Starting /dee2/code/volunteer_pipeline.sh SRR14639573 current disk space = 3117826433024 free memory = 1449179596 SRR14639573 SRAfilesize aadb9466babadb14a4dee0058f64098c SRR14639573.sra SRR14639573.sra file validated SRR14639573 is paired end SRR14639573 is conventional basespace SRR14639573 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639573_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66 32.0 32.0 32.0 32.0 32.0 2 31.50125 32.0 32.0 32.0 32.0 32.0 3 35.31875 37.0 32.0 37.0 32.0 37.0 4 36.11875 37.0 37.0 37.0 32.0 37.0 5 36.315 37.0 37.0 37.0 37.0 37.0 6 39.93 41.0 41.0 41.0 37.0 41.0 7 39.8395 41.0 41.0 41.0 37.0 41.0 8 40.0585 41.0 41.0 41.0 37.0 41.0 9 40.15025 41.0 41.0 41.0 37.0 41.0 10-14 40.192550000000004 41.0 41.0 41.0 37.8 41.0 15-19 40.19664999999999 41.0 41.0 41.0 37.8 41.0 20-24 40.15665 41.0 41.0 41.0 37.0 41.0 25-29 40.18985 41.0 41.0 41.0 38.6 41.0 30-34 40.17444999999999 41.0 41.0 41.0 39.4 41.0 35-39 40.04045 41.0 41.0 41.0 37.0 41.0 40-44 40.0505 41.0 41.0 41.0 37.0 41.0 45-49 39.987300000000005 41.0 41.0 41.0 37.0 41.0 50-54 40.0115 41.0 41.0 41.0 37.0 41.0 55-59 39.8668 41.0 41.0 41.0 37.0 41.0 60-64 39.83975 41.0 41.0 41.0 37.0 41.0 65-69 39.712149999999994 41.0 41.0 41.0 37.0 41.0 70-74 39.5812 41.0 41.0 41.0 37.0 41.0 75-79 39.111549999999994 41.0 40.2 41.0 36.0 41.0 80-84 39.592999999999996 41.0 41.0 41.0 37.0 41.0 85-89 39.5655 41.0 41.0 41.0 37.0 41.0 90-94 39.530150000000006 41.0 41.0 41.0 37.0 41.0 95-99 39.43245 41.0 41.0 41.0 37.0 41.0 100-104 39.321299999999994 41.0 41.0 41.0 37.0 41.0 105-109 39.1793 41.0 41.0 41.0 37.0 41.0 110-114 39.19645 41.0 41.0 41.0 37.0 41.0 115-119 39.1822 41.0 41.0 41.0 37.0 41.0 120-124 39.116 41.0 41.0 41.0 37.0 41.0 125-129 39.078599999999994 41.0 41.0 41.0 36.0 41.0 130-134 38.8529 41.0 41.0 41.0 32.0 41.0 135-139 38.63645 41.0 41.0 41.0 32.0 41.0 140-144 38.33194999999999 41.0 38.6 41.0 32.0 41.0 145-149 38.16245 41.0 37.0 41.0 32.0 41.0 150 37.97625 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 1.0 23 3.0 24 1.0 25 5.0 26 7.0 27 12.0 28 12.0 29 12.0 30 31.0 31 36.0 32 42.0 33 54.0 34 70.0 35 99.0 36 112.0 37 144.0 38 235.0 39 542.0 40 2579.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0 13.5 10.95 38.550000000000004 2 14.875 13.450000000000001 42.95 28.725 3 15.25 19.15 30.3 35.3 4 20.575 26.924999999999997 25.674999999999997 26.825 5 20.724999999999998 32.75 26.950000000000003 19.575 6 17.05 33.85 26.525 22.575 7 13.875000000000002 28.050000000000004 41.325 16.75 8 14.124999999999998 23.325000000000003 37.325 25.224999999999998 9 14.875 24.0 35.699999999999996 25.424999999999997 10-14 19.36 28.59 28.12 23.93 15-19 18.9 28.115000000000002 28.29 24.695 20-24 18.34 27.950000000000003 29.020000000000003 24.69 25-29 18.965 28.610000000000003 28.21 24.215 30-34 18.790000000000003 28.16 28.665000000000003 24.385 35-39 19.235 28.535 27.49 24.740000000000002 40-44 19.84 28.435 27.58 24.145 45-49 18.935 28.93 27.800000000000004 24.335 50-54 18.790000000000003 28.189999999999998 27.834999999999997 25.185000000000002 55-59 19.105 28.125 28.449999999999996 24.32 60-64 18.655 28.34 28.475 24.529999999999998 65-69 19.07 28.52 28.525 23.885 70-74 19.455 28.12 28.389999999999997 24.035 75-79 19.134999999999998 28.345 28.275 24.245 80-84 19.885 27.744999999999997 27.6 24.77 85-89 19.46 27.935 28.155 24.45 90-94 19.725 28.125 28.199999999999996 23.95 95-99 19.53 27.935 27.85 24.685000000000002 100-104 19.68 28.884999999999998 27.084999999999997 24.349999999999998 105-109 19.87198719871987 28.717871787178716 26.977697769776977 24.432443244324435 110-114 19.695 28.439999999999998 27.675 24.19 115-119 20.27 28.12 27.805000000000003 23.805 120-124 20.52 28.144999999999996 27.455000000000002 23.880000000000003 125-129 19.99 28.044999999999998 27.375 24.59 130-134 20.244999999999997 27.735 28.51 23.51 135-139 20.3 27.67 27.72 24.310000000000002 140-144 20.117011701170117 28.06280628062806 27.432743274327432 24.387438743874387 145-149 20.305 27.905 27.400000000000002 24.39 150 21.099999999999998 27.775 27.325 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.0 19 3.0 20 2.5 21 1.5 22 1.5 23 1.5 24 3.5 25 5.0 26 3.0 27 5.5 28 13.5 29 15.0 30 18.0 31 28.0 32 41.0 33 56.0 34 69.5 35 81.5 36 93.5 37 121.5 38 162.5 39 188.5 40 217.0 41 229.5 42 225.0 43 247.0 44 271.0 45 264.5 46 252.0 47 230.0 48 200.5 49 174.5 50 139.5 51 112.0 52 92.0 53 78.0 54 69.0 55 57.0 56 43.0 57 35.5 58 35.0 59 28.5 60 20.0 61 17.0 62 10.5 63 6.5 64 5.5 65 6.0 66 4.0 67 2.5 68 3.0 69 1.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.15670650730412 88.625 2 5.471447543160691 10.299999999999999 3 0.3452855245683931 0.975 4 0.02656042496679947 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0125 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0125 0.0 0.0 0.025 0.0 106-107 0.025 0.0 0.0 0.025 0.0 108-109 0.025 0.0 0.0 0.025 0.0 110-111 0.025 0.0 0.0 0.025 0.0 112-113 0.025 0.0 0.0 0.025 0.0 114-115 0.025 0.0 0.0 0.025 0.0 116-117 0.025 0.0 0.0 0.025 0.0 118-119 0.0625 0.0 0.0 0.025 0.0 120-121 0.075 0.0 0.0 0.025 0.0 122-123 0.1 0.0 0.0 0.025 0.0 124-125 0.1 0.0 0.0 0.025 0.0 126-127 0.1 0.0 0.0 0.025 0.0 128-129 0.1 0.0 0.0 0.025 0.0 130-131 0.125 0.0 0.0 0.025 0.0 132-133 0.16249999999999998 0.0 0.0 0.025 0.0 134-135 0.1875 0.0 0.0 0.025 0.0 136-137 0.2 0.0 0.0 0.025 0.0 138 0.2 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCGC 10 0.006973645 144.0 4 CAAAACT 10 0.006973645 144.0 1 >>END_MODULE SRR14639573 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639573_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.72 32.0 32.0 32.0 32.0 32.0 2 30.73125 32.0 32.0 32.0 32.0 32.0 3 34.00375 37.0 32.0 37.0 32.0 37.0 4 34.97375 37.0 37.0 37.0 32.0 37.0 5 35.16 37.0 37.0 37.0 32.0 37.0 6 38.349 41.0 41.0 41.0 32.0 41.0 7 38.39075 41.0 41.0 41.0 32.0 41.0 8 38.30925 41.0 41.0 41.0 32.0 41.0 9 38.42825 41.0 41.0 41.0 32.0 41.0 10-14 38.539350000000006 41.0 41.0 41.0 32.0 41.0 15-19 38.26875 41.0 41.0 41.0 32.0 41.0 20-24 38.18945 41.0 41.0 41.0 31.0 41.0 25-29 37.8566 41.0 37.8 41.0 28.0 41.0 30-34 37.798750000000005 41.0 37.0 41.0 27.0 41.0 35-39 37.70215 41.0 37.0 41.0 27.0 41.0 40-44 37.5227 41.0 37.0 41.0 27.0 41.0 45-49 37.40025 41.0 37.0 41.0 27.0 41.0 50-54 37.173350000000006 41.0 37.0 41.0 27.0 41.0 55-59 37.213350000000005 41.0 37.0 41.0 27.0 41.0 60-64 37.230599999999995 41.0 37.0 41.0 27.0 41.0 65-69 36.91930000000001 41.0 37.0 41.0 26.0 41.0 70-74 36.61865 41.0 37.0 41.0 23.0 41.0 75-79 35.721450000000004 40.2 35.0 41.0 22.0 41.0 80-84 36.812149999999995 41.0 37.0 41.0 22.0 41.0 85-89 36.772400000000005 41.0 37.0 41.0 22.0 41.0 90-94 36.475 41.0 37.0 41.0 22.0 41.0 95-99 36.6282 41.0 37.0 41.0 22.0 41.0 100-104 36.2536 41.0 37.0 41.0 22.0 41.0 105-109 36.2217 41.0 37.0 41.0 22.0 41.0 110-114 36.181349999999995 41.0 37.0 41.0 22.0 41.0 115-119 35.89565 41.0 36.0 41.0 22.0 41.0 120-124 36.0059 41.0 37.0 41.0 22.0 41.0 125-129 35.3992 41.0 34.0 41.0 18.0 41.0 130-134 35.3965 41.0 33.0 41.0 22.0 41.0 135-139 34.917199999999994 41.0 34.0 41.0 16.0 41.0 140-144 34.564699999999995 41.0 32.0 41.0 14.0 41.0 145-149 34.340650000000004 40.2 31.0 41.0 12.0 41.0 150 33.8945 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 10.0 16 13.0 17 19.0 18 19.0 19 23.0 20 25.0 21 29.0 22 32.0 23 37.0 24 51.0 25 56.0 26 42.0 27 49.0 28 72.0 29 73.0 30 69.0 31 84.0 32 77.0 33 108.0 34 143.0 35 149.0 36 198.0 37 214.0 38 346.0 39 573.0 40 1489.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.16086193936356 26.45953395139063 9.19569030318216 26.183913806063643 2 19.375 27.275 38.35 15.0 3 16.375 26.1 35.975 21.55 4 21.975 35.099999999999994 23.1 19.825 5 22.675 38.074999999999996 22.85 16.400000000000002 6 18.475 38.975 24.15 18.4 7 19.325 23.225 36.95 20.5 8 17.849999999999998 24.2 32.300000000000004 25.650000000000002 9 19.25 24.099999999999998 32.35 24.3 10-14 23.165 27.54 26.945000000000004 22.35 15-19 22.634999999999998 28.000000000000004 27.800000000000004 21.565 20-24 22.335 28.249999999999996 28.01 21.404999999999998 25-29 22.79 27.975 27.555000000000003 21.68 30-34 22.795 28.044999999999998 27.810000000000002 21.349999999999998 35-39 23.645 27.165 27.715 21.475 40-44 22.97 28.1 28.044999999999998 20.885 45-49 22.68 27.87 27.785 21.665 50-54 23.015 27.82 28.499999999999996 20.665 55-59 23.165 28.215 27.589999999999996 21.029999999999998 60-64 23.57 28.060000000000002 27.155 21.215 65-69 22.86 28.15 27.375 21.615000000000002 70-74 23.26 28.749999999999996 26.99 21.0 75-79 23.34 27.529999999999998 27.825 21.305 80-84 22.975 27.384999999999998 27.705000000000002 21.935 85-89 23.25 27.855 27.700000000000003 21.195 90-94 22.825 27.755000000000003 27.76 21.66 95-99 23.05 27.639999999999997 27.355 21.955 100-104 23.71 27.810000000000002 27.83 20.65 105-109 23.35 27.794999999999998 27.785 21.07 110-114 22.95 28.610000000000003 27.43 21.01 115-119 23.3 28.09 27.389999999999997 21.22 120-124 23.3 27.46 27.76 21.48 125-129 22.425 28.625 26.995 21.955 130-134 24.515 27.58 26.97 20.935000000000002 135-139 23.5 27.52 27.6 21.38 140-144 23.77 27.815 27.05 21.365000000000002 145-149 23.799999999999997 27.525 26.724999999999998 21.95 150 24.525 26.974999999999998 28.4 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 2.5 20 2.0 21 0.5 22 1.5 23 1.5 24 3.0 25 5.0 26 7.5 27 9.5 28 12.5 29 17.5 30 20.0 31 28.0 32 33.0 33 36.5 34 57.0 35 68.5 36 87.5 37 124.5 38 147.5 39 179.0 40 198.0 41 216.5 42 228.5 43 235.0 44 275.0 45 262.5 46 237.5 47 239.5 48 201.0 49 170.5 50 145.0 51 118.0 52 113.0 53 94.5 54 79.0 55 66.0 56 49.0 57 49.0 58 38.5 59 23.5 60 24.0 61 24.0 62 17.5 63 9.5 64 7.0 65 5.0 66 1.5 67 2.0 68 4.0 69 3.5 70 1.5 71 1.5 72 2.5 73 1.5 74 2.0 75 2.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.90361763929232 89.85 2 4.673884341167151 8.85 3 0.36968576709796674 1.05 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.026406126221283337 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0125 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.037500000000000006 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.0875 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.16249999999999998 0.0 0.0 0.0 0.0 134-135 0.2375 0.0 0.0 0.0 0.0 136-137 0.25 0.0 0.0 0.0 0.0 138 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTTAC 10 0.006973645 144.0 6 TTACACT 10 0.006973645 144.0 9 GTCTGAG 10 0.006973645 144.0 1 GTTACAC 10 0.006973645 144.0 8 AAATGGT 10 0.006973645 144.0 1 GGTGTTA 10 0.006973645 144.0 5 >>END_MODULE Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249018 spots for SRR14639573.sra Written 1249018 spots for SRR14639573.sra Read 1249026 spots for SRR14639573.sra Written 1249026 spots for SRR14639573.sra SRR ids: ['SRR14639573.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ht9q7aog SRR14639573.sra spots: 24980368 blocks: [[1, 1249018], [1249019, 2498036], [2498037, 3747054], [3747055, 4996072], [4996073, 6245090], [6245091, 7494108], [7494109, 8743126], [8743127, 9992144], [9992145, 11241162], [11241163, 12490180], [12490181, 13739198], [13739199, 14988216], [14988217, 16237234], [16237235, 17486252], [17486253, 18735270], [18735271, 19984288], [19984289, 21233306], [21233307, 22482324], [22482325, 23731342], [23731343, 24980368]] SRR14639573 file size 9247806 SRR14639573 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639573 SRR14639573_1.fastq SRR14639573_2.fastq Input file: SRR14639573_1.fastq Paired file: SRR14639573_2.fastq trimmed: SRR14639573-trimmed-pair1.fastq, SRR14639573-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:33:13 2025 >> started Fri Feb 14 08:33:40 2025 >> done (26.990s) 24980368 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 54 ( 0.00%) empty read pairs filtered out after trimming by size control 24980202 (100.00%) read pairs available; of these: 537208 ( 2.15%) trimmed read pairs available after processing 24442994 (97.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 20 0.00% 20 14 0.00% 21 29 0.00% 22 16 0.00% 23 32 0.00% 24 17 0.00% 25 31 0.00% 26 25 0.00% 27 31 0.00% 28 28 0.00% 29 34 0.00% 30 35 0.00% 31 40 0.00% 32 39 0.00% 33 47 0.00% 34 46 0.00% 35 43 0.00% 36 44 0.00% 37 47 0.00% 38 64 0.00% 39 49 0.00% 40 69 0.00% 41 49 0.00% 42 43 0.00% 43 48 0.00% 44 56 0.00% 45 77 0.00% 46 69 0.00% 47 83 0.00% 48 61 0.00% 49 85 0.00% 50 78 0.00% 51 80 0.00% 52 75 0.00% 53 89 0.00% 54 85 0.00% 55 128 0.00% 56 120 0.00% 57 85 0.00% 58 100 0.00% 59 103 0.00% 60 102 0.00% 61 121 0.00% 62 114 0.00% 63 125 0.00% 64 132 0.00% 65 128 0.00% 66 126 0.00% 67 139 0.00% 68 140 0.00% 69 171 0.00% 70 172 0.00% 71 204 0.00% 72 159 0.00% 73 193 0.00% 74 194 0.00% 75 212 0.00% 76 209 0.00% 77 200 0.00% 78 204 0.00% 79 277 0.00% 80 288 0.00% 81 260 0.00% 82 313 0.00% 83 282 0.00% 84 308 0.00% 85 337 0.00% 86 364 0.00% 87 375 0.00% 88 424 0.00% 89 422 0.00% 90 463 0.00% 91 482 0.00% 92 495 0.00% 93 531 0.00% 94 618 0.00% 95 589 0.00% 96 605 0.00% 97 657 0.00% 98 697 0.00% 99 750 0.00% 100 789 0.00% 101 836 0.00% 102 850 0.00% 103 1002 0.00% 104 927 0.00% 105 1066 0.00% 106 1170 0.00% 107 1073 0.00% 108 1167 0.00% 109 1265 0.01% 110 1369 0.01% 111 1487 0.01% 112 1440 0.01% 113 1522 0.01% 114 1702 0.01% 115 1778 0.01% 116 1850 0.01% 117 1975 0.01% 118 2039 0.01% 119 2025 0.01% 120 2150 0.01% 121 2297 0.01% 122 2372 0.01% 123 2603 0.01% 124 2673 0.01% 125 2774 0.01% 126 2916 0.01% 127 2912 0.01% 128 3123 0.01% 129 3401 0.01% 130 3515 0.01% 131 3549 0.01% 132 3724 0.01% 133 3813 0.02% 134 3958 0.02% 135 4102 0.02% 136 4180 0.02% 137 4430 0.02% 138 4361 0.02% 139 4784 0.02% 140 4970 0.02% 141 5002 0.02% 142 5335 0.02% 143 5585 0.02% 144 5854 0.02% 145 6048 0.02% 146 6883 0.03% 147 10068 0.04% 148 27760 0.11% 149 349820 1.40% 150 24442994 97.85% 24980202 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=26.08 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=5.9 sequence=CCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCGGGACCAACAAGGGGTAGTACAGGAATATTCGCCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAACCCTTAGGTTTTCGGGGCATTGGATTCTCACCAATGTTTGCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCCACCCCCGCTCGCGCGGGTGCTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.61 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=104.29 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=12.8 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639573 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:34:44 Started mapping on | Feb 14 08:34:45 Finished on | Feb 14 08:38:12 Mapping speed, Million of reads per hour | 434.44 Number of input reads | 24980202 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21787411 Uniquely mapped reads % | 87.22% Average mapped length | 297.20 Number of splices: Total | 22127171 Number of splices: Annotated (sjdb) | 21615613 Number of splices: GT/AG | 21715362 Number of splices: GC/AG | 331880 Number of splices: AT/AC | 16053 Number of splices: Non-canonical | 63876 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.02% Deletion average length | 3.15 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 568152 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 755691 % of reads mapped to too many loci | 3.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.62% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2624639 2624639 2624639 N_multimapping 568152 568152 568152 N_noFeature 1045414 21445926 1109853 N_ambiguous 400463 1673 122625 UnstrandedReadsAssigned:20341534 PositiveStrandReadsAssigned:339812 NegativeStrandReadsAssigned:20554933 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639573 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639573-trimmed-pair1.fastq SRR14639573-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,980,202 reads, 21,592,571 reads pseudoaligned [quant] estimated average fragment length: 363.707 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52401 SRR14639573.ke.tsv 34699 SRR14639573.se.tsv 87100 total ==> SRR14639573.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1655.29 834 18.4983 Potri.005G024800.1.v4.1 1035 672.293 309 16.8749 Potri.004G059700.1.v4.1 961 598.679 79 4.84479 Potri.007G009000.2.v4.1 1416 1053.29 0 0 Potri.003G141000.2.v4.1 2943 2580.29 1895.56 26.9717 Potri.016G087400.1.v4.1 270 46.9984 1157 903.839 Potri.015G069301.1.v4.1 564 231.794 0 0 Potri.010G195200.1.v4.1 1773 1410.29 63 1.64011 Potri.012G127500.1.v4.1 977 614.518 36 2.15084 ==> SRR14639573.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 240 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR14639573 completed mapping pipeline successfully