Starting /dee2/code/volunteer_pipeline.sh SRR14639572 current disk space = 3117642268672 free memory = 1478502660 SRR14639572 SRAfilesize 2b563af20cb0dec3c7c50e8eea32ac38 SRR14639572.sra SRR14639572.sra file validated SRR14639572 is paired end SRR14639572 is conventional basespace SRR14639572 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639572_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6925 32.0 32.0 32.0 32.0 32.0 2 31.5825 32.0 32.0 32.0 32.0 32.0 3 35.27 37.0 37.0 37.0 32.0 37.0 4 36.17875 37.0 37.0 37.0 37.0 37.0 5 36.2925 37.0 37.0 37.0 37.0 37.0 6 39.79575 41.0 41.0 41.0 37.0 41.0 7 39.86575 41.0 41.0 41.0 37.0 41.0 8 40.18075 41.0 41.0 41.0 37.0 41.0 9 40.22825 41.0 41.0 41.0 37.0 41.0 10-14 40.2836 41.0 41.0 41.0 41.0 41.0 15-19 40.27455 41.0 41.0 41.0 41.0 41.0 20-24 40.2485 41.0 41.0 41.0 39.4 41.0 25-29 40.216249999999995 41.0 41.0 41.0 41.0 41.0 30-34 40.2101 41.0 41.0 41.0 41.0 41.0 35-39 40.092999999999996 41.0 41.0 41.0 37.8 41.0 40-44 40.04325 41.0 41.0 41.0 37.0 41.0 45-49 40.05215 41.0 41.0 41.0 37.0 41.0 50-54 39.980199999999996 41.0 41.0 41.0 37.0 41.0 55-59 39.9226 41.0 41.0 41.0 37.0 41.0 60-64 39.83965 41.0 41.0 41.0 37.0 41.0 65-69 39.787 41.0 41.0 41.0 37.0 41.0 70-74 39.604749999999996 41.0 41.0 41.0 37.0 41.0 75-79 39.172900000000006 41.0 40.2 41.0 36.0 41.0 80-84 39.61450000000001 41.0 41.0 41.0 37.0 41.0 85-89 39.564800000000005 41.0 41.0 41.0 37.0 41.0 90-94 39.4974 41.0 41.0 41.0 37.0 41.0 95-99 39.4902 41.0 41.0 41.0 37.0 41.0 100-104 39.40585 41.0 41.0 41.0 37.0 41.0 105-109 39.32875 41.0 41.0 41.0 37.0 41.0 110-114 39.30385 41.0 41.0 41.0 37.0 41.0 115-119 39.263600000000004 41.0 41.0 41.0 37.0 41.0 120-124 39.2618 41.0 41.0 41.0 37.0 41.0 125-129 39.1896 41.0 41.0 41.0 37.0 41.0 130-134 38.94995 41.0 41.0 41.0 34.0 41.0 135-139 38.659400000000005 41.0 41.0 41.0 32.0 41.0 140-144 38.482749999999996 41.0 41.0 41.0 32.0 41.0 145-149 38.22985 41.0 37.0 41.0 32.0 41.0 150 38.08175 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 1.0 23 2.0 24 2.0 25 4.0 26 12.0 27 10.0 28 16.0 29 19.0 30 30.0 31 37.0 32 31.0 33 48.0 34 63.0 35 78.0 36 95.0 37 159.0 38 243.0 39 478.0 40 2669.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.59379689844922 14.282141070535268 8.629314657328663 39.49474737368684 2 14.649999999999999 13.725000000000001 42.825 28.799999999999997 3 15.275 20.0 30.85 33.875 4 22.725 27.900000000000002 24.275 25.1 5 21.175 34.4 25.25 19.175 6 17.45 35.35 27.125 20.075000000000003 7 13.200000000000001 27.950000000000003 41.8 17.05 8 14.649999999999999 26.025 34.55 24.775 9 15.325 26.325 35.225 23.125 10-14 18.72 29.28 28.610000000000003 23.39 15-19 18.834999999999997 28.555000000000003 28.48 24.13 20-24 18.975 28.199999999999996 28.93 23.895 25-29 19.095000000000002 29.110000000000003 27.985 23.810000000000002 30-34 18.75 28.88 28.754999999999995 23.615 35-39 19.39 29.345 27.865000000000002 23.400000000000002 40-44 19.08 29.345 27.775 23.799999999999997 45-49 18.884999999999998 28.389999999999997 28.305000000000003 24.42 50-54 19.035 29.24 28.345 23.380000000000003 55-59 19.005 28.68 28.065 24.25 60-64 19.064999999999998 29.304999999999996 28.194999999999997 23.435 65-69 19.625 29.075 27.944999999999997 23.355 70-74 19.61 28.665000000000003 28.050000000000004 23.674999999999997 75-79 19.575 28.675 28.189999999999998 23.56 80-84 19.575 28.29 27.665 24.47 85-89 19.689999999999998 28.32 28.444999999999997 23.544999999999998 90-94 19.41 28.67 28.04 23.880000000000003 95-99 19.545 27.939999999999998 28.98 23.535 100-104 19.919999999999998 28.37 27.965 23.745 105-109 19.72 27.91 27.97 24.4 110-114 18.935 28.435 28.27 24.36 115-119 19.29 28.615000000000002 28.134999999999998 23.96 120-124 19.775000000000002 28.715000000000003 27.35 24.16 125-129 19.845 28.315 28.000000000000004 23.84 130-134 19.64 28.395 28.065 23.9 135-139 20.05 27.944999999999997 28.544999999999998 23.46 140-144 19.899974993748437 28.782195548887223 27.851962990747687 23.465866466616657 145-149 20.34 27.875 27.694999999999997 24.09 150 18.275 27.925 28.825 24.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.0 21 1.0 22 1.5 23 2.5 24 5.5 25 3.5 26 3.0 27 13.5 28 17.5 29 14.5 30 21.0 31 33.5 32 44.5 33 55.5 34 67.5 35 77.5 36 94.0 37 127.0 38 156.5 39 183.0 40 213.5 41 242.5 42 261.0 43 273.5 44 291.0 45 270.0 46 252.5 47 248.0 48 208.0 49 183.5 50 151.0 51 118.5 52 93.0 53 63.0 54 49.0 55 36.0 56 26.0 57 16.0 58 17.5 59 19.0 60 13.0 61 9.0 62 5.0 63 1.5 64 1.5 65 2.5 66 1.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.32440241660099 90.725 2 4.386656159705805 8.35 3 0.21013921723141582 0.6 4 0.052534804307853955 0.2 5 0.026267402153926978 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTATG 5 0.125 TruSeq Adapter, Index 13 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.0875 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1375 0.0 0.0 0.0 0.0 128-129 0.16249999999999998 0.0 0.0 0.0 0.0 130-131 0.1875 0.0 0.0 0.0 0.0 132-133 0.225 0.0 0.0 0.0 0.0 134-135 0.225 0.0 0.0 0.0 0.0 136-137 0.225 0.0 0.0 0.0 0.0 138 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTGTA 10 0.006973645 144.0 2 >>END_MODULE SRR14639572 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639572_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.54875 32.0 32.0 32.0 27.0 32.0 2 30.9025 32.0 32.0 32.0 32.0 32.0 3 34.21625 37.0 32.0 37.0 32.0 37.0 4 34.96875 37.0 37.0 37.0 32.0 37.0 5 35.2425 37.0 37.0 37.0 32.0 37.0 6 38.403 41.0 41.0 41.0 32.0 41.0 7 38.29575 41.0 41.0 41.0 32.0 41.0 8 38.44175 41.0 41.0 41.0 32.0 41.0 9 38.571 41.0 41.0 41.0 32.0 41.0 10-14 38.550799999999995 41.0 41.0 41.0 32.0 41.0 15-19 38.31055 41.0 41.0 41.0 32.0 41.0 20-24 38.0831 41.0 41.0 41.0 29.0 41.0 25-29 37.76005 41.0 37.8 41.0 27.0 41.0 30-34 37.7154 41.0 37.0 41.0 27.0 41.0 35-39 37.70115 41.0 37.0 41.0 27.0 41.0 40-44 37.37615 41.0 37.0 41.0 27.0 41.0 45-49 37.3766 41.0 37.0 41.0 27.0 41.0 50-54 37.24675 41.0 37.0 41.0 27.0 41.0 55-59 37.16135 41.0 37.0 41.0 27.0 41.0 60-64 37.100849999999994 41.0 37.0 41.0 27.0 41.0 65-69 36.86095 41.0 37.0 41.0 25.0 41.0 70-74 36.620599999999996 41.0 37.0 41.0 22.0 41.0 75-79 35.793899999999994 40.2 35.0 41.0 23.0 41.0 80-84 36.810449999999996 41.0 37.0 41.0 22.0 41.0 85-89 36.89735 41.0 37.0 41.0 23.0 41.0 90-94 36.4703 41.0 37.0 41.0 22.0 41.0 95-99 36.62845 41.0 37.0 41.0 22.0 41.0 100-104 36.276500000000006 41.0 37.0 41.0 22.0 41.0 105-109 36.35305 41.0 37.0 41.0 22.0 41.0 110-114 36.2927 41.0 37.0 41.0 22.0 41.0 115-119 35.96015 41.0 36.0 41.0 20.0 41.0 120-124 36.08820000000001 41.0 37.0 41.0 22.0 41.0 125-129 35.48989999999999 41.0 34.0 41.0 20.0 41.0 130-134 35.595000000000006 41.0 35.0 41.0 22.0 41.0 135-139 35.030300000000004 41.0 32.0 41.0 18.0 41.0 140-144 34.79645 41.0 32.0 41.0 18.0 41.0 145-149 34.58665 40.2 31.0 41.0 12.0 41.0 150 34.188 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 5.0 16 7.0 17 20.0 18 14.0 19 27.0 20 23.0 21 25.0 22 35.0 23 53.0 24 59.0 25 39.0 26 46.0 27 69.0 28 52.0 29 53.0 30 81.0 31 95.0 32 100.0 33 95.0 34 142.0 35 152.0 36 161.0 37 226.0 38 308.0 39 570.0 40 1540.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.94736842105263 26.416040100250626 8.045112781954886 26.591478696741856 2 20.0 28.975 37.1 13.925 3 17.8 27.55 33.95 20.7 4 21.55 35.9 22.5 20.05 5 22.125 39.15 22.2 16.525000000000002 6 18.55 39.225 24.925 17.299999999999997 7 19.5 23.549999999999997 37.4 19.55 8 17.95 25.5 31.5 25.05 9 20.175 23.925 32.4 23.5 10-14 22.31 28.194999999999997 27.445000000000004 22.05 15-19 22.2 27.775 28.395 21.63 20-24 22.02 28.389999999999997 28.465 21.125 25-29 22.384999999999998 28.53 28.275 20.810000000000002 30-34 22.45 28.349999999999998 28.444999999999997 20.755000000000003 35-39 22.435 27.785 28.53 21.25 40-44 22.17 28.375 27.544999999999998 21.91 45-49 22.64 28.810000000000002 27.805000000000003 20.745 50-54 22.46 28.46 27.639999999999997 21.44 55-59 22.745 27.905 27.705000000000002 21.645 60-64 22.38 28.34 27.875 21.404999999999998 65-69 22.085 28.685 27.83 21.4 70-74 22.835 27.884999999999998 28.095 21.185000000000002 75-79 22.89 28.134999999999998 27.565 21.41 80-84 23.189999999999998 27.97 27.98 20.86 85-89 23.02 27.975 28.115000000000002 20.89 90-94 22.88 28.265 27.05 21.805 95-99 23.06 28.33 27.755000000000003 20.855 100-104 23.015 27.99 27.310000000000002 21.685 105-109 23.085 28.205000000000002 27.85 20.86 110-114 22.585 28.33 28.09 20.995 115-119 22.975 28.475 27.12 21.43 120-124 23.150000000000002 28.48 27.74 20.630000000000003 125-129 22.855 27.965 27.750000000000004 21.43 130-134 22.505 28.34 27.889999999999997 21.265 135-139 23.35 27.725 27.485 21.44 140-144 23.265 28.4 27.875 20.46 145-149 23.26 28.005000000000003 27.325 21.41 150 22.125 28.075 28.599999999999998 21.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.5 20 2.5 21 2.5 22 2.0 23 4.0 24 3.5 25 4.0 26 7.0 27 7.5 28 8.0 29 11.5 30 12.5 31 20.0 32 31.5 33 41.5 34 63.5 35 82.5 36 106.0 37 125.0 38 152.5 39 174.0 40 191.0 41 237.5 42 274.0 43 269.0 44 257.0 45 258.0 46 248.5 47 243.5 48 223.0 49 187.5 50 147.0 51 120.5 52 106.5 53 80.0 54 62.0 55 58.5 56 48.5 57 31.5 58 24.0 59 22.5 60 15.0 61 7.5 62 6.0 63 4.0 64 2.0 65 0.5 66 1.0 67 2.0 68 1.5 69 1.0 70 1.0 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.08865710560626 92.125 2 3.650586701434159 7.000000000000001 3 0.15645371577574968 0.44999999999999996 4 0.07822685788787484 0.3 5 0.02607561929595828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCTC 5 0.125 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.037500000000000006 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1375 0.0 0.0 0.0 0.0 128-129 0.1875 0.0 0.0 0.0 0.0 130-131 0.21250000000000002 0.0 0.0 0.0 0.0 132-133 0.25 0.0 0.0 0.0 0.0 134-135 0.25 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGCCT 10 0.006973645 144.0 2 TTGGTAT 10 0.006973645 144.0 8 >>END_MODULE Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra Read 1156786 spots for SRR14639572.sra Written 1156786 spots for SRR14639572.sra Read 1156772 spots for SRR14639572.sra Written 1156772 spots for SRR14639572.sra SRR ids: ['SRR14639572.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w81swi_n SRR14639572.sra spots: 23135454 blocks: [[1, 1156772], [1156773, 2313544], [2313545, 3470316], [3470317, 4627088], [4627089, 5783860], [5783861, 6940632], [6940633, 8097404], [8097405, 9254176], [9254177, 10410948], [10410949, 11567720], [11567721, 12724492], [12724493, 13881264], [13881265, 15038036], [15038037, 16194808], [16194809, 17351580], [17351581, 18508352], [18508353, 19665124], [19665125, 20821896], [20821897, 21978668], [21978669, 23135454]] SRR14639572 file size 8564035 SRR14639572 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639572 SRR14639572_1.fastq SRR14639572_2.fastq Input file: SRR14639572_1.fastq Paired file: SRR14639572_2.fastq trimmed: SRR14639572-trimmed-pair1.fastq, SRR14639572-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:40:05 2025 >> started Fri Feb 14 08:40:50 2025 >> done (44.753s) 23135454 read pairs processed; of these: 147 ( 0.00%) short read pairs filtered out after trimming by size control 76 ( 0.00%) empty read pairs filtered out after trimming by size control 23135231 (100.00%) read pairs available; of these: 516513 ( 2.23%) trimmed read pairs available after processing 22618718 (97.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 28 0.00% 20 25 0.00% 21 25 0.00% 22 34 0.00% 23 24 0.00% 24 24 0.00% 25 30 0.00% 26 23 0.00% 27 50 0.00% 28 33 0.00% 29 38 0.00% 30 42 0.00% 31 48 0.00% 32 40 0.00% 33 44 0.00% 34 47 0.00% 35 49 0.00% 36 59 0.00% 37 57 0.00% 38 68 0.00% 39 58 0.00% 40 62 0.00% 41 49 0.00% 42 63 0.00% 43 59 0.00% 44 60 0.00% 45 83 0.00% 46 84 0.00% 47 67 0.00% 48 87 0.00% 49 72 0.00% 50 87 0.00% 51 70 0.00% 52 100 0.00% 53 94 0.00% 54 79 0.00% 55 91 0.00% 56 102 0.00% 57 90 0.00% 58 97 0.00% 59 106 0.00% 60 121 0.00% 61 118 0.00% 62 111 0.00% 63 125 0.00% 64 138 0.00% 65 138 0.00% 66 115 0.00% 67 161 0.00% 68 143 0.00% 69 142 0.00% 70 167 0.00% 71 186 0.00% 72 183 0.00% 73 193 0.00% 74 201 0.00% 75 216 0.00% 76 219 0.00% 77 214 0.00% 78 218 0.00% 79 283 0.00% 80 266 0.00% 81 268 0.00% 82 312 0.00% 83 314 0.00% 84 330 0.00% 85 315 0.00% 86 341 0.00% 87 353 0.00% 88 403 0.00% 89 402 0.00% 90 447 0.00% 91 471 0.00% 92 482 0.00% 93 529 0.00% 94 600 0.00% 95 632 0.00% 96 624 0.00% 97 706 0.00% 98 718 0.00% 99 742 0.00% 100 826 0.00% 101 917 0.00% 102 925 0.00% 103 935 0.00% 104 1057 0.00% 105 1105 0.00% 106 1153 0.00% 107 1157 0.01% 108 1336 0.01% 109 1341 0.01% 110 1427 0.01% 111 1501 0.01% 112 1641 0.01% 113 1614 0.01% 114 1816 0.01% 115 1900 0.01% 116 2038 0.01% 117 2076 0.01% 118 2194 0.01% 119 2299 0.01% 120 2486 0.01% 121 2493 0.01% 122 2675 0.01% 123 2876 0.01% 124 2887 0.01% 125 3105 0.01% 126 3309 0.01% 127 3285 0.01% 128 3579 0.02% 129 3677 0.02% 130 3886 0.02% 131 4069 0.02% 132 4082 0.02% 133 4348 0.02% 134 4512 0.02% 135 4671 0.02% 136 4827 0.02% 137 5119 0.02% 138 5394 0.02% 139 5592 0.02% 140 5847 0.03% 141 6152 0.03% 142 6370 0.03% 143 6445 0.03% 144 6884 0.03% 145 7205 0.03% 146 7986 0.03% 147 10943 0.05% 148 26734 0.12% 149 310699 1.34% 150 22618718 97.77% 23135231 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=30 prefix-density=0.64 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=64.65 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=13.1 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=37 prefix-density=0.86 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=104.21 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.9 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639572 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:41:40 Started mapping on | Feb 14 08:41:40 Finished on | Feb 14 08:47:52 Mapping speed, Million of reads per hour | 223.89 Number of input reads | 23135231 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20806414 Uniquely mapped reads % | 89.93% Average mapped length | 297.32 Number of splices: Total | 21699008 Number of splices: Annotated (sjdb) | 21180619 Number of splices: GT/AG | 21298317 Number of splices: GC/AG | 320436 Number of splices: AT/AC | 15497 Number of splices: Non-canonical | 64758 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.02% Deletion average length | 3.16 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455838 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 14567 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.99% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1872979 1872979 1872979 N_multimapping 455838 455838 455838 N_noFeature 675262 20507498 737953 N_ambiguous 362833 1239 126076 UnstrandedReadsAssigned:19768319 PositiveStrandReadsAssigned:297677 NegativeStrandReadsAssigned:19942385 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639572 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639572-trimmed-pair1.fastq SRR14639572-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,135,231 reads, 20,335,362 reads pseudoaligned [quant] estimated average fragment length: 352.215 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR14639572.ke.tsv 34699 SRR14639572.se.tsv 87100 total ==> SRR14639572.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1666.78 1063 25.73 Potri.005G024800.1.v4.1 1035 683.785 362 21.3588 Potri.004G059700.1.v4.1 961 610.216 43 2.84297 Potri.007G009000.2.v4.1 1416 1064.78 0 0 Potri.003G141000.2.v4.1 2943 2591.78 1902.64 29.6172 Potri.016G087400.1.v4.1 270 49.9848 1428 1152.6 Potri.015G069301.1.v4.1 564 240.777 0 0 Potri.010G195200.1.v4.1 1773 1421.78 205 5.8171 Potri.012G127500.1.v4.1 977 626.009 62 3.99575 ==> SRR14639572.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 193 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 76 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 21 SRR14639572 completed mapping pipeline successfully