Starting /dee2/code/volunteer_pipeline.sh SRR14639575 current disk space = 2810406682624 free memory = 1579837936 SRR14639575 SRAfilesize 6a5f4d44b4a2de72df319313876d5861 SRR14639575.sra SRR14639575.sra file validated SRR14639575 is paired end SRR14639575 is conventional basespace SRR14639575 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66125 32.0 32.0 32.0 32.0 32.0 2 31.5625 32.0 32.0 32.0 32.0 32.0 3 35.21375 37.0 32.0 37.0 32.0 37.0 4 36.17375 37.0 37.0 37.0 37.0 37.0 5 36.39 37.0 37.0 37.0 37.0 37.0 6 39.87075 41.0 41.0 41.0 37.0 41.0 7 40.05375 41.0 41.0 41.0 37.0 41.0 8 40.22725 41.0 41.0 41.0 37.0 41.0 9 40.23625 41.0 41.0 41.0 37.0 41.0 10-14 40.232299999999995 41.0 41.0 41.0 39.4 41.0 15-19 40.303200000000004 41.0 41.0 41.0 41.0 41.0 20-24 40.266099999999994 41.0 41.0 41.0 39.4 41.0 25-29 40.2149 41.0 41.0 41.0 41.0 41.0 30-34 40.2492 41.0 41.0 41.0 40.2 41.0 35-39 40.1337 41.0 41.0 41.0 37.8 41.0 40-44 40.1222 41.0 41.0 41.0 37.8 41.0 45-49 40.057449999999996 41.0 41.0 41.0 37.0 41.0 50-54 40.05225 41.0 41.0 41.0 37.0 41.0 55-59 39.9693 41.0 41.0 41.0 37.0 41.0 60-64 39.91985 41.0 41.0 41.0 37.0 41.0 65-69 39.836400000000005 41.0 41.0 41.0 37.0 41.0 70-74 39.62745 41.0 41.0 41.0 37.0 41.0 75-79 39.256299999999996 41.0 40.2 41.0 36.0 41.0 80-84 39.69665 41.0 41.0 41.0 37.0 41.0 85-89 39.6488 41.0 41.0 41.0 37.0 41.0 90-94 39.62830000000001 41.0 41.0 41.0 37.0 41.0 95-99 39.55865 41.0 41.0 41.0 37.0 41.0 100-104 39.4695 41.0 41.0 41.0 37.0 41.0 105-109 39.39405 41.0 41.0 41.0 37.0 41.0 110-114 39.432 41.0 41.0 41.0 37.0 41.0 115-119 39.341950000000004 41.0 41.0 41.0 37.0 41.0 120-124 39.292049999999996 41.0 41.0 41.0 37.0 41.0 125-129 39.27815 41.0 41.0 41.0 37.0 41.0 130-134 39.02145 41.0 41.0 41.0 35.0 41.0 135-139 38.79175 41.0 41.0 41.0 32.0 41.0 140-144 38.498599999999996 41.0 41.0 41.0 32.0 41.0 145-149 38.336149999999996 41.0 37.0 41.0 32.0 41.0 150 38.1435 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 3.0 23 3.0 24 4.0 25 2.0 26 9.0 27 10.0 28 7.0 29 9.0 30 29.0 31 29.0 32 37.0 33 54.0 34 71.0 35 78.0 36 94.0 37 143.0 38 235.0 39 463.0 40 2718.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.35 13.750000000000002 8.625 46.275 2 14.875 12.2 43.625 29.299999999999997 3 14.85 17.9 31.275 35.975 4 20.275000000000002 25.974999999999998 25.825 27.925 5 21.6 32.975 27.075 18.35 6 16.775000000000002 35.4 28.575 19.25 7 14.399999999999999 26.375 42.199999999999996 17.025000000000002 8 14.6 24.375 36.95 24.075 9 14.399999999999999 24.75 36.925000000000004 23.925 10-14 19.189999999999998 28.804999999999996 28.634999999999998 23.369999999999997 15-19 18.625 28.560000000000002 28.88 23.935000000000002 20-24 18.235 28.910000000000004 29.220000000000002 23.635 25-29 18.72 28.715000000000003 28.87 23.695 30-34 18.385 29.395 28.285 23.935000000000002 35-39 19.85 28.71 28.335 23.105 40-44 18.72 29.044999999999998 28.360000000000003 23.875 45-49 19.13 28.849999999999998 27.76 24.26 50-54 19.21 29.445 27.51 23.835 55-59 19.509999999999998 29.335 27.355 23.799999999999997 60-64 18.83 28.794999999999998 28.77 23.605 65-69 19.095000000000002 28.425 28.42 24.060000000000002 70-74 19.405 28.955 28.18 23.46 75-79 19.634999999999998 28.144999999999996 28.42 23.799999999999997 80-84 19.045 28.43 28.52 24.005000000000003 85-89 19.314999999999998 28.895 27.705000000000002 24.085 90-94 19.91 28.645 27.855 23.59 95-99 19.259999999999998 28.985 28.305000000000003 23.45 100-104 19.580000000000002 28.605000000000004 28.389999999999997 23.425 105-109 19.75197519751975 29.01290129012901 27.63776377637764 23.597359735973598 110-114 19.48 28.78 28.000000000000004 23.74 115-119 18.970000000000002 28.71 28.235 24.085 120-124 19.175 28.435 28.38 24.01 125-129 19.06 28.53 28.595 23.815 130-134 19.535 28.655 27.97 23.84 135-139 19.37 28.544999999999998 28.015 24.07 140-144 19.54390878175635 27.945589117823566 28.905781156231246 23.604720944188838 145-149 19.905 28.335 28.060000000000002 23.7 150 19.125 28.675 26.775 25.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.0 21 4.5 22 4.5 23 4.0 24 7.5 25 5.5 26 4.0 27 6.5 28 8.0 29 16.5 30 26.0 31 29.5 32 31.5 33 44.0 34 60.5 35 79.0 36 99.0 37 128.5 38 165.5 39 200.5 40 217.5 41 235.0 42 266.5 43 291.5 44 311.5 45 283.0 46 241.5 47 226.0 48 215.0 49 189.5 50 152.5 51 113.0 52 84.5 53 69.0 54 52.0 55 32.5 56 21.5 57 19.5 58 12.5 59 8.5 60 6.5 61 4.5 62 4.5 63 4.0 64 2.5 65 2.5 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.175 #Duplication Level Percentage of deduplicated Percentage of total 1 96.33480634260462 92.65 2 3.3792565635560177 6.5 3 0.25994281258123214 0.75 4 0.02599428125812321 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.0875 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.16249999999999998 0.0 0.0 0.0 0.0 130-131 0.175 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.225 0.0 0.0 0.0 0.0 136-137 0.2875 0.0 0.0 0.0 0.0 138 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATATA 10 0.006973645 144.0 6 CTCTTAT 10 0.006973645 144.0 1 >>END_MODULE SRR14639575 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639575_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6425 32.0 32.0 32.0 27.0 32.0 2 30.92875 32.0 32.0 32.0 32.0 32.0 3 34.38625 37.0 32.0 37.0 32.0 37.0 4 35.0 37.0 37.0 37.0 32.0 37.0 5 35.39125 37.0 37.0 37.0 32.0 37.0 6 38.52025 41.0 41.0 41.0 32.0 41.0 7 38.408 41.0 41.0 41.0 32.0 41.0 8 38.45425 41.0 41.0 41.0 32.0 41.0 9 38.61175 41.0 41.0 41.0 32.0 41.0 10-14 38.62835 41.0 41.0 41.0 33.0 41.0 15-19 38.39215 41.0 41.0 41.0 32.0 41.0 20-24 38.228699999999996 41.0 41.0 41.0 31.0 41.0 25-29 37.8548 41.0 38.6 41.0 28.0 41.0 30-34 37.87195 41.0 38.6 41.0 27.0 41.0 35-39 37.844350000000006 41.0 37.0 41.0 27.0 41.0 40-44 37.61705 41.0 37.0 41.0 27.0 41.0 45-49 37.4858 41.0 37.0 41.0 27.0 41.0 50-54 37.299949999999995 41.0 37.0 41.0 27.0 41.0 55-59 37.322500000000005 41.0 37.0 41.0 27.0 41.0 60-64 37.268299999999996 41.0 37.0 41.0 27.0 41.0 65-69 37.007 41.0 37.0 41.0 27.0 41.0 70-74 36.7584 41.0 37.0 41.0 25.0 41.0 75-79 36.0485 40.2 35.0 41.0 23.0 41.0 80-84 36.991049999999994 41.0 37.0 41.0 25.0 41.0 85-89 36.955799999999996 41.0 37.0 41.0 25.0 41.0 90-94 36.70665 41.0 37.0 41.0 22.0 41.0 95-99 36.794650000000004 41.0 37.0 41.0 22.0 41.0 100-104 36.551 41.0 37.0 41.0 22.0 41.0 105-109 36.4707 41.0 37.0 41.0 22.0 41.0 110-114 36.53060000000001 41.0 37.0 41.0 22.0 41.0 115-119 36.0772 41.0 36.0 41.0 20.0 41.0 120-124 36.2699 41.0 37.0 41.0 22.0 41.0 125-129 35.83155 41.0 36.0 41.0 20.0 41.0 130-134 35.65285 41.0 36.0 41.0 22.0 41.0 135-139 35.207300000000004 41.0 34.0 41.0 18.0 41.0 140-144 35.0425 41.0 32.0 41.0 18.0 41.0 145-149 34.8565 41.0 32.0 41.0 14.0 41.0 150 34.351 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 8.0 17 13.0 18 24.0 19 26.0 20 26.0 21 21.0 22 28.0 23 21.0 24 31.0 25 54.0 26 51.0 27 64.0 28 69.0 29 87.0 30 58.0 31 81.0 32 103.0 33 111.0 34 112.0 35 154.0 36 199.0 37 226.0 38 332.0 39 559.0 40 1539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.90256152687092 28.37769964841788 8.186840783525867 29.532898041185334 2 19.475 27.55 37.875 15.1 3 16.375 27.750000000000004 36.3 19.575 4 20.349999999999998 34.425 25.025 20.200000000000003 5 22.575 39.275 22.75 15.4 6 18.05 40.025 26.5 15.425 7 19.85 23.025000000000002 36.7 20.424999999999997 8 18.0 24.55 32.1 25.35 9 18.625 24.775 32.9 23.7 10-14 21.985 29.304999999999996 27.72 20.990000000000002 15-19 21.915000000000003 28.389999999999997 28.585 21.11 20-24 21.995 28.625 28.125 21.255 25-29 21.985 28.76 28.775000000000002 20.48 30-34 22.220000000000002 28.48 28.505000000000003 20.794999999999998 35-39 22.42 28.15 28.24 21.19 40-44 22.485 28.275 28.28 20.96 45-49 21.959999999999997 28.465 28.67 20.905 50-54 22.82 28.59 28.105000000000004 20.485 55-59 22.395 28.395 27.994999999999997 21.215 60-64 22.564999999999998 28.125 28.475 20.835 65-69 21.91 28.249999999999996 28.294999999999998 21.545 70-74 22.73 28.375 27.845 21.05 75-79 22.645 28.02 28.315 21.02 80-84 23.119999999999997 28.04 28.000000000000004 20.84 85-89 23.71 28.67 27.11 20.51 90-94 22.46 28.465 28.21 20.865000000000002 95-99 23.235 27.99 27.92 20.855 100-104 23.06 28.34 27.589999999999996 21.01 105-109 22.745 28.065 28.435 20.755000000000003 110-114 22.68 29.065 27.589999999999996 20.665 115-119 23.745 27.860000000000003 28.055000000000003 20.34 120-124 23.044999999999998 28.675 27.650000000000002 20.630000000000003 125-129 23.52 28.349999999999998 27.555000000000003 20.575 130-134 23.535 28.43 28.055000000000003 19.98 135-139 23.195 28.575 27.584999999999997 20.645 140-144 23.26 28.189999999999998 28.155 20.395 145-149 22.625 28.384999999999998 27.655 21.335 150 23.9 28.975 27.525 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 2.5 21 3.5 22 3.5 23 4.5 24 7.5 25 8.5 26 8.5 27 12.5 28 15.0 29 18.0 30 27.0 31 28.0 32 31.0 33 50.0 34 64.5 35 78.5 36 97.0 37 112.0 38 150.0 39 193.5 40 216.5 41 239.0 42 259.5 43 275.0 44 285.5 45 274.5 46 246.5 47 233.0 48 215.5 49 181.0 50 144.0 51 114.0 52 96.0 53 74.0 54 51.5 55 34.0 56 27.0 57 27.0 58 20.5 59 17.5 60 15.0 61 10.5 62 7.0 63 4.5 64 3.5 65 1.5 66 1.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.575 #Duplication Level Percentage of deduplicated Percentage of total 1 96.68651307274139 93.375 2 3.0805073776857363 5.949999999999999 3 0.23297954957287084 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.275 0.0 0.0 0.0 0.0 134-135 0.30000000000000004 0.0 0.0 0.0 0.0 136-137 0.3625 0.0 0.0 0.0 0.0 138 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 60 2.3948356E-4 16.8 80-84 >>END_MODULE Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326411 spots for SRR14639575.sra Written 1326411 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra Read 1326403 spots for SRR14639575.sra Written 1326403 spots for SRR14639575.sra SRR ids: ['SRR14639575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1tb6o162 SRR14639575.sra spots: 26528068 blocks: [[1, 1326403], [1326404, 2652806], [2652807, 3979209], [3979210, 5305612], [5305613, 6632015], [6632016, 7958418], [7958419, 9284821], [9284822, 10611224], [10611225, 11937627], [11937628, 13264030], [13264031, 14590433], [14590434, 15916836], [15916837, 17243239], [17243240, 18569642], [18569643, 19896045], [19896046, 21222448], [21222449, 22548851], [22548852, 23875254], [23875255, 25201657], [25201658, 26528068]] SRR14639575 file size 9821474 SRR14639575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639575 SRR14639575_1.fastq SRR14639575_2.fastq Input file: SRR14639575_1.fastq Paired file: SRR14639575_2.fastq trimmed: SRR14639575-trimmed-pair1.fastq, SRR14639575-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Apr 11 12:18:02 2025 >> started Fri Apr 11 12:18:41 2025 >> done (38.788s) 26528068 read pairs processed; of these: 150 ( 0.00%) short read pairs filtered out after trimming by size control 307 ( 0.00%) empty read pairs filtered out after trimming by size control 26527611 (100.00%) read pairs available; of these: 477752 ( 1.80%) trimmed read pairs available after processing 26049859 (98.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 14 0.00% 20 20 0.00% 21 34 0.00% 22 49 0.00% 23 31 0.00% 24 38 0.00% 25 45 0.00% 26 34 0.00% 27 57 0.00% 28 36 0.00% 29 49 0.00% 30 47 0.00% 31 56 0.00% 32 56 0.00% 33 77 0.00% 34 61 0.00% 35 77 0.00% 36 71 0.00% 37 61 0.00% 38 115 0.00% 39 74 0.00% 40 72 0.00% 41 80 0.00% 42 97 0.00% 43 75 0.00% 44 78 0.00% 45 96 0.00% 46 86 0.00% 47 101 0.00% 48 98 0.00% 49 110 0.00% 50 93 0.00% 51 104 0.00% 52 103 0.00% 53 98 0.00% 54 116 0.00% 55 114 0.00% 56 130 0.00% 57 112 0.00% 58 125 0.00% 59 136 0.00% 60 124 0.00% 61 134 0.00% 62 164 0.00% 63 136 0.00% 64 134 0.00% 65 152 0.00% 66 163 0.00% 67 171 0.00% 68 157 0.00% 69 185 0.00% 70 211 0.00% 71 196 0.00% 72 225 0.00% 73 235 0.00% 74 243 0.00% 75 254 0.00% 76 243 0.00% 77 226 0.00% 78 268 0.00% 79 307 0.00% 80 283 0.00% 81 310 0.00% 82 340 0.00% 83 343 0.00% 84 361 0.00% 85 374 0.00% 86 356 0.00% 87 387 0.00% 88 462 0.00% 89 455 0.00% 90 480 0.00% 91 514 0.00% 92 487 0.00% 93 543 0.00% 94 569 0.00% 95 547 0.00% 96 633 0.00% 97 636 0.00% 98 723 0.00% 99 778 0.00% 100 761 0.00% 101 780 0.00% 102 853 0.00% 103 872 0.00% 104 953 0.00% 105 1040 0.00% 106 1087 0.00% 107 1098 0.00% 108 1164 0.00% 109 1248 0.00% 110 1267 0.00% 111 1331 0.01% 112 1405 0.01% 113 1444 0.01% 114 1557 0.01% 115 1620 0.01% 116 1804 0.01% 117 1861 0.01% 118 1806 0.01% 119 1962 0.01% 120 2043 0.01% 121 2055 0.01% 122 2166 0.01% 123 2341 0.01% 124 2532 0.01% 125 2553 0.01% 126 2684 0.01% 127 2801 0.01% 128 2845 0.01% 129 3012 0.01% 130 3155 0.01% 131 3192 0.01% 132 3348 0.01% 133 3374 0.01% 134 3493 0.01% 135 3853 0.01% 136 3839 0.01% 137 3950 0.01% 138 4084 0.02% 139 4492 0.02% 140 4459 0.02% 141 4695 0.02% 142 4711 0.02% 143 4861 0.02% 144 5223 0.02% 145 5415 0.02% 146 5990 0.02% 147 8365 0.03% 148 22722 0.09% 149 306932 1.16% 150 26049859 98.20% 26527611 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=37 prefix-density=0.52 prefix-fanout=1.9 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATG criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=112.66 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=22.4 sequence=CAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=42 prefix-density=0.68 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=115.28 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.2 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639575 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 11 12:19:35 Started mapping on | Apr 11 12:19:35 Finished on | Apr 11 12:22:30 Mapping speed, Million of reads per hour | 545.71 Number of input reads | 26527611 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 24521852 Uniquely mapped reads % | 92.44% Average mapped length | 297.36 Number of splices: Total | 25206960 Number of splices: Annotated (sjdb) | 24586467 Number of splices: GT/AG | 24749117 Number of splices: GC/AG | 360897 Number of splices: AT/AC | 19614 Number of splices: Non-canonical | 77332 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.03% Deletion average length | 3.14 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 629652 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 29028 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.02% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1376107 1376107 1376107 N_multimapping 629652 629652 629652 N_noFeature 801568 24218809 867990 N_ambiguous 403238 1293 166194 UnstrandedReadsAssigned:23317046 PositiveStrandReadsAssigned:301750 NegativeStrandReadsAssigned:23487668 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639575 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639575-trimmed-pair1.fastq SRR14639575-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,527,611 reads, 23,765,212 reads pseudoaligned [quant] estimated average fragment length: 364.699 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR14639575.ke.tsv 34699 SRR14639575.se.tsv 87100 total ==> SRR14639575.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1654.3 2448 52.3967 Potri.005G024800.1.v4.1 1035 671.301 878 46.3111 Potri.004G059700.1.v4.1 961 597.628 47 2.78467 Potri.007G009000.2.v4.1 1416 1052.3 0 0 Potri.003G141000.2.v4.1 2943 2579.3 2198 30.174 Potri.016G087400.1.v4.1 270 45.4684 2371 1846.42 Potri.015G069301.1.v4.1 564 227.313 0 0 Potri.010G195200.1.v4.1 1773 1409.3 686 17.2356 Potri.012G127500.1.v4.1 977 613.472 34 1.96242 ==> SRR14639575.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 91 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 185 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR14639575 completed mapping pipeline successfully