Starting /dee2/code/volunteer_pipeline.sh SRR14639576 current disk space = 3116981760000 free memory = 1493705840 SRR14639576 SRAfilesize deaae9579963dcc8b314558ade20cc19 SRR14639576.sra SRR14639576.sra file validated SRR14639576 is paired end SRR14639576 is conventional basespace SRR14639576 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639576_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.675 32.0 32.0 32.0 32.0 32.0 2 31.52875 32.0 32.0 32.0 32.0 32.0 3 35.29 37.0 32.0 37.0 32.0 37.0 4 36.16375 37.0 37.0 37.0 32.0 37.0 5 36.3 37.0 37.0 37.0 37.0 37.0 6 39.8505 41.0 41.0 41.0 37.0 41.0 7 39.875 41.0 41.0 41.0 37.0 41.0 8 40.2975 41.0 41.0 41.0 37.0 41.0 9 40.2615 41.0 41.0 41.0 37.0 41.0 10-14 40.236650000000004 41.0 41.0 41.0 39.4 41.0 15-19 40.252500000000005 41.0 41.0 41.0 39.4 41.0 20-24 40.25935 41.0 41.0 41.0 41.0 41.0 25-29 40.23975 41.0 41.0 41.0 41.0 41.0 30-34 40.22475 41.0 41.0 41.0 41.0 41.0 35-39 40.17225 41.0 41.0 41.0 38.6 41.0 40-44 40.14065 41.0 41.0 41.0 37.8 41.0 45-49 40.118399999999994 41.0 41.0 41.0 37.0 41.0 50-54 40.0153 41.0 41.0 41.0 37.0 41.0 55-59 40.031850000000006 41.0 41.0 41.0 37.0 41.0 60-64 39.91745 41.0 41.0 41.0 37.0 41.0 65-69 39.816849999999995 41.0 41.0 41.0 37.0 41.0 70-74 39.67805 41.0 41.0 41.0 37.0 41.0 75-79 39.236599999999996 41.0 40.2 41.0 36.0 41.0 80-84 39.649699999999996 41.0 41.0 41.0 37.0 41.0 85-89 39.64355 41.0 41.0 41.0 37.0 41.0 90-94 39.65665 41.0 41.0 41.0 37.0 41.0 95-99 39.592200000000005 41.0 41.0 41.0 37.0 41.0 100-104 39.50055 41.0 41.0 41.0 37.0 41.0 105-109 39.40245 41.0 41.0 41.0 37.0 41.0 110-114 39.397149999999996 41.0 41.0 41.0 37.0 41.0 115-119 39.3994 41.0 41.0 41.0 37.0 41.0 120-124 39.259100000000004 41.0 41.0 41.0 37.0 41.0 125-129 39.3818 41.0 41.0 41.0 37.0 41.0 130-134 39.0492 41.0 41.0 41.0 35.0 41.0 135-139 38.794799999999995 41.0 41.0 41.0 32.0 41.0 140-144 38.6121 41.0 41.0 41.0 32.0 41.0 145-149 38.4002 41.0 37.0 41.0 32.0 41.0 150 38.0935 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 1.0 25 2.0 26 10.0 27 5.0 28 8.0 29 18.0 30 25.0 31 21.0 32 44.0 33 46.0 34 74.0 35 72.0 36 91.0 37 161.0 38 251.0 39 514.0 40 2652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.01650825412706 12.88144072036018 8.179089544772387 45.92296148074037 2 13.850000000000001 12.725 46.25 27.175 3 14.725 18.325 30.349999999999998 36.6 4 20.150000000000002 27.1 24.099999999999998 28.65 5 22.825 31.2 27.200000000000003 18.775 6 17.7 34.075 26.85 21.375 7 13.950000000000001 26.625 42.0 17.424999999999997 8 13.225000000000001 23.849999999999998 38.975 23.95 9 14.95 23.35 37.025000000000006 24.675 10-14 18.565 29.38 28.144999999999996 23.91 15-19 18.404999999999998 28.685 28.439999999999998 24.47 20-24 18.78 28.59 28.365000000000002 24.265 25-29 18.705 29.78 27.860000000000003 23.655 30-34 18.42 28.67 28.4 24.51 35-39 18.84 28.665000000000003 28.18 24.315 40-44 18.725 28.660000000000004 28.744999999999997 23.87 45-49 19.11 28.675 28.1 24.115000000000002 50-54 18.925 28.725 29.025000000000002 23.325000000000003 55-59 19.21 29.275000000000002 27.925 23.59 60-64 18.84 28.595 28.48 24.085 65-69 18.855 28.895 28.09 24.16 70-74 18.77 28.860000000000003 28.17 24.2 75-79 19.145 28.89 27.625 24.34 80-84 18.905 28.355000000000004 28.405 24.335 85-89 19.115 28.585 28.395 23.905 90-94 19.455 28.244999999999997 27.93 24.37 95-99 18.77 28.025 28.945 24.26 100-104 19.2 28.87 28.194999999999997 23.735 105-109 18.94473618404601 28.727181795448864 28.237059264816207 24.091022755688922 110-114 20.03 28.02 28.449999999999996 23.5 115-119 19.040000000000003 28.189999999999998 28.549999999999997 24.22 120-124 19.585 28.24 27.944999999999997 24.23 125-129 19.52 27.92 28.595 23.965 130-134 19.400000000000002 28.555000000000003 28.754999999999995 23.29 135-139 19.725 28.57 27.77 23.935000000000002 140-144 19.234808702175542 28.457114278569644 28.49212303075769 23.815953988497125 145-149 19.744999999999997 28.92 28.12 23.215 150 19.525000000000002 28.15 27.725 24.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 3.0 24 2.0 25 4.5 26 8.0 27 9.5 28 10.5 29 18.0 30 26.5 31 30.0 32 42.5 33 51.5 34 62.0 35 81.5 36 105.0 37 126.5 38 155.0 39 197.0 40 217.5 41 236.5 42 265.0 43 269.0 44 279.0 45 279.0 46 267.5 47 248.5 48 201.5 49 167.0 50 141.5 51 119.5 52 92.5 53 68.5 54 57.0 55 43.5 56 29.5 57 22.0 58 19.5 59 12.0 60 8.0 61 6.5 62 2.5 63 1.5 64 3.0 65 2.0 66 1.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 95.13925380977403 90.525 2 4.624277456647398 8.799999999999999 3 0.2364687335785602 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.025 0.0 0.0 0.025 0.0 130-131 0.05 0.0 0.0 0.025 0.0 132-133 0.0625 0.0 0.0 0.025 0.0 134-135 0.1 0.0 0.0 0.025 0.0 136-137 0.1 0.0 0.0 0.025 0.0 138 0.1 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 30 0.0015031899 23.999998 140-144 >>END_MODULE SRR14639576 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639576_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.72875 32.0 32.0 32.0 32.0 32.0 2 30.8075 32.0 32.0 32.0 32.0 32.0 3 34.4625 37.0 32.0 37.0 32.0 37.0 4 35.18 37.0 37.0 37.0 32.0 37.0 5 35.42125 37.0 37.0 37.0 32.0 37.0 6 38.57275 41.0 41.0 41.0 32.0 41.0 7 38.4795 41.0 41.0 41.0 32.0 41.0 8 38.58 41.0 41.0 41.0 32.0 41.0 9 38.7155 41.0 41.0 41.0 32.0 41.0 10-14 38.85015 41.0 41.0 41.0 36.0 41.0 15-19 38.644850000000005 41.0 41.0 41.0 33.0 41.0 20-24 38.50265 41.0 41.0 41.0 32.0 41.0 25-29 38.07015 41.0 39.4 41.0 30.0 41.0 30-34 38.0393 41.0 38.6 41.0 30.0 41.0 35-39 38.0624 41.0 38.6 41.0 30.0 41.0 40-44 37.74535 41.0 37.0 41.0 27.0 41.0 45-49 37.71245 41.0 37.0 41.0 27.0 41.0 50-54 37.466699999999996 41.0 37.0 41.0 27.0 41.0 55-59 37.4593 41.0 37.0 41.0 27.0 41.0 60-64 37.3331 41.0 37.0 41.0 27.0 41.0 65-69 37.093900000000005 41.0 37.0 41.0 26.0 41.0 70-74 36.97805 41.0 37.0 41.0 26.0 41.0 75-79 36.02205 40.2 35.0 41.0 23.0 41.0 80-84 37.030950000000004 41.0 37.0 41.0 25.0 41.0 85-89 37.140950000000004 41.0 37.0 41.0 26.0 41.0 90-94 36.71035 41.0 37.0 41.0 23.0 41.0 95-99 36.84415 41.0 37.0 41.0 22.0 41.0 100-104 36.54135000000001 41.0 37.0 41.0 22.0 41.0 105-109 36.45935 41.0 37.0 41.0 22.0 41.0 110-114 36.439350000000005 41.0 37.0 41.0 22.0 41.0 115-119 36.09335 41.0 36.0 41.0 20.0 41.0 120-124 36.094100000000005 41.0 37.0 41.0 22.0 41.0 125-129 35.640299999999996 41.0 34.0 41.0 20.0 41.0 130-134 35.6934 41.0 36.0 41.0 22.0 41.0 135-139 35.146 41.0 34.0 41.0 18.0 41.0 140-144 34.90325 41.0 32.0 41.0 18.0 41.0 145-149 34.631150000000005 40.2 31.0 41.0 14.0 41.0 150 34.19025 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 7.0 17 15.0 18 16.0 19 17.0 20 24.0 21 16.0 22 33.0 23 42.0 24 38.0 25 43.0 26 53.0 27 49.0 28 59.0 29 62.0 30 61.0 31 98.0 32 91.0 33 114.0 34 130.0 35 154.0 36 205.0 37 249.0 38 350.0 39 559.0 40 1511.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.47553324968632 25.77164366373902 8.030112923462985 32.72271016311167 2 18.575 28.599999999999998 38.975 13.850000000000001 3 16.5 27.725 35.0 20.775 4 20.674999999999997 34.675 26.025 18.625 5 23.549999999999997 37.375 22.3 16.775000000000002 6 17.05 38.25 25.825 18.875 7 19.325 21.9 38.5 20.275000000000002 8 16.7 25.724999999999998 32.975 24.6 9 19.325 25.25 31.275 24.15 10-14 22.31 29.134999999999998 27.305 21.25 15-19 21.735 28.595 28.38 21.29 20-24 22.235 28.96 27.93 20.875 25-29 22.88 27.92 28.055000000000003 21.145 30-34 21.834999999999997 28.335 28.78 21.05 35-39 21.795 28.03 28.84 21.335 40-44 21.645 28.525 28.634999999999998 21.195 45-49 22.365 27.735 28.965000000000003 20.935000000000002 50-54 22.105 28.34 28.26 21.295 55-59 22.195 27.975 28.89 20.94 60-64 21.815 28.48 28.845 20.86 65-69 22.225 28.825 28.27 20.68 70-74 22.615 28.22 28.305000000000003 20.86 75-79 22.825 28.54 28.235 20.4 80-84 22.865 28.194999999999997 28.155 20.785 85-89 22.41 28.565 28.084999999999997 20.94 90-94 22.645 28.005000000000003 28.17 21.18 95-99 22.965 28.634999999999998 27.77 20.630000000000003 100-104 22.935 28.854999999999997 27.46 20.75 105-109 22.46 28.13 28.794999999999998 20.615 110-114 22.91 28.785 27.74 20.565 115-119 22.88114405720286 28.22641132056603 28.196409820491024 20.696034801740087 120-124 23.44 28.110000000000003 28.07 20.380000000000003 125-129 22.905 28.075 28.24 20.78 130-134 22.525000000000002 28.595 28.125 20.755000000000003 135-139 23.115 27.93 28.155 20.8 140-144 23.13 27.794999999999998 28.499999999999996 20.575 145-149 23.200000000000003 28.21 28.025 20.565 150 24.625 26.825 27.625 20.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 2.0 22 3.5 23 3.0 24 3.5 25 5.5 26 10.5 27 11.0 28 9.0 29 16.5 30 21.5 31 27.5 32 41.0 33 50.5 34 65.5 35 90.0 36 98.0 37 122.0 38 161.5 39 191.0 40 219.0 41 240.5 42 272.0 43 281.5 44 268.5 45 269.5 46 261.5 47 235.5 48 214.5 49 171.0 50 135.0 51 120.5 52 88.5 53 69.0 54 56.0 55 40.0 56 27.5 57 21.0 58 18.0 59 13.5 60 9.5 61 7.5 62 8.5 63 4.5 64 1.5 65 3.0 66 2.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.93432369038311 92.025 2 3.883242116236643 7.449999999999999 3 0.18243419338024497 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1125 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.16249999999999998 0.0 0.0 0.0 0.0 134-135 0.2 0.0 0.0 0.0 0.0 136-137 0.2 0.0 0.0 0.0 0.0 138 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGAG 10 0.006973645 144.0 1 CAAAACT 10 0.006973645 144.0 1 >>END_MODULE Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320749 spots for SRR14639576.sra Written 1320749 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra Read 1320740 spots for SRR14639576.sra Written 1320740 spots for SRR14639576.sra SRR ids: ['SRR14639576.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ozb_i5_a SRR14639576.sra spots: 26414809 blocks: [[1, 1320740], [1320741, 2641480], [2641481, 3962220], [3962221, 5282960], [5282961, 6603700], [6603701, 7924440], [7924441, 9245180], [9245181, 10565920], [10565921, 11886660], [11886661, 13207400], [13207401, 14528140], [14528141, 15848880], [15848881, 17169620], [17169621, 18490360], [18490361, 19811100], [19811101, 21131840], [21131841, 22452580], [22452581, 23773320], [23773321, 25094060], [25094061, 26414809]] SRR14639576 file size 9779505 SRR14639576 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639576 SRR14639576_1.fastq SRR14639576_2.fastq Input file: SRR14639576_1.fastq Paired file: SRR14639576_2.fastq trimmed: SRR14639576-trimmed-pair1.fastq, SRR14639576-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:15:15 2025 >> started Fri Feb 14 09:15:51 2025 >> done (36.052s) 26414809 read pairs processed; of these: 173 ( 0.00%) short read pairs filtered out after trimming by size control 30 ( 0.00%) empty read pairs filtered out after trimming by size control 26414606 (100.00%) read pairs available; of these: 508223 ( 1.92%) trimmed read pairs available after processing 25906383 (98.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 29 0.00% 20 35 0.00% 21 30 0.00% 22 38 0.00% 23 56 0.00% 24 47 0.00% 25 53 0.00% 26 43 0.00% 27 63 0.00% 28 62 0.00% 29 50 0.00% 30 53 0.00% 31 72 0.00% 32 68 0.00% 33 76 0.00% 34 80 0.00% 35 71 0.00% 36 77 0.00% 37 81 0.00% 38 131 0.00% 39 95 0.00% 40 87 0.00% 41 96 0.00% 42 115 0.00% 43 119 0.00% 44 112 0.00% 45 122 0.00% 46 128 0.00% 47 129 0.00% 48 129 0.00% 49 105 0.00% 50 112 0.00% 51 122 0.00% 52 123 0.00% 53 129 0.00% 54 126 0.00% 55 169 0.00% 56 139 0.00% 57 165 0.00% 58 155 0.00% 59 161 0.00% 60 187 0.00% 61 160 0.00% 62 174 0.00% 63 179 0.00% 64 183 0.00% 65 200 0.00% 66 214 0.00% 67 221 0.00% 68 195 0.00% 69 221 0.00% 70 209 0.00% 71 225 0.00% 72 255 0.00% 73 223 0.00% 74 240 0.00% 75 258 0.00% 76 262 0.00% 77 278 0.00% 78 293 0.00% 79 331 0.00% 80 321 0.00% 81 303 0.00% 82 335 0.00% 83 344 0.00% 84 390 0.00% 85 389 0.00% 86 430 0.00% 87 400 0.00% 88 469 0.00% 89 521 0.00% 90 459 0.00% 91 536 0.00% 92 522 0.00% 93 552 0.00% 94 632 0.00% 95 666 0.00% 96 696 0.00% 97 668 0.00% 98 772 0.00% 99 783 0.00% 100 830 0.00% 101 889 0.00% 102 889 0.00% 103 915 0.00% 104 936 0.00% 105 1094 0.00% 106 1111 0.00% 107 1123 0.00% 108 1196 0.00% 109 1231 0.00% 110 1304 0.00% 111 1383 0.01% 112 1451 0.01% 113 1470 0.01% 114 1567 0.01% 115 1659 0.01% 116 1765 0.01% 117 1805 0.01% 118 1967 0.01% 119 2007 0.01% 120 2059 0.01% 121 2090 0.01% 122 2230 0.01% 123 2344 0.01% 124 2458 0.01% 125 2535 0.01% 126 2754 0.01% 127 2770 0.01% 128 2895 0.01% 129 3093 0.01% 130 3212 0.01% 131 3341 0.01% 132 3479 0.01% 133 3562 0.01% 134 3648 0.01% 135 3867 0.01% 136 3897 0.01% 137 4258 0.02% 138 4413 0.02% 139 4484 0.02% 140 4731 0.02% 141 4852 0.02% 142 5025 0.02% 143 5204 0.02% 144 5412 0.02% 145 5736 0.02% 146 6315 0.02% 147 8992 0.03% 148 24905 0.09% 149 328504 1.24% 150 25906383 98.08% 26414606 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=33 prefix-density=0.37 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=158.64 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=27.2 sequence=TCATCTTCTTCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=32 prefix-density=0.50 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=89.79 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=20.1 sequence=AAGAAAAGAAAA SRR14639576 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:16:47 Started mapping on | Feb 14 09:16:48 Finished on | Feb 14 09:20:08 Mapping speed, Million of reads per hour | 475.46 Number of input reads | 26414606 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 24140591 Uniquely mapped reads % | 91.39% Average mapped length | 297.13 Number of splices: Total | 23497742 Number of splices: Annotated (sjdb) | 22885147 Number of splices: GT/AG | 23061098 Number of splices: GC/AG | 338325 Number of splices: AT/AC | 18355 Number of splices: Non-canonical | 79964 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 733820 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 17987 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.70% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1540195 1540195 1540195 N_multimapping 733820 733820 733820 N_noFeature 844126 23862371 913245 N_ambiguous 427462 1419 217915 UnstrandedReadsAssigned:22869003 PositiveStrandReadsAssigned:276801 NegativeStrandReadsAssigned:23009431 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639576 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639576-trimmed-pair1.fastq SRR14639576-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,414,606 reads, 23,366,186 reads pseudoaligned [quant] estimated average fragment length: 362.75 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR14639576.ke.tsv 34699 SRR14639576.se.tsv 87100 total ==> SRR14639576.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1656.25 5645 130.754 Potri.005G024800.1.v4.1 1035 673.25 1589 90.545 Potri.004G059700.1.v4.1 961 599.498 100 6.39926 Potri.007G009000.2.v4.1 1416 1054.25 0 0 Potri.003G141000.2.v4.1 2943 2581.25 2192.88 32.5913 Potri.016G087400.1.v4.1 270 46.4508 2056.83 1698.73 Potri.015G069301.1.v4.1 564 228.8 0 0 Potri.010G195200.1.v4.1 1773 1411.25 1352.96 36.7787 Potri.012G127500.1.v4.1 977 615.4 44 2.74291 ==> SRR14639576.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 188 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 983 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR14639576 completed mapping pipeline successfully