Starting /dee2/code/volunteer_pipeline.sh SRR14639577 current disk space = 3116829196288 free memory = 1448853200 SRR14639577 SRAfilesize 592f16e43b70d2733d7c0f5993a859f0 SRR14639577.sra SRR14639577.sra file validated SRR14639577 is paired end SRR14639577 is conventional basespace SRR14639577 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639577_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63375 32.0 32.0 32.0 32.0 32.0 2 31.61 32.0 32.0 32.0 32.0 32.0 3 35.175 37.0 32.0 37.0 32.0 37.0 4 36.08875 37.0 37.0 37.0 32.0 37.0 5 36.3025 37.0 37.0 37.0 37.0 37.0 6 39.80625 41.0 41.0 41.0 37.0 41.0 7 39.9015 41.0 41.0 41.0 37.0 41.0 8 40.077 41.0 41.0 41.0 37.0 41.0 9 40.15 41.0 41.0 41.0 37.0 41.0 10-14 40.20915 41.0 41.0 41.0 38.6 41.0 15-19 40.220600000000005 41.0 41.0 41.0 37.8 41.0 20-24 40.204899999999995 41.0 41.0 41.0 38.6 41.0 25-29 40.200250000000004 41.0 41.0 41.0 37.8 41.0 30-34 40.19425 41.0 41.0 41.0 41.0 41.0 35-39 40.12165 41.0 41.0 41.0 37.8 41.0 40-44 40.040049999999994 41.0 41.0 41.0 37.0 41.0 45-49 40.008449999999996 41.0 41.0 41.0 37.0 41.0 50-54 39.9757 41.0 41.0 41.0 37.0 41.0 55-59 39.88325 41.0 41.0 41.0 37.0 41.0 60-64 39.86130000000001 41.0 41.0 41.0 37.0 41.0 65-69 39.748949999999994 41.0 41.0 41.0 37.0 41.0 70-74 39.578700000000005 41.0 41.0 41.0 37.0 41.0 75-79 39.14185 41.0 40.2 41.0 36.0 41.0 80-84 39.60705 41.0 41.0 41.0 37.0 41.0 85-89 39.581450000000004 41.0 41.0 41.0 37.0 41.0 90-94 39.53745 41.0 41.0 41.0 37.0 41.0 95-99 39.46405 41.0 41.0 41.0 37.0 41.0 100-104 39.3315 41.0 41.0 41.0 37.0 41.0 105-109 39.2693 41.0 41.0 41.0 37.0 41.0 110-114 39.22795 41.0 41.0 41.0 37.0 41.0 115-119 39.169650000000004 41.0 41.0 41.0 37.0 41.0 120-124 39.166250000000005 41.0 41.0 41.0 37.0 41.0 125-129 39.17569999999999 41.0 41.0 41.0 37.0 41.0 130-134 38.8947 41.0 41.0 41.0 33.0 41.0 135-139 38.608050000000006 41.0 41.0 41.0 32.0 41.0 140-144 38.42725 41.0 39.4 41.0 32.0 41.0 145-149 38.120999999999995 41.0 37.0 41.0 32.0 41.0 150 38.036 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 2.0 25 2.0 26 9.0 27 8.0 28 14.0 29 20.0 30 30.0 31 26.0 32 48.0 33 53.0 34 77.0 35 86.0 36 111.0 37 160.0 38 230.0 39 511.0 40 2609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.156789197299325 12.178044511127782 6.951737934483621 53.71342835708928 2 13.25 14.099999999999998 46.6 26.05 3 13.775 17.375 31.0 37.85 4 20.0 25.525 25.124999999999996 29.349999999999998 5 21.275 33.5 25.974999999999998 19.25 6 16.875 33.85 27.725 21.55 7 14.124999999999998 27.625 41.425 16.825000000000003 8 13.425 24.2 37.5 24.875 9 15.0 25.374999999999996 37.175000000000004 22.45 10-14 18.56 28.910000000000004 29.005 23.525 15-19 18.465 28.355000000000004 29.13 24.05 20-24 19.18 28.51 28.444999999999997 23.865 25-29 18.325 28.810000000000002 29.439999999999998 23.425 30-34 18.740000000000002 28.82 28.435 24.005000000000003 35-39 18.3 28.84 28.634999999999998 24.224999999999998 40-44 18.26 29.244999999999997 28.389999999999997 24.104999999999997 45-49 18.67 28.665000000000003 28.83 23.835 50-54 19.265 28.725 27.925 24.085 55-59 18.72 28.425 28.444999999999997 24.41 60-64 19.095000000000002 28.410000000000004 28.4 24.095 65-69 18.89 29.21 27.860000000000003 24.04 70-74 18.595 29.2 28.24 23.965 75-79 19.775000000000002 29.015 28.03 23.18 80-84 19.415 28.749999999999996 27.750000000000004 24.085 85-89 18.795 29.385 28.494999999999997 23.325000000000003 90-94 19.31 28.93 28.1 23.66 95-99 19.455 28.199999999999996 27.889999999999997 24.455 100-104 19.41 28.74 28.000000000000004 23.849999999999998 105-109 18.78687868786879 28.982898289828984 28.217821782178216 24.012401240124014 110-114 19.625 28.294999999999998 28.53 23.549999999999997 115-119 19.125 28.705000000000002 28.535 23.635 120-124 19.72 27.884999999999998 28.355000000000004 24.04 125-129 19.12 28.01 29.099999999999998 23.77 130-134 19.155 28.01 28.994999999999997 23.84 135-139 19.475 28.199999999999996 28.754999999999995 23.57 140-144 19.69590877263179 27.888366509952984 28.678603581074324 23.737121136340903 145-149 20.145 28.205000000000002 28.12 23.53 150 19.650000000000002 28.175 28.050000000000004 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.5 8 1.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 3.0 19 1.5 20 0.5 21 2.0 22 2.5 23 1.0 24 3.0 25 7.0 26 7.5 27 8.0 28 10.0 29 19.5 30 27.5 31 28.5 32 38.0 33 49.5 34 61.5 35 80.0 36 110.5 37 139.0 38 163.5 39 200.0 40 223.0 41 234.5 42 260.0 43 285.0 44 276.5 45 257.5 46 253.5 47 246.0 48 219.5 49 174.0 50 139.0 51 113.0 52 84.0 53 63.5 54 43.0 55 35.5 56 37.5 57 28.5 58 15.0 59 10.0 60 12.0 61 8.0 62 3.5 63 2.5 64 2.0 65 2.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.03 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.69236862952205 89.64999999999999 2 5.122788486928967 9.700000000000001 3 0.1320306311064167 0.375 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026406126221283337 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.1875 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.2375 0.0 0.0 0.0 0.0 128-129 0.25 0.0 0.0 0.0 0.0 130-131 0.2625 0.0 0.0 0.0 0.0 132-133 0.275 0.0 0.0 0.0 0.0 134-135 0.2875 0.0 0.0 0.0 0.0 136-137 0.3375 0.0 0.0 0.0 0.0 138 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639577 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639577_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.66125 32.0 32.0 32.0 32.0 32.0 2 30.94875 32.0 32.0 32.0 32.0 32.0 3 34.21375 37.0 32.0 37.0 32.0 37.0 4 35.14125 37.0 37.0 37.0 32.0 37.0 5 35.345 37.0 37.0 37.0 32.0 37.0 6 38.6695 41.0 41.0 41.0 32.0 41.0 7 38.4015 41.0 41.0 41.0 32.0 41.0 8 38.59325 41.0 41.0 41.0 32.0 41.0 9 38.585 41.0 41.0 41.0 32.0 41.0 10-14 38.7169 41.0 41.0 41.0 33.0 41.0 15-19 38.415350000000004 41.0 41.0 41.0 32.0 41.0 20-24 38.220349999999996 41.0 41.0 41.0 31.0 41.0 25-29 37.9613 41.0 39.4 41.0 29.0 41.0 30-34 37.8075 41.0 37.0 41.0 27.0 41.0 35-39 37.7615 41.0 37.0 41.0 27.0 41.0 40-44 37.5118 41.0 37.0 41.0 27.0 41.0 45-49 37.542449999999995 41.0 37.0 41.0 27.0 41.0 50-54 37.3779 41.0 37.0 41.0 27.0 41.0 55-59 37.23030000000001 41.0 37.0 41.0 27.0 41.0 60-64 37.31845 41.0 37.0 41.0 27.0 41.0 65-69 36.88675 41.0 37.0 41.0 26.0 41.0 70-74 36.77575 41.0 37.0 41.0 24.0 41.0 75-79 35.8098 40.2 35.0 41.0 22.0 41.0 80-84 36.878 41.0 37.0 41.0 23.0 41.0 85-89 36.849199999999996 41.0 37.0 41.0 22.0 41.0 90-94 36.4433 41.0 37.0 41.0 22.0 41.0 95-99 36.566649999999996 41.0 37.0 41.0 22.0 41.0 100-104 36.38405 41.0 37.0 41.0 22.0 41.0 105-109 36.206500000000005 41.0 37.0 41.0 22.0 41.0 110-114 36.17425 41.0 37.0 41.0 22.0 41.0 115-119 35.82275 41.0 36.0 41.0 20.0 41.0 120-124 35.9448 41.0 37.0 41.0 22.0 41.0 125-129 35.372299999999996 41.0 34.0 41.0 18.0 41.0 130-134 35.41395 41.0 33.0 41.0 22.0 41.0 135-139 34.9175 41.0 32.0 41.0 18.0 41.0 140-144 34.6954 41.0 32.0 41.0 18.0 41.0 145-149 34.454 40.2 32.0 41.0 12.0 41.0 150 33.9995 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 2.0 16 4.0 17 10.0 18 11.0 19 26.0 20 27.0 21 32.0 22 31.0 23 33.0 24 53.0 25 37.0 26 63.0 27 50.0 28 63.0 29 82.0 30 79.0 31 93.0 32 102.0 33 119.0 34 124.0 35 153.0 36 178.0 37 244.0 38 373.0 39 555.0 40 1453.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.213872832369944 26.46393566222669 7.715506408645388 34.60668509675798 2 19.125 27.075 40.25 13.55 3 15.2 27.175 34.949999999999996 22.675 4 20.025000000000002 32.9 26.125 20.95 5 22.3 37.625 24.025 16.05 6 18.7 37.375 25.15 18.775 7 17.75 22.475 39.7 20.075000000000003 8 16.150000000000002 25.35 33.45 25.05 9 18.099999999999998 25.15 33.2 23.549999999999997 10-14 21.315 29.275000000000002 27.935 21.475 15-19 21.255 28.16 29.235 21.349999999999998 20-24 22.02 29.375 27.92 20.685000000000002 25-29 21.66 28.505000000000003 28.82 21.015 30-34 21.154999999999998 28.349999999999998 29.195 21.3 35-39 21.790000000000003 28.575 28.625 21.01 40-44 21.77 28.74 28.23 21.26 45-49 21.52 28.194999999999997 29.23 21.055 50-54 22.195 28.64 28.110000000000003 21.055 55-59 21.905 28.494999999999997 28.27 21.33 60-64 22.27 27.875 28.505000000000003 21.349999999999998 65-69 22.395 28.689999999999998 28.494999999999997 20.419999999999998 70-74 22.575 28.044999999999998 28.515 20.865000000000002 75-79 22.765 28.794999999999998 27.605 20.835 80-84 22.39 28.505000000000003 28.015 21.09 85-89 22.439999999999998 28.915000000000003 27.925 20.72 90-94 22.939999999999998 27.889999999999997 27.735 21.435000000000002 95-99 22.855 28.53 27.634999999999998 20.979999999999997 100-104 23.13 27.639999999999997 28.63 20.599999999999998 105-109 23.815 28.48 27.355 20.349999999999998 110-114 23.25 28.1 28.265 20.385 115-119 22.636131806590328 28.666433321666084 28.466423321166058 20.23101155057753 120-124 22.84 28.389999999999997 27.91 20.86 125-129 22.5 28.599999999999998 28.09 20.810000000000002 130-134 23.165 28.26 27.584999999999997 20.990000000000002 135-139 23.47 28.115000000000002 27.365000000000002 21.05 140-144 22.975 29.325000000000003 27.205000000000002 20.495 145-149 22.85 28.375 27.889999999999997 20.885 150 24.175 28.249999999999996 28.050000000000004 19.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.0 20 1.5 21 2.5 22 5.0 23 6.5 24 6.0 25 8.5 26 13.5 27 13.5 28 14.0 29 22.5 30 27.5 31 32.0 32 38.0 33 43.0 34 58.0 35 81.0 36 106.0 37 131.0 38 152.0 39 202.0 40 241.0 41 244.5 42 257.5 43 271.0 44 264.0 45 251.0 46 238.0 47 218.5 48 209.0 49 185.5 50 149.5 51 119.0 52 86.0 53 67.5 54 52.0 55 36.5 56 35.5 57 28.5 58 23.0 59 15.5 60 5.0 61 6.0 62 6.5 63 4.0 64 3.5 65 2.0 66 1.5 67 2.5 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7124183006536 91.525 2 4.026143790849673 7.7 3 0.2352941176470588 0.675 4 0.026143790849673207 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2375 0.0 0.0 0.0 0.0 124-125 0.25 0.0 0.0 0.0 0.0 126-127 0.2875 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.3125 0.0 0.0 0.0 0.0 132-133 0.325 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 0.3875 0.0 0.0 0.0 0.0 138 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306615 spots for SRR14639577.sra Written 1306615 spots for SRR14639577.sra Read 1306616 spots for SRR14639577.sra Written 1306616 spots for SRR14639577.sra SRR ids: ['SRR14639577.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fiya2e_k SRR14639577.sra spots: 26132301 blocks: [[1, 1306615], [1306616, 2613230], [2613231, 3919845], [3919846, 5226460], [5226461, 6533075], [6533076, 7839690], [7839691, 9146305], [9146306, 10452920], [10452921, 11759535], [11759536, 13066150], [13066151, 14372765], [14372766, 15679380], [15679381, 16985995], [16985996, 18292610], [18292611, 19599225], [19599226, 20905840], [20905841, 22212455], [22212456, 23519070], [23519071, 24825685], [24825686, 26132301]] SRR14639577 file size 9674787 SRR14639577 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639577 SRR14639577_1.fastq SRR14639577_2.fastq Input file: SRR14639577_1.fastq Paired file: SRR14639577_2.fastq trimmed: SRR14639577-trimmed-pair1.fastq, SRR14639577-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:26:34 2025 >> started Fri Feb 14 09:27:03 2025 >> done (28.391s) 26132301 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 74 ( 0.00%) empty read pairs filtered out after trimming by size control 26132100 (100.00%) read pairs available; of these: 565760 ( 2.17%) trimmed read pairs available after processing 25566340 (97.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 22 0.00% 20 26 0.00% 21 28 0.00% 22 24 0.00% 23 25 0.00% 24 34 0.00% 25 30 0.00% 26 28 0.00% 27 42 0.00% 28 38 0.00% 29 51 0.00% 30 52 0.00% 31 52 0.00% 32 59 0.00% 33 58 0.00% 34 62 0.00% 35 56 0.00% 36 73 0.00% 37 64 0.00% 38 79 0.00% 39 77 0.00% 40 71 0.00% 41 61 0.00% 42 65 0.00% 43 94 0.00% 44 91 0.00% 45 92 0.00% 46 95 0.00% 47 92 0.00% 48 126 0.00% 49 105 0.00% 50 116 0.00% 51 118 0.00% 52 102 0.00% 53 129 0.00% 54 118 0.00% 55 142 0.00% 56 122 0.00% 57 136 0.00% 58 156 0.00% 59 184 0.00% 60 156 0.00% 61 173 0.00% 62 190 0.00% 63 197 0.00% 64 194 0.00% 65 219 0.00% 66 220 0.00% 67 240 0.00% 68 232 0.00% 69 274 0.00% 70 292 0.00% 71 289 0.00% 72 294 0.00% 73 304 0.00% 74 307 0.00% 75 356 0.00% 76 407 0.00% 77 395 0.00% 78 397 0.00% 79 450 0.00% 80 482 0.00% 81 468 0.00% 82 524 0.00% 83 561 0.00% 84 592 0.00% 85 594 0.00% 86 664 0.00% 87 649 0.00% 88 717 0.00% 89 746 0.00% 90 743 0.00% 91 856 0.00% 92 937 0.00% 93 899 0.00% 94 964 0.00% 95 989 0.00% 96 1071 0.00% 97 1157 0.00% 98 1189 0.00% 99 1224 0.00% 100 1342 0.01% 101 1434 0.01% 102 1428 0.01% 103 1516 0.01% 104 1576 0.01% 105 1716 0.01% 106 1792 0.01% 107 1888 0.01% 108 2074 0.01% 109 2078 0.01% 110 2067 0.01% 111 2209 0.01% 112 2303 0.01% 113 2387 0.01% 114 2520 0.01% 115 2752 0.01% 116 2814 0.01% 117 2920 0.01% 118 2967 0.01% 119 3068 0.01% 120 3207 0.01% 121 3220 0.01% 122 3442 0.01% 123 3614 0.01% 124 3738 0.01% 125 3925 0.02% 126 4160 0.02% 127 4132 0.02% 128 4302 0.02% 129 4535 0.02% 130 4536 0.02% 131 4775 0.02% 132 4963 0.02% 133 5265 0.02% 134 5282 0.02% 135 5352 0.02% 136 5602 0.02% 137 5748 0.02% 138 6034 0.02% 139 6224 0.02% 140 6304 0.02% 141 6531 0.02% 142 6712 0.03% 143 6779 0.03% 144 7146 0.03% 145 7486 0.03% 146 7995 0.03% 147 10508 0.04% 148 25231 0.10% 149 321328 1.23% 150 25566340 97.83% 26132100 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=32 prefix-density=0.36 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=157.10 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=26.4 sequence=TCATCTTCTTCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=33 prefix-density=0.48 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=113.06 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=19.1 sequence=CTCTCTCTTTCAAACCCTA SRR14639577 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:27:50 Started mapping on | Feb 14 09:27:51 Finished on | Feb 14 09:31:02 Mapping speed, Million of reads per hour | 492.54 Number of input reads | 26132100 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 24240388 Uniquely mapped reads % | 92.76% Average mapped length | 296.92 Number of splices: Total | 23830023 Number of splices: Annotated (sjdb) | 23206085 Number of splices: GT/AG | 23385493 Number of splices: GC/AG | 348902 Number of splices: AT/AC | 18223 Number of splices: Non-canonical | 77405 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.03% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 692661 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 18188 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.44% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1199051 1199051 1199051 N_multimapping 692661 692661 692661 N_noFeature 855347 23958923 929014 N_ambiguous 408633 1352 200483 UnstrandedReadsAssigned:22976408 PositiveStrandReadsAssigned:280113 NegativeStrandReadsAssigned:23110891 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639577 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639577-trimmed-pair1.fastq SRR14639577-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,132,100 reads, 23,378,271 reads pseudoaligned [quant] estimated average fragment length: 371.315 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR14639577.ke.tsv 34699 SRR14639577.se.tsv 87100 total ==> SRR14639577.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1647.69 4243 100.427 Potri.005G024800.1.v4.1 1035 664.685 1432 84.0192 Potri.004G059700.1.v4.1 961 591.208 57 3.75998 Potri.007G009000.2.v4.1 1416 1045.69 0 0 Potri.003G141000.2.v4.1 2943 2572.69 1934 29.3171 Potri.016G087400.1.v4.1 270 50.3295 2294 1777.55 Potri.015G069301.1.v4.1 564 225.793 0 0 Potri.010G195200.1.v4.1 1773 1402.69 1738.97 48.3485 Potri.012G127500.1.v4.1 977 606.95 80 5.1403 ==> SRR14639577.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 125 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 619 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR14639577 completed mapping pipeline successfully