108 0.00% 59 100 0.00% 60 127 0.00% 61 105 0.00% 62 139 0.00% 63 131 0.00% 64 124 0.00% 65 122 0.00% 66 143 0.00% 67 150 0.00% 68 149 0.00% 69 163 0.00% 70 178 0.00% 71 185 0.00% 72 187 0.00% 73 221 0.00% 74 197 0.00% 75 226 0.00% 76 254 0.00% 77 233 0.00% 78 246 0.00% 79 307 0.00% 80 282 0.00% 81 349 0.00% 82 372 0.00% 83 355 0.00% 84 378 0.00% 85 430 0.00% 86 454 0.00% 87 460 0.00% 88 466 0.00% 89 440 0.00% 90 544 0.00% 91 569 0.00% 92 600 0.00% 93 639 0.00% 94 649 0.00% 95 666 0.00% 96 704 0.00% 97 817 0.00% 98 863 0.00% 99 857 0.00% 100 894 0.00% 101 945 0.00% 102 1018 0.00% 103 1092 0.00% 104 1112 0.00% 105 1249 0.00% 106 1220 0.00% 107 1347 0.01% 108 1357 0.01% 109 1485 0.01% 110 1542 0.01% 111 1621 0.01% 112 1693 0.01% 113 1826 0.01% 114 1806 0.01% 115 1992 0.01% 116 2178 0.01% 117 2149 0.01% 118 2293 0.01% 119 2503 0.01% 120 2538 0.01% 121 2781 0.01% 122 2755 0.01% 123 2899 0.01% 124 3040 0.01% 125 3307 0.01% 126 3412 0.01% 127 3446 0.01% 128 3557 0.01% 129 3795 0.02% 130 3799 0.02% 131 3966 0.02% 132 4162 0.02% 133 4331 0.02% 134 4436 0.02% 135 4634 0.02% 136 4731 0.02% 137 4863 0.02% 138 5065 0.02% 139 5386 0.02% 140 5392 0.02% 141 5586 0.02% 142 5835 0.02% 143 6083 0.02% 144 6300 0.03% 145 6823 0.03% 146 7480 0.03% 147 10640 0.04% 148 28243 0.11% 149 341529 1.36% 150 24594108 97.82% 25142980 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=23 prefix-density=0.77 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=91.34 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=20.7 sequence=CAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATTTGGTTGCCCCAAAGCCTTCAAAGCCAAGTGTGCAGCCTTCTGCCCTGAGATCATCATTGC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=35 prefix-density=1.01 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=110.01 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=11.0 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639571 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:59:00 Started mapping on | Feb 14 09:59:00 Finished on | Feb 14 10:02:00 Mapping speed, Million of reads per hour | 502.86 Number of input reads | 25142980 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22853301 Uniquely mapped reads % | 90.89% Average mapped length | 297.17 Number of splices: Total | 23891066 Number of splices: Annotated (sjdb) | 23303083 Number of splices: GT/AG | 23451413 Number of splices: GC/AG | 347500 Number of splices: AT/AC | 17691 Number of splices: Non-canonical | 74462 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.03% Deletion average length | 3.17 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 511838 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 17456 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.96% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1777841 1777841 1777841 N_multimapping 511838 511838 511838 N_noFeature 786504 22502562 852142 N_ambiguous 430147 1282 144577 UnstrandedReadsAssigned:21636650 PositiveStrandReadsAssigned:349457 NegativeStrandReadsAssigned:21856582 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639571 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639571-trimmed-pair1.fastq SRR14639571-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,142,980 reads, 22,260,807 reads pseudoaligned [quant] estimated average fragment length: 354.431 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR14639571.ke.tsv 34699 SRR14639571.se.tsv 87100 total ==> SRR14639571.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1664.57 1319 28.8411 Potri.005G024800.1.v4.1 1035 681.569 421 22.4823 Potri.004G059700.1.v4.1 961 607.907 48 2.87391 Potri.007G009000.2.v4.1 1416 1062.57 0 0 Potri.003G141000.2.v4.1 2943 2589.57 2075.06 29.1657 Potri.016G087400.1.v4.1 270 48.559 1705 1277.98 Potri.015G069301.1.v4.1 564 235.108 0 0 Potri.010G195200.1.v4.1 1773 1419.57 290 7.43551 Potri.012G127500.1.v4.1 977 623.732 99 5.77705 ==> SRR14639571.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 98 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 121 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR14639571 completed mapping pipeline successfully