Starting /dee2/code/volunteer_pipeline.sh SRR14639574 current disk space = 3116037754880 free memory = 1577095556 SRR14639574 SRAfilesize 3733fc5fa992f478a0641caa1d44eb53 SRR14639574.sra SRR14639574.sra file validated SRR14639574 is paired end SRR14639574 is conventional basespace SRR14639574 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639574_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63375 32.0 32.0 32.0 32.0 32.0 2 31.49 32.0 32.0 32.0 32.0 32.0 3 35.08625 37.0 32.0 37.0 32.0 37.0 4 36.14875 37.0 37.0 37.0 32.0 37.0 5 36.1325 37.0 37.0 37.0 37.0 37.0 6 39.8245 41.0 41.0 41.0 37.0 41.0 7 39.76975 41.0 41.0 41.0 37.0 41.0 8 39.911 41.0 41.0 41.0 37.0 41.0 9 40.05475 41.0 41.0 41.0 37.0 41.0 10-14 40.17635 41.0 41.0 41.0 37.8 41.0 15-19 40.1873 41.0 41.0 41.0 37.0 41.0 20-24 40.17764999999999 41.0 41.0 41.0 37.0 41.0 25-29 40.16705 41.0 41.0 41.0 37.8 41.0 30-34 40.1691 41.0 41.0 41.0 38.6 41.0 35-39 40.057100000000005 41.0 41.0 41.0 37.0 41.0 40-44 40.02065 41.0 41.0 41.0 37.0 41.0 45-49 39.95665 41.0 41.0 41.0 37.0 41.0 50-54 39.964600000000004 41.0 41.0 41.0 37.0 41.0 55-59 39.81535 41.0 41.0 41.0 37.0 41.0 60-64 39.8405 41.0 41.0 41.0 37.0 41.0 65-69 39.667950000000005 41.0 41.0 41.0 37.0 41.0 70-74 39.542350000000006 41.0 41.0 41.0 37.0 41.0 75-79 39.0943 41.0 40.2 41.0 36.0 41.0 80-84 39.627449999999996 41.0 41.0 41.0 37.0 41.0 85-89 39.59035 41.0 41.0 41.0 37.0 41.0 90-94 39.5052 41.0 41.0 41.0 37.0 41.0 95-99 39.4504 41.0 41.0 41.0 37.0 41.0 100-104 39.346849999999996 41.0 41.0 41.0 37.0 41.0 105-109 39.3055 41.0 41.0 41.0 37.0 41.0 110-114 39.26780000000001 41.0 41.0 41.0 37.0 41.0 115-119 39.19495 41.0 41.0 41.0 37.0 41.0 120-124 39.24915 41.0 41.0 41.0 37.0 41.0 125-129 39.22505 41.0 41.0 41.0 37.0 41.0 130-134 38.95745 41.0 41.0 41.0 34.0 41.0 135-139 38.68175000000001 41.0 41.0 41.0 32.0 41.0 140-144 38.54705 41.0 41.0 41.0 32.0 41.0 145-149 38.363350000000004 41.0 37.0 41.0 32.0 41.0 150 38.0645 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 1.0 24 3.0 25 5.0 26 8.0 27 11.0 28 15.0 29 21.0 30 28.0 31 29.0 32 46.0 33 66.0 34 59.0 35 88.0 36 110.0 37 153.0 38 220.0 39 482.0 40 2652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.51625812906453 12.581290645322662 8.22911455727864 46.673336668334166 2 14.35 13.325000000000001 44.85 27.474999999999998 3 14.075 16.6 30.375000000000004 38.95 4 21.775 24.725 24.224999999999998 29.275000000000002 5 21.625 32.225 27.075 19.075 6 16.575 32.925 29.975 20.525 7 13.25 28.549999999999997 40.550000000000004 17.65 8 14.424999999999999 25.424999999999997 38.025 22.125 9 14.924999999999999 24.5 36.475 24.099999999999998 10-14 18.425 29.575000000000003 29.049999999999997 22.95 15-19 18.655 27.925 28.560000000000002 24.86 20-24 19.189999999999998 28.410000000000004 28.23 24.169999999999998 25-29 18.975 29.365000000000002 28.16 23.5 30-34 18.884999999999998 28.985 27.500000000000004 24.63 35-39 18.785 29.345 28.04 23.830000000000002 40-44 19.37 28.349999999999998 28.4 23.880000000000003 45-49 19.395 28.03 28.415000000000003 24.16 50-54 19.38 28.49 28.29 23.84 55-59 19.040000000000003 28.465 28.51 23.985 60-64 18.8 28.735 28.285 24.18 65-69 18.310000000000002 28.560000000000002 28.955 24.175 70-74 18.85 28.565 28.01 24.575 75-79 19.2 29.439999999999998 27.97 23.39 80-84 19.495 28.49 28.23 23.785 85-89 19.615 28.32 28.17 23.895 90-94 19.325 28.189999999999998 27.860000000000003 24.625 95-99 19.335 28.025 28.275 24.365000000000002 100-104 19.895 27.655 28.415000000000003 24.035 105-109 19.246924692469246 27.88278827882788 28.247824782478247 24.62246224622462 110-114 19.509999999999998 28.16 28.694999999999997 23.635 115-119 19.265 27.66 28.515 24.560000000000002 120-124 19.55 27.965 28.285 24.2 125-129 19.775000000000002 27.85 28.694999999999997 23.68 130-134 20.0 27.450000000000003 28.64 23.91 135-139 19.915 28.275 27.615000000000002 24.195 140-144 20.15903180636127 28.210642128425683 27.885577115423082 23.744748949789958 145-149 19.435 27.884999999999998 28.485 24.195 150 19.5 28.825 27.675 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 4.0 26 6.5 27 7.5 28 8.5 29 11.5 30 17.5 31 27.5 32 36.0 33 38.5 34 51.0 35 88.0 36 112.5 37 133.5 38 161.0 39 169.0 40 193.5 41 248.0 42 274.5 43 287.0 44 303.5 45 287.5 46 258.5 47 253.0 48 223.5 49 171.5 50 144.0 51 123.5 52 91.5 53 63.5 54 52.5 55 40.0 56 30.0 57 19.0 58 12.5 59 13.0 60 10.5 61 6.5 62 4.0 63 1.5 64 1.0 65 1.0 66 1.5 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.3 #Duplication Level Percentage of deduplicated Percentage of total 1 95.19937040923399 90.725 2 4.669464847848898 8.9 3 0.13116474291710387 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.1375 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.15 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.15 0.0 0.0 0.0 0.0 136-137 0.16249999999999998 0.0 0.0 0.0 0.0 138 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCTT 10 0.006973645 144.0 4 >>END_MODULE SRR14639574 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639574_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.79625 32.0 32.0 32.0 32.0 32.0 2 30.9675 32.0 32.0 32.0 32.0 32.0 3 34.42125 37.0 32.0 37.0 32.0 37.0 4 35.27375 37.0 37.0 37.0 32.0 37.0 5 35.44875 37.0 37.0 37.0 32.0 37.0 6 38.64975 41.0 41.0 41.0 32.0 41.0 7 38.56125 41.0 41.0 41.0 32.0 41.0 8 38.56875 41.0 41.0 41.0 32.0 41.0 9 38.82125 41.0 41.0 41.0 37.0 41.0 10-14 38.7354 41.0 41.0 41.0 34.0 41.0 15-19 38.588 41.0 41.0 41.0 32.0 41.0 20-24 38.475199999999994 41.0 41.0 41.0 32.0 41.0 25-29 38.13535 41.0 39.4 41.0 30.0 41.0 30-34 38.080949999999994 41.0 40.2 41.0 29.0 41.0 35-39 38.03445000000001 41.0 37.8 41.0 30.0 41.0 40-44 37.9057 41.0 37.0 41.0 28.0 41.0 45-49 37.70975 41.0 37.0 41.0 27.0 41.0 50-54 37.60210000000001 41.0 37.0 41.0 27.0 41.0 55-59 37.459649999999996 41.0 37.0 41.0 27.0 41.0 60-64 37.55205 41.0 37.0 41.0 27.0 41.0 65-69 37.24735 41.0 37.0 41.0 27.0 41.0 70-74 37.0484 41.0 37.0 41.0 25.0 41.0 75-79 36.3144 40.2 36.0 41.0 23.0 41.0 80-84 37.2015 41.0 37.0 41.0 26.0 41.0 85-89 37.245799999999996 41.0 37.0 41.0 26.0 41.0 90-94 36.982350000000004 41.0 37.0 41.0 24.0 41.0 95-99 37.10535 41.0 37.0 41.0 25.0 41.0 100-104 36.82935 41.0 37.0 41.0 25.0 41.0 105-109 36.65475 41.0 37.0 41.0 22.0 41.0 110-114 36.70985 41.0 37.0 41.0 22.0 41.0 115-119 36.39895 41.0 37.0 41.0 22.0 41.0 120-124 36.4431 41.0 37.0 41.0 22.0 41.0 125-129 35.86945000000001 41.0 36.0 41.0 20.0 41.0 130-134 35.9031 41.0 37.0 41.0 22.0 41.0 135-139 35.46355 41.0 35.0 41.0 20.0 41.0 140-144 35.085449999999994 41.0 32.0 41.0 18.0 41.0 145-149 35.06735 41.0 33.0 41.0 12.0 41.0 150 34.7905 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 3.0 16 9.0 17 13.0 18 15.0 19 25.0 20 34.0 21 25.0 22 26.0 23 26.0 24 24.0 25 40.0 26 32.0 27 52.0 28 38.0 29 73.0 30 63.0 31 86.0 32 106.0 33 107.0 34 119.0 35 173.0 36 193.0 37 245.0 38 310.0 39 534.0 40 1625.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.33007273639328 26.987710057687487 7.850514171055932 32.83170303486331 2 19.775000000000002 26.200000000000003 40.050000000000004 13.975000000000001 3 15.950000000000001 27.450000000000003 35.125 21.475 4 20.150000000000002 36.3 24.9 18.65 5 23.9 38.5 21.175 16.425 6 18.675 39.925 23.875 17.525 7 20.05 23.325000000000003 37.125 19.5 8 17.325 24.3 33.225 25.15 9 19.575 25.1 31.724999999999998 23.599999999999998 10-14 22.939999999999998 28.465 27.195000000000004 21.4 15-19 21.82 27.900000000000002 28.49 21.790000000000003 20-24 22.36 28.96 27.779999999999998 20.9 25-29 21.66 28.965000000000003 28.185 21.19 30-34 21.985 28.310000000000002 28.435 21.27 35-39 22.25 28.775000000000002 27.884999999999998 21.09 40-44 22.425 27.450000000000003 28.365000000000002 21.759999999999998 45-49 22.919999999999998 28.54 27.644999999999996 20.895 50-54 22.615 28.71 27.845 20.830000000000002 55-59 23.11 28.705000000000002 27.785 20.4 60-64 22.400000000000002 27.975 28.22 21.404999999999998 65-69 22.56 28.77 27.634999999999998 21.035 70-74 23.244999999999997 27.900000000000002 27.96 20.895 75-79 22.869999999999997 28.425 27.625 21.08 80-84 23.14 28.785 26.855 21.22 85-89 23.085 28.694999999999997 27.52 20.7 90-94 23.465 28.43 26.805 21.3 95-99 22.785 28.470000000000002 27.694999999999997 21.05 100-104 23.21 28.395 27.38 21.015 105-109 23.47 28.689999999999998 27.175 20.665 110-114 22.955000000000002 28.499999999999996 27.58 20.965 115-119 23.200000000000003 28.125 27.67 21.005 120-124 23.73 28.735 26.979999999999997 20.555 125-129 23.02 28.355000000000004 27.169999999999998 21.455 130-134 23.919999999999998 27.77 28.025 20.285 135-139 23.77 28.365000000000002 27.015 20.849999999999998 140-144 22.82 28.52 27.439999999999998 21.22 145-149 23.82 28.439999999999998 27.41 20.330000000000002 150 23.425 27.05 29.125 20.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 2.0 20 2.5 21 3.0 22 2.5 23 1.5 24 3.0 25 4.0 26 6.0 27 9.0 28 11.0 29 14.0 30 17.0 31 24.0 32 30.0 33 40.0 34 56.5 35 73.5 36 97.0 37 128.5 38 149.5 39 175.5 40 227.0 41 242.5 42 236.5 43 257.0 44 274.0 45 270.0 46 268.5 47 256.5 48 218.5 49 179.0 50 144.5 51 127.5 52 115.5 53 85.0 54 54.5 55 44.5 56 38.0 57 31.0 58 25.0 59 15.5 60 8.5 61 5.0 62 5.5 63 4.0 64 3.5 65 4.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.475 #Duplication Level Percentage of deduplicated Percentage of total 1 96.44985747603005 93.05 2 3.44648872764965 6.65 3 0.10365379632029023 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.0875 0.0 0.0 0.0 0.0 122-123 0.1125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.125 0.0 0.0 0.0 0.0 134-135 0.125 0.0 0.0 0.0 0.0 136-137 0.1375 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTCC 10 0.006973645 144.0 1 ATATTCC 10 0.006973645 144.0 5 AGCGAAG 10 0.006973645 144.0 1 >>END_MODULE Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276757 spots for SRR14639574.sra Written 1276757 spots for SRR14639574.sra Read 1276773 spots for SRR14639574.sra Written 1276773 spots for SRR14639574.sra SRR ids: ['SRR14639574.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f4rrqtg5 SRR14639574.sra spots: 25535156 blocks: [[1, 1276757], [1276758, 2553514], [2553515, 3830271], [3830272, 5107028], [5107029, 6383785], [6383786, 7660542], [7660543, 8937299], [8937300, 10214056], [10214057, 11490813], [11490814, 12767570], [12767571, 14044327], [14044328, 15321084], [15321085, 16597841], [16597842, 17874598], [17874599, 19151355], [19151356, 20428112], [20428113, 21704869], [21704870, 22981626], [22981627, 24258383], [24258384, 25535156]] SRR14639574 file size 9453454 SRR14639574 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639574 SRR14639574_1.fastq SRR14639574_2.fastq Input file: SRR14639574_1.fastq Paired file: SRR14639574_2.fastq trimmed: SRR14639574-trimmed-pair1.fastq, SRR14639574-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:06:37 2025 >> started Fri Feb 14 10:07:07 2025 >> done (30.850s) 25535156 read pairs processed; of these: 99 ( 0.00%) short read pairs filtered out after trimming by size control 32 ( 0.00%) empty read pairs filtered out after trimming by size control 25535025 (100.00%) read pairs available; of these: 515912 ( 2.02%) trimmed read pairs available after processing 25019113 (97.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 19 0.00% 20 34 0.00% 21 23 0.00% 22 32 0.00% 23 37 0.00% 24 28 0.00% 25 26 0.00% 26 35 0.00% 27 30 0.00% 28 39 0.00% 29 43 0.00% 30 48 0.00% 31 45 0.00% 32 41 0.00% 33 51 0.00% 34 54 0.00% 35 59 0.00% 36 48 0.00% 37 50 0.00% 38 67 0.00% 39 71 0.00% 40 65 0.00% 41 58 0.00% 42 72 0.00% 43 78 0.00% 44 80 0.00% 45 73 0.00% 46 91 0.00% 47 69 0.00% 48 90 0.00% 49 91 0.00% 50 134 0.00% 51 85 0.00% 52 101 0.00% 53 119 0.00% 54 109 0.00% 55 122 0.00% 56 131 0.00% 57 118 0.00% 58 137 0.00% 59 137 0.00% 60 149 0.00% 61 159 0.00% 62 145 0.00% 63 154 0.00% 64 173 0.00% 65 177 0.00% 66 190 0.00% 67 197 0.00% 68 168 0.00% 69 200 0.00% 70 220 0.00% 71 184 0.00% 72 245 0.00% 73 261 0.00% 74 281 0.00% 75 287 0.00% 76 309 0.00% 77 306 0.00% 78 323 0.00% 79 372 0.00% 80 342 0.00% 81 397 0.00% 82 434 0.00% 83 393 0.00% 84 471 0.00% 85 490 0.00% 86 466 0.00% 87 507 0.00% 88 531 0.00% 89 574 0.00% 90 600 0.00% 91 661 0.00% 92 716 0.00% 93 701 0.00% 94 719 0.00% 95 776 0.00% 96 858 0.00% 97 815 0.00% 98 930 0.00% 99 971 0.00% 100 988 0.00% 101 1047 0.00% 102 1126 0.00% 103 1182 0.00% 104 1272 0.00% 105 1347 0.01% 106 1328 0.01% 107 1411 0.01% 108 1484 0.01% 109 1579 0.01% 110 1607 0.01% 111 1753 0.01% 112 1819 0.01% 113 1821 0.01% 114 1981 0.01% 115 2056 0.01% 116 2213 0.01% 117 2345 0.01% 118 2386 0.01% 119 2564 0.01% 120 2644 0.01% 121 2689 0.01% 122 2754 0.01% 123 2952 0.01% 124 3121 0.01% 125 3135 0.01% 126 3414 0.01% 127 3554 0.01% 128 3725 0.01% 129 3832 0.02% 130 4020 0.02% 131 4081 0.02% 132 4244 0.02% 133 4327 0.02% 134 4567 0.02% 135 4777 0.02% 136 5081 0.02% 137 5242 0.02% 138 5396 0.02% 139 5558 0.02% 140 5683 0.02% 141 6222 0.02% 142 6246 0.02% 143 6300 0.02% 144 6596 0.03% 145 7017 0.03% 146 7726 0.03% 147 10227 0.04% 148 24758 0.10% 149 302999 1.19% 150 25019113 97.98% 25535025 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=34 prefix-density=0.53 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=75.64 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=15.6 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=37 prefix-density=0.70 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=66.84 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=15.1 sequence=CTCTCTCTTTCAAACCCTA SRR14639574 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:08:02 Started mapping on | Feb 14 10:08:03 Finished on | Feb 14 10:10:49 Mapping speed, Million of reads per hour | 553.77 Number of input reads | 25535025 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 23783450 Uniquely mapped reads % | 93.14% Average mapped length | 297.30 Number of splices: Total | 24610877 Number of splices: Annotated (sjdb) | 24042790 Number of splices: GT/AG | 24164304 Number of splices: GC/AG | 358460 Number of splices: AT/AC | 18487 Number of splices: Non-canonical | 69626 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.02% Deletion average length | 3.11 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 565861 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 19401 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1185714 1185714 1185714 N_multimapping 565861 565861 565861 N_noFeature 685532 23454881 753328 N_ambiguous 415797 1453 154551 UnstrandedReadsAssigned:22682121 PositiveStrandReadsAssigned:327116 NegativeStrandReadsAssigned:22875571 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639574 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639574-trimmed-pair1.fastq SRR14639574-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,535,025 reads, 23,113,347 reads pseudoaligned [quant] estimated average fragment length: 356.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR14639574.ke.tsv 34699 SRR14639574.se.tsv 87100 total ==> SRR14639574.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1662.03 2605 54.3627 Potri.005G024800.1.v4.1 1035 679.034 924 47.197 Potri.004G059700.1.v4.1 961 605.399 118 6.76042 Potri.007G009000.2.v4.1 1416 1060.03 0 0 Potri.003G141000.2.v4.1 2943 2587.03 2145.52 28.7649 Potri.016G087400.1.v4.1 270 48.0134 2053 1483.06 Potri.015G069301.1.v4.1 564 235.083 0 0 Potri.010G195200.1.v4.1 1773 1417.03 355 8.68924 Potri.012G127500.1.v4.1 977 621.252 63 3.51727 ==> SRR14639574.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 243 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 202 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 25 SRR14639574 completed mapping pipeline successfully