Starting /dee2/code/volunteer_pipeline.sh SRR14639578 current disk space = 3116544757760 free memory = 1484599948 SRR14639578 SRAfilesize 2c1a23f644b04a10f8e15705aafde57f SRR14639578.sra SRR14639578.sra file validated SRR14639578 is paired end SRR14639578 is conventional basespace SRR14639578 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66375 32.0 32.0 32.0 32.0 32.0 2 31.5 32.0 32.0 32.0 32.0 32.0 3 35.2125 37.0 32.0 37.0 32.0 37.0 4 36.05125 37.0 37.0 37.0 32.0 37.0 5 36.225 37.0 37.0 37.0 37.0 37.0 6 39.79275 41.0 41.0 41.0 37.0 41.0 7 39.896 41.0 41.0 41.0 37.0 41.0 8 40.18825 41.0 41.0 41.0 37.0 41.0 9 40.2765 41.0 41.0 41.0 37.0 41.0 10-14 40.21925 41.0 41.0 41.0 39.4 41.0 15-19 40.25609999999999 41.0 41.0 41.0 40.2 41.0 20-24 40.242149999999995 41.0 41.0 41.0 40.2 41.0 25-29 40.23865 41.0 41.0 41.0 39.4 41.0 30-34 40.1853 41.0 41.0 41.0 40.2 41.0 35-39 40.0858 41.0 41.0 41.0 37.8 41.0 40-44 40.14005 41.0 41.0 41.0 37.0 41.0 45-49 40.0989 41.0 41.0 41.0 37.0 41.0 50-54 40.0284 41.0 41.0 41.0 37.0 41.0 55-59 39.94105 41.0 41.0 41.0 37.0 41.0 60-64 39.92530000000001 41.0 41.0 41.0 37.0 41.0 65-69 39.745400000000004 41.0 41.0 41.0 37.0 41.0 70-74 39.58705 41.0 41.0 41.0 37.0 41.0 75-79 39.210449999999994 41.0 40.2 41.0 36.0 41.0 80-84 39.650400000000005 41.0 41.0 41.0 37.0 41.0 85-89 39.62265 41.0 41.0 41.0 37.0 41.0 90-94 39.640499999999996 41.0 41.0 41.0 37.0 41.0 95-99 39.50435 41.0 41.0 41.0 37.0 41.0 100-104 39.381499999999996 41.0 41.0 41.0 37.0 41.0 105-109 39.36575 41.0 41.0 41.0 37.0 41.0 110-114 39.34105 41.0 41.0 41.0 37.0 41.0 115-119 39.2434 41.0 41.0 41.0 37.0 41.0 120-124 39.23950000000001 41.0 41.0 41.0 37.0 41.0 125-129 39.224149999999995 41.0 41.0 41.0 37.0 41.0 130-134 38.914699999999996 41.0 41.0 41.0 34.0 41.0 135-139 38.5972 41.0 41.0 41.0 32.0 41.0 140-144 38.43275 41.0 38.6 41.0 32.0 41.0 145-149 38.265049999999995 41.0 37.0 41.0 32.0 41.0 150 38.139 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 5.0 24 1.0 25 4.0 26 6.0 27 10.0 28 7.0 29 22.0 30 20.0 31 28.0 32 43.0 33 39.0 34 60.0 35 98.0 36 91.0 37 167.0 38 267.0 39 542.0 40 2588.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.675000000000004 13.775 12.725 36.825 2 15.375 12.6 39.65 32.375 3 15.475 19.5 30.075000000000003 34.949999999999996 4 21.025 26.3 25.8 26.875 5 21.224999999999998 33.625 25.525 19.625 6 16.475 32.75 30.15 20.625 7 14.499999999999998 29.525000000000002 38.7 17.275 8 13.900000000000002 25.124999999999996 36.9 24.075 9 14.875 26.625 34.475 24.025 10-14 18.605 28.610000000000003 29.310000000000002 23.474999999999998 15-19 18.95 28.575 28.82 23.655 20-24 19.17 28.96 28.165000000000003 23.705000000000002 25-29 18.884999999999998 28.410000000000004 28.555000000000003 24.15 30-34 19.24 29.09 27.855 23.815 35-39 17.974999999999998 28.825 28.955 24.245 40-44 19.03 28.775000000000002 28.389999999999997 23.805 45-49 18.915000000000003 29.044999999999998 27.68 24.36 50-54 18.965 28.825 28.155 24.055 55-59 18.915000000000003 29.145 27.675 24.265 60-64 19.53 28.43 27.91 24.13 65-69 19.470000000000002 29.044999999999998 28.194999999999997 23.29 70-74 19.3 28.955 28.165000000000003 23.580000000000002 75-79 19.21 28.634999999999998 28.09 24.065 80-84 19.55 28.525 28.125 23.799999999999997 85-89 19.645000000000003 28.48 28.175 23.7 90-94 19.470000000000002 28.694999999999997 28.42 23.415 95-99 19.43 28.73 27.83 24.01 100-104 19.855 29.03 27.495000000000005 23.62 105-109 19.75197519751975 29.122912291229124 27.667766776677666 23.457345734573458 110-114 19.900000000000002 27.694999999999997 28.810000000000002 23.595 115-119 19.255 28.585 28.465 23.695 120-124 19.37 27.939999999999998 28.315 24.375 125-129 19.189999999999998 28.23 28.925 23.655 130-134 19.39 28.194999999999997 28.685 23.73 135-139 19.02 28.1 28.42 24.46 140-144 19.80396079215843 27.725545109021805 28.855771154230847 23.614722944588916 145-149 20.135 27.76 28.18 23.925 150 19.25 27.750000000000004 28.825 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.5 25 2.5 26 3.5 27 5.5 28 9.5 29 11.5 30 17.5 31 29.5 32 39.0 33 58.0 34 66.5 35 71.5 36 110.0 37 136.5 38 156.5 39 195.0 40 221.5 41 243.0 42 266.5 43 286.5 44 276.5 45 269.5 46 261.0 47 226.5 48 207.5 49 192.5 50 153.0 51 111.0 52 92.5 53 71.5 54 55.0 55 45.0 56 27.0 57 15.5 58 16.0 59 13.5 60 8.5 61 6.0 62 3.0 63 2.0 64 1.0 65 2.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.34713375796179 88.875 2 5.17515923566879 9.75 3 0.45116772823779194 1.275 4 0.02653927813163482 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0125 0.025 0.0 0.0 0.0 112-113 0.025 0.025 0.0 0.0 0.0 114-115 0.025 0.025 0.0 0.0 0.0 116-117 0.025 0.025 0.0 0.0 0.0 118-119 0.025 0.025 0.0 0.0 0.0 120-121 0.025 0.025 0.0 0.0 0.0 122-123 0.025 0.025 0.0 0.0 0.0 124-125 0.025 0.025 0.0 0.0 0.0 126-127 0.025 0.025 0.0 0.0 0.0 128-129 0.025 0.025 0.0 0.0 0.0 130-131 0.025 0.025 0.0 0.0 0.0 132-133 0.025 0.025 0.0 0.0 0.0 134-135 0.05 0.025 0.0 0.0 0.0 136-137 0.0875 0.025 0.0 0.0 0.0 138 0.1 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639578 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639578_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7725 32.0 32.0 32.0 32.0 32.0 2 30.78375 32.0 32.0 32.0 32.0 32.0 3 33.93125 37.0 32.0 37.0 32.0 37.0 4 34.89625 37.0 37.0 37.0 32.0 37.0 5 35.10875 37.0 37.0 37.0 32.0 37.0 6 38.176 41.0 37.0 41.0 32.0 41.0 7 37.96 41.0 37.0 41.0 32.0 41.0 8 38.02925 41.0 41.0 41.0 27.0 41.0 9 38.0405 41.0 41.0 41.0 27.0 41.0 10-14 38.19385 41.0 41.0 41.0 31.0 41.0 15-19 37.9611 41.0 39.4 41.0 28.0 41.0 20-24 37.79109999999999 41.0 37.8 41.0 27.0 41.0 25-29 37.431400000000004 41.0 37.0 41.0 27.0 41.0 30-34 37.3211 41.0 37.0 41.0 27.0 41.0 35-39 37.1542 41.0 37.0 41.0 27.0 41.0 40-44 36.94845 41.0 37.0 41.0 26.0 41.0 45-49 36.80205 41.0 37.0 41.0 25.0 41.0 50-54 36.638 41.0 37.0 41.0 23.0 41.0 55-59 36.618399999999994 41.0 37.0 41.0 23.0 41.0 60-64 36.670049999999996 41.0 37.0 41.0 23.0 41.0 65-69 36.31105 41.0 37.0 41.0 22.0 41.0 70-74 36.1907 41.0 37.0 41.0 22.0 41.0 75-79 35.36535 40.2 34.0 41.0 22.0 41.0 80-84 36.27045 41.0 37.0 41.0 22.0 41.0 85-89 36.484950000000005 41.0 37.0 41.0 22.0 41.0 90-94 36.0048 41.0 37.0 41.0 22.0 41.0 95-99 36.11105 41.0 37.0 41.0 22.0 41.0 100-104 35.9056 41.0 35.0 41.0 20.0 41.0 105-109 35.78065 41.0 35.0 41.0 22.0 41.0 110-114 35.68815 41.0 34.0 41.0 22.0 41.0 115-119 35.48435 41.0 33.0 41.0 20.0 41.0 120-124 35.52735 41.0 32.0 41.0 22.0 41.0 125-129 35.0407 41.0 33.0 41.0 20.0 41.0 130-134 35.05515 41.0 32.0 41.0 20.0 41.0 135-139 34.58985 39.4 31.0 41.0 18.0 41.0 140-144 34.160849999999996 39.4 32.0 41.0 12.0 41.0 145-149 33.8695 37.8 31.0 41.0 12.0 41.0 150 33.3915 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 4.0 17 25.0 18 29.0 19 24.0 20 39.0 21 28.0 22 40.0 23 56.0 24 56.0 25 52.0 26 61.0 27 62.0 28 59.0 29 78.0 30 84.0 31 105.0 32 99.0 33 115.0 34 143.0 35 175.0 36 167.0 37 251.0 38 324.0 39 603.0 40 1318.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.63242295164119 28.36381859183162 11.500876973189676 23.50288148333751 2 19.825 27.875 36.225 16.075 3 16.575 28.1 35.5 19.825 4 21.05 34.175 24.925 19.85 5 21.8 38.15 23.474999999999998 16.575 6 19.125 36.625 24.7 19.55 7 18.85 25.624999999999996 34.9 20.625 8 16.35 26.200000000000003 32.9 24.55 9 19.525000000000002 24.925 31.65 23.9 10-14 22.314999999999998 28.744999999999997 27.565 21.375 15-19 21.575 28.725 28.439999999999998 21.26 20-24 21.84 28.51 28.575 21.075 25-29 22.285 28.189999999999998 27.76 21.765 30-34 22.115000000000002 28.22 28.27 21.395 35-39 21.785 27.955000000000002 28.83 21.43 40-44 21.805 28.955 27.73 21.51 45-49 22.645 27.98 28.155 21.22 50-54 22.11 28.384999999999998 27.845 21.66 55-59 22.175 28.415000000000003 28.305000000000003 21.105 60-64 22.615 27.944999999999997 28.48 20.96 65-69 23.195 27.825 27.555000000000003 21.425 70-74 22.845 28.315 28.09 20.75 75-79 22.55 28.17 28.24 21.04 80-84 22.095000000000002 28.415000000000003 27.779999999999998 21.709999999999997 85-89 22.98 28.53 27.295 21.195 90-94 22.97 28.315 27.905 20.810000000000002 95-99 22.96 28.24 27.450000000000003 21.349999999999998 100-104 23.03 28.24 27.584999999999997 21.145 105-109 23.25 28.194999999999997 27.900000000000002 20.655 110-114 22.155 28.73 28.294999999999998 20.82 115-119 23.244999999999997 28.32 27.79 20.645 120-124 23.465 27.875 27.97 20.69 125-129 22.869999999999997 28.165000000000003 27.76 21.205 130-134 23.200000000000003 28.27 27.655 20.875 135-139 22.86 28.444999999999997 27.525 21.17 140-144 22.935 28.155 27.98 20.93 145-149 23.585 28.175 27.37 20.87 150 23.45 28.575 27.625 20.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 2.0 18 2.0 19 1.5 20 1.0 21 0.5 22 2.5 23 2.5 24 1.0 25 1.5 26 4.0 27 7.0 28 10.5 29 15.0 30 24.5 31 28.5 32 36.5 33 49.5 34 68.5 35 90.0 36 107.5 37 121.5 38 130.0 39 161.0 40 208.5 41 249.0 42 268.5 43 273.5 44 269.0 45 262.5 46 258.0 47 232.5 48 205.0 49 192.0 50 156.0 51 114.0 52 92.0 53 74.0 54 63.5 55 51.0 56 42.0 57 35.5 58 22.5 59 17.5 60 14.5 61 7.5 62 4.0 63 5.5 64 3.5 65 1.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 95.35554972448176 90.85 2 4.355812122802414 8.3 3 0.26239832065074786 0.75 4 0.026239832065074783 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.037500000000000006 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.05 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.05 0.0 0.0 0.0 0.0 132-133 0.05 0.0 0.0 0.0 0.0 134-135 0.0875 0.0 0.0 0.0 0.0 136-137 0.1375 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 35 0.0036813593 20.571428 85-89 >>END_MODULE Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162027 spots for SRR14639578.sra Written 1162027 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra Read 1162016 spots for SRR14639578.sra Written 1162016 spots for SRR14639578.sra SRR ids: ['SRR14639578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zdfrkp8h SRR14639578.sra spots: 23240331 blocks: [[1, 1162016], [1162017, 2324032], [2324033, 3486048], [3486049, 4648064], [4648065, 5810080], [5810081, 6972096], [6972097, 8134112], [8134113, 9296128], [9296129, 10458144], [10458145, 11620160], [11620161, 12782176], [12782177, 13944192], [13944193, 15106208], [15106209, 16268224], [16268225, 17430240], [17430241, 18592256], [18592257, 19754272], [19754273, 20916288], [20916289, 22078304], [22078305, 23240331]] SRR14639578 file size 8602934 SRR14639578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639578 SRR14639578_1.fastq SRR14639578_2.fastq Input file: SRR14639578_1.fastq Paired file: SRR14639578_2.fastq trimmed: SRR14639578-trimmed-pair1.fastq, SRR14639578-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 09:42:05 2025 >> started Fri Feb 14 09:42:49 2025 >> done (44.109s) 23240331 read pairs processed; of these: 173 ( 0.00%) short read pairs filtered out after trimming by size control 110 ( 0.00%) empty read pairs filtered out after trimming by size control 23240048 (100.00%) read pairs available; of these: 462192 ( 1.99%) trimmed read pairs available after processing 22777856 (98.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 23 0.00% 20 26 0.00% 21 29 0.00% 22 25 0.00% 23 51 0.00% 24 39 0.00% 25 35 0.00% 26 48 0.00% 27 44 0.00% 28 42 0.00% 29 47 0.00% 30 42 0.00% 31 38 0.00% 32 55 0.00% 33 48 0.00% 34 60 0.00% 35 69 0.00% 36 72 0.00% 37 61 0.00% 38 85 0.00% 39 62 0.00% 40 41 0.00% 41 62 0.00% 42 59 0.00% 43 77 0.00% 44 71 0.00% 45 78 0.00% 46 77 0.00% 47 84 0.00% 48 90 0.00% 49 90 0.00% 50 70 0.00% 51 93 0.00% 52 88 0.00% 53 109 0.00% 54 87 0.00% 55 112 0.00% 56 102 0.00% 57 100 0.00% 58 115 0.00% 59 116 0.00% 60 108 0.00% 61 128 0.00% 62 126 0.00% 63 119 0.00% 64 127 0.00% 65 129 0.00% 66 138 0.00% 67 146 0.00% 68 166 0.00% 69 135 0.00% 70 160 0.00% 71 172 0.00% 72 162 0.00% 73 181 0.00% 74 180 0.00% 75 182 0.00% 76 166 0.00% 77 218 0.00% 78 202 0.00% 79 233 0.00% 80 217 0.00% 81 251 0.00% 82 241 0.00% 83 275 0.00% 84 261 0.00% 85 308 0.00% 86 314 0.00% 87 308 0.00% 88 302 0.00% 89 287 0.00% 90 347 0.00% 91 346 0.00% 92 368 0.00% 93 424 0.00% 94 395 0.00% 95 426 0.00% 96 438 0.00% 97 482 0.00% 98 501 0.00% 99 543 0.00% 100 488 0.00% 101 571 0.00% 102 604 0.00% 103 576 0.00% 104 683 0.00% 105 708 0.00% 106 729 0.00% 107 760 0.00% 108 726 0.00% 109 847 0.00% 110 879 0.00% 111 938 0.00% 112 892 0.00% 113 1017 0.00% 114 1041 0.00% 115 1093 0.00% 116 1116 0.00% 117 1284 0.01% 118 1264 0.01% 119 1370 0.01% 120 1338 0.01% 121 1410 0.01% 122 1510 0.01% 123 1561 0.01% 124 1740 0.01% 125 1801 0.01% 126 1889 0.01% 127 1927 0.01% 128 1898 0.01% 129 2128 0.01% 130 2177 0.01% 131 2269 0.01% 132 2284 0.01% 133 2320 0.01% 134 2425 0.01% 135 2568 0.01% 136 2696 0.01% 137 2721 0.01% 138 2851 0.01% 139 3024 0.01% 140 3078 0.01% 141 3212 0.01% 142 3369 0.01% 143 3511 0.02% 144 3656 0.02% 145 3916 0.02% 146 4541 0.02% 147 7164 0.03% 148 23552 0.10% 149 333117 1.43% 150 22777856 98.01% 23240048 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=36 prefix-density=0.63 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=158.22 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=25.7 sequence=TCATCTTCTTCT criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=39 prefix-density=0.86 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=268.63 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=26.9 sequence=AGAAGAAGAAGA SRR14639578 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 09:43:57 Started mapping on | Feb 14 09:43:57 Finished on | Feb 14 09:51:22 Mapping speed, Million of reads per hour | 188.01 Number of input reads | 23240048 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21448053 Uniquely mapped reads % | 92.29% Average mapped length | 297.05 Number of splices: Total | 22409258 Number of splices: Annotated (sjdb) | 21872325 Number of splices: GT/AG | 22006543 Number of splices: GC/AG | 321070 Number of splices: AT/AC | 17599 Number of splices: Non-canonical | 64046 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.03% Deletion average length | 3.21 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510814 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 21688 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.37% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1281181 1281181 1281181 N_multimapping 510814 510814 510814 N_noFeature 645696 21151676 695785 N_ambiguous 389238 1104 142599 UnstrandedReadsAssigned:20413119 PositiveStrandReadsAssigned:295273 NegativeStrandReadsAssigned:20609669 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639578 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639578-trimmed-pair1.fastq SRR14639578-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,240,048 reads, 20,948,164 reads pseudoaligned [quant] estimated average fragment length: 399.335 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR14639578.ke.tsv 34699 SRR14639578.se.tsv 87100 total ==> SRR14639578.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1619.66 1494 35.2731 Potri.005G024800.1.v4.1 1035 636.665 590 35.4372 Potri.004G059700.1.v4.1 961 563.485 55 3.73249 Potri.007G009000.2.v4.1 1416 1017.66 0 0 Potri.003G141000.2.v4.1 2943 2544.66 1923.01 28.8981 Potri.016G087400.1.v4.1 270 47.9057 2007.81 1602.71 Potri.015G069301.1.v4.1 564 210.543 0 0 Potri.010G195200.1.v4.1 1773 1374.66 291 8.09496 Potri.012G127500.1.v4.1 977 579.156 112 7.39505 ==> SRR14639578.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 132 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 92 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR14639578 completed mapping pipeline successfully