Starting /dee2/code/volunteer_pipeline.sh SRR14639579 current disk space = 3114845822976 free memory = 1576949948 SRR14639579 SRAfilesize 67b32d96df577444dbebe6651f3ec1a1 SRR14639579.sra SRR14639579.sra file validated SRR14639579 is paired end SRR14639579 is conventional basespace SRR14639579 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6025 32.0 32.0 32.0 32.0 32.0 2 31.54125 32.0 32.0 32.0 32.0 32.0 3 35.17625 37.0 32.0 37.0 32.0 37.0 4 36.10625 37.0 37.0 37.0 32.0 37.0 5 36.25375 37.0 37.0 37.0 37.0 37.0 6 39.68825 41.0 41.0 41.0 37.0 41.0 7 39.775 41.0 41.0 41.0 37.0 41.0 8 40.10025 41.0 41.0 41.0 37.0 41.0 9 40.19075 41.0 41.0 41.0 37.0 41.0 10-14 40.10485 41.0 41.0 41.0 37.0 41.0 15-19 40.1574 41.0 41.0 41.0 37.8 41.0 20-24 40.2085 41.0 41.0 41.0 38.6 41.0 25-29 40.16795 41.0 41.0 41.0 38.6 41.0 30-34 40.173199999999994 41.0 41.0 41.0 38.6 41.0 35-39 40.097 41.0 41.0 41.0 37.0 41.0 40-44 40.07045 41.0 41.0 41.0 37.0 41.0 45-49 40.00655 41.0 41.0 41.0 37.0 41.0 50-54 39.95565 41.0 41.0 41.0 37.0 41.0 55-59 39.83925 41.0 41.0 41.0 37.0 41.0 60-64 39.8221 41.0 41.0 41.0 37.0 41.0 65-69 39.7062 41.0 41.0 41.0 37.0 41.0 70-74 39.56965 41.0 41.0 41.0 37.0 41.0 75-79 39.12195 41.0 40.2 41.0 36.0 41.0 80-84 39.6461 41.0 41.0 41.0 37.0 41.0 85-89 39.5963 41.0 41.0 41.0 37.0 41.0 90-94 39.575149999999994 41.0 41.0 41.0 37.0 41.0 95-99 39.407999999999994 41.0 41.0 41.0 37.0 41.0 100-104 39.29984999999999 41.0 41.0 41.0 37.0 41.0 105-109 39.24145 41.0 41.0 41.0 37.0 41.0 110-114 39.225300000000004 41.0 41.0 41.0 37.0 41.0 115-119 39.184749999999994 41.0 41.0 41.0 37.0 41.0 120-124 39.18265 41.0 41.0 41.0 37.0 41.0 125-129 39.06185 41.0 41.0 41.0 37.0 41.0 130-134 38.8963 41.0 41.0 41.0 33.0 41.0 135-139 38.61445 41.0 40.2 41.0 32.0 41.0 140-144 38.35695 41.0 38.6 41.0 32.0 41.0 145-149 38.1793 41.0 37.0 41.0 32.0 41.0 150 38.00025 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 3.0 24 3.0 25 5.0 26 9.0 27 16.0 28 14.0 29 21.0 30 23.0 31 22.0 32 35.0 33 65.0 34 47.0 35 106.0 36 100.0 37 157.0 38 277.0 39 522.0 40 2572.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.5 14.299999999999999 13.625000000000002 36.575 2 15.299999999999999 13.025 41.525 30.15 3 15.125 20.3 29.825000000000003 34.75 4 20.150000000000002 26.325 26.224999999999998 27.3 5 20.474999999999998 33.725 25.775 20.025000000000002 6 16.625 32.65 30.175 20.549999999999997 7 14.374999999999998 27.275 38.824999999999996 19.525000000000002 8 13.65 24.875 37.675 23.799999999999997 9 13.925 25.674999999999997 36.925000000000004 23.474999999999998 10-14 18.55 28.58 29.125 23.745 15-19 18.75 27.96 28.725 24.565 20-24 18.6 28.610000000000003 28.689999999999998 24.099999999999998 25-29 18.834999999999997 28.925 28.244999999999997 23.995 30-34 18.8 28.849999999999998 28.175 24.175 35-39 18.435000000000002 28.83 28.305000000000003 24.43 40-44 18.84 28.89 28.465 23.805 45-49 18.6 28.585 28.48 24.335 50-54 19.045 29.065 28.18 23.71 55-59 19.43 28.955 27.73 23.885 60-64 19.27 28.71 27.71 24.310000000000002 65-69 19.439999999999998 28.875 28.315 23.369999999999997 70-74 19.16 29.5 27.85 23.49 75-79 19.305 28.705000000000002 28.084999999999997 23.905 80-84 19.225 28.084999999999997 28.410000000000004 24.279999999999998 85-89 18.515 28.605000000000004 28.835 24.044999999999998 90-94 19.435 28.53 27.665 24.37 95-99 19.225 28.505000000000003 28.08 24.19 100-104 19.575 28.375 27.765 24.285 105-109 19.665983299164957 27.69138456922846 28.851442572128605 23.791189559477974 110-114 19.73 28.305000000000003 27.500000000000004 24.465 115-119 19.515 28.03 28.139999999999997 24.315 120-124 19.545 28.02 28.065 24.37 125-129 19.42 28.43 27.825 24.325 130-134 19.830000000000002 28.655 27.775 23.74 135-139 19.735 27.765 28.285 24.215 140-144 18.876887688768875 28.59285928592859 28.082808280828083 24.44744474447445 145-149 20.21 28.07 27.805000000000003 23.915 150 19.25 29.625 27.450000000000003 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 2.5 23 3.0 24 2.5 25 3.5 26 6.0 27 6.0 28 9.5 29 17.0 30 18.5 31 25.5 32 36.0 33 44.0 34 62.5 35 81.5 36 97.5 37 124.5 38 158.5 39 194.5 40 233.5 41 260.0 42 267.0 43 276.0 44 282.5 45 268.0 46 246.5 47 248.5 48 236.5 49 193.5 50 148.5 51 107.0 52 77.5 53 64.0 54 51.5 55 36.5 56 26.5 57 20.0 58 17.5 59 12.5 60 8.5 61 6.0 62 2.5 63 0.5 64 1.5 65 2.0 66 1.0 67 1.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.93804376482996 90.025 2 4.771948325863433 9.049999999999999 3 0.23727919852359608 0.675 4 0.02636435539151068 0.1 5 0.0 0.0 6 0.02636435539151068 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATG 6 0.15 TruSeq Adapter, Index 7 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0125 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0125 0.0 0.0 0.025 0.0 106-107 0.025 0.0 0.0 0.025 0.0 108-109 0.025 0.0 0.0 0.025 0.0 110-111 0.025 0.0 0.0 0.025 0.0 112-113 0.025 0.0 0.0 0.025 0.0 114-115 0.025 0.0 0.0 0.025 0.0 116-117 0.025 0.0 0.0 0.025 0.0 118-119 0.025 0.0 0.0 0.025 0.0 120-121 0.05 0.0 0.0 0.025 0.0 122-123 0.1 0.0 0.0 0.025 0.0 124-125 0.1 0.0 0.0 0.025 0.0 126-127 0.1 0.0 0.0 0.025 0.0 128-129 0.1 0.0 0.0 0.025 0.0 130-131 0.1 0.0 0.0 0.025 0.0 132-133 0.1 0.0 0.0 0.025 0.0 134-135 0.1 0.0 0.0 0.025 0.0 136-137 0.1 0.0 0.0 0.025 0.0 138 0.1 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACCGA 10 0.006973645 144.0 1 ACCGAAC 10 0.006973645 144.0 3 CGAACAG 10 0.006973645 144.0 5 GAACAGT 10 0.006973645 144.0 6 ACAGTTT 10 0.006973645 144.0 8 >>END_MODULE SRR14639579 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639579_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8775 32.0 32.0 32.0 32.0 32.0 2 30.8575 32.0 32.0 32.0 32.0 32.0 3 34.12625 37.0 32.0 37.0 32.0 37.0 4 35.0075 37.0 37.0 37.0 32.0 37.0 5 35.40125 37.0 37.0 37.0 32.0 37.0 6 38.3955 41.0 37.0 41.0 32.0 41.0 7 38.4255 41.0 41.0 41.0 32.0 41.0 8 38.296 41.0 41.0 41.0 32.0 41.0 9 38.4345 41.0 41.0 41.0 32.0 41.0 10-14 38.42605 41.0 41.0 41.0 32.0 41.0 15-19 38.273849999999996 41.0 40.2 41.0 32.0 41.0 20-24 38.15495 41.0 39.4 41.0 30.0 41.0 25-29 37.770900000000005 41.0 37.0 41.0 28.0 41.0 30-34 37.611450000000005 41.0 37.0 41.0 27.0 41.0 35-39 37.5025 41.0 37.0 41.0 27.0 41.0 40-44 37.3283 41.0 37.0 41.0 27.0 41.0 45-49 37.22879999999999 41.0 37.0 41.0 27.0 41.0 50-54 36.9525 41.0 37.0 41.0 26.0 41.0 55-59 36.9628 41.0 37.0 41.0 27.0 41.0 60-64 36.927049999999994 41.0 37.0 41.0 27.0 41.0 65-69 36.6407 41.0 37.0 41.0 23.0 41.0 70-74 36.4425 41.0 37.0 41.0 23.0 41.0 75-79 35.7735 40.2 35.0 41.0 22.0 41.0 80-84 36.703649999999996 41.0 37.0 41.0 22.0 41.0 85-89 36.70345 41.0 37.0 41.0 22.0 41.0 90-94 36.38685 41.0 37.0 41.0 22.0 41.0 95-99 36.4008 41.0 37.0 41.0 22.0 41.0 100-104 36.23035 41.0 37.0 41.0 22.0 41.0 105-109 36.083600000000004 41.0 37.0 41.0 22.0 41.0 110-114 36.0786 41.0 37.0 41.0 22.0 41.0 115-119 35.81965 41.0 36.0 41.0 20.0 41.0 120-124 35.79875 41.0 36.0 41.0 22.0 41.0 125-129 35.318149999999996 41.0 34.0 41.0 18.0 41.0 130-134 35.300650000000005 41.0 32.0 41.0 22.0 41.0 135-139 34.8326 41.0 32.0 41.0 18.0 41.0 140-144 34.439800000000005 41.0 32.0 41.0 14.0 41.0 145-149 34.34455 40.2 31.0 41.0 12.0 41.0 150 33.925 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 9.0 17 11.0 18 21.0 19 30.0 20 28.0 21 38.0 22 34.0 23 33.0 24 40.0 25 43.0 26 60.0 27 60.0 28 64.0 29 67.0 30 89.0 31 98.0 32 112.0 33 117.0 34 138.0 35 143.0 36 190.0 37 225.0 38 372.0 39 605.0 40 1371.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.32949424136204 27.71657486229344 11.216825237856785 24.73710565848773 2 18.25 28.525 37.35 15.875 3 16.6 28.925 33.675 20.8 4 20.674999999999997 34.65 24.55 20.125 5 21.75 37.05 23.974999999999998 17.224999999999998 6 17.474999999999998 36.75 26.200000000000003 19.575 7 19.925 23.425 36.55 20.1 8 17.05 25.374999999999996 32.775 24.8 9 19.15 25.374999999999996 31.4 24.075 10-14 22.215 28.88 27.12 21.785 15-19 22.12 27.58 28.595 21.705 20-24 22.025 28.895 27.925 21.154999999999998 25-29 21.884999999999998 28.52 28.765 20.830000000000002 30-34 21.785 28.194999999999997 28.605000000000004 21.415 35-39 21.41 28.525 28.444999999999997 21.62 40-44 22.32 28.03 28.29 21.36 45-49 22.065 28.23 28.42 21.285 50-54 22.645 28.865000000000002 27.37 21.12 55-59 23.175 28.325 27.66 20.84 60-64 22.439999999999998 28.125 27.950000000000003 21.485000000000003 65-69 22.54 28.07 27.87 21.52 70-74 23.02 28.89 27.515 20.575 75-79 22.54 28.349999999999998 27.67 21.44 80-84 22.99 28.74 27.665 20.605 85-89 23.365 28.13 27.450000000000003 21.055 90-94 23.1 27.544999999999998 28.360000000000003 20.995 95-99 22.97 28.365000000000002 27.765 20.9 100-104 23.105 28.405 27.005000000000003 21.485000000000003 105-109 23.18 28.255000000000003 27.529999999999998 21.035 110-114 22.775000000000002 28.455000000000002 28.060000000000002 20.71 115-119 23.544999999999998 28.325 27.589999999999996 20.54 120-124 23.919999999999998 28.26 27.384999999999998 20.435 125-129 22.935 28.9 27.279999999999998 20.885 130-134 23.169999999999998 28.16 27.435 21.235 135-139 23.400000000000002 28.244999999999997 26.865 21.490000000000002 140-144 23.275000000000002 28.76 27.68 20.285 145-149 23.25 28.185 27.465 21.099999999999998 150 23.275000000000002 28.65 27.825 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 1.0 21 1.5 22 3.5 23 4.0 24 3.5 25 6.0 26 8.5 27 12.5 28 13.5 29 11.5 30 16.5 31 26.5 32 38.5 33 50.5 34 55.0 35 68.5 36 89.5 37 121.5 38 161.0 39 181.0 40 192.0 41 228.0 42 259.5 43 289.5 44 299.0 45 267.0 46 249.5 47 235.0 48 210.0 49 177.0 50 143.0 51 121.0 52 99.0 53 78.5 54 73.5 55 52.5 56 35.0 57 31.0 58 20.0 59 15.0 60 13.5 61 8.5 62 7.0 63 6.0 64 3.0 65 2.0 66 0.5 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.675 #Duplication Level Percentage of deduplicated Percentage of total 1 96.00209041024301 91.85 2 3.7104781813430887 7.1 3 0.20904102430101906 0.6 4 0.026130128037627383 0.1 5 0.0 0.0 6 0.026130128037627383 0.15 7 0.0 0.0 8 0.026130128037627383 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCTC 8 0.2 Illumina Single End PCR Primer 1 (96% over 31bp) AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.1 0.0 0.0 0.0 0.0 132-133 0.1125 0.0 0.0 0.0 0.0 134-135 0.125 0.0 0.0 0.0 0.0 136-137 0.15 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCAC 10 0.006973645 144.0 3 CTCATTC 10 0.006973645 144.0 1 TCATTCA 10 0.006973645 144.0 2 >>END_MODULE Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171087 spots for SRR14639579.sra Written 1171087 spots for SRR14639579.sra Read 1171101 spots for SRR14639579.sra Written 1171101 spots for SRR14639579.sra SRR ids: ['SRR14639579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0jceeva_ SRR14639579.sra spots: 23421754 blocks: [[1, 1171087], [1171088, 2342174], [2342175, 3513261], [3513262, 4684348], [4684349, 5855435], [5855436, 7026522], [7026523, 8197609], [8197610, 9368696], [9368697, 10539783], [10539784, 11710870], [11710871, 12881957], [12881958, 14053044], [14053045, 15224131], [15224132, 16395218], [16395219, 17566305], [17566306, 18737392], [18737393, 19908479], [19908480, 21079566], [21079567, 22250653], [22250654, 23421754]] SRR14639579 file size 8670201 SRR14639579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639579 SRR14639579_1.fastq SRR14639579_2.fastq Input file: SRR14639579_1.fastq Paired file: SRR14639579_2.fastq trimmed: SRR14639579-trimmed-pair1.fastq, SRR14639579-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:04:43 2025 >> started Fri Feb 14 11:05:10 2025 >> done (27.455s) 23421754 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 174 ( 0.00%) empty read pairs filtered out after trimming by size control 23421473 (100.00%) read pairs available; of these: 450160 ( 1.92%) trimmed read pairs available after processing 22971313 (98.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 12 0.00% 20 20 0.00% 21 15 0.00% 22 26 0.00% 23 25 0.00% 24 27 0.00% 25 15 0.00% 26 22 0.00% 27 31 0.00% 28 34 0.00% 29 30 0.00% 30 25 0.00% 31 41 0.00% 32 33 0.00% 33 36 0.00% 34 40 0.00% 35 31 0.00% 36 45 0.00% 37 31 0.00% 38 52 0.00% 39 48 0.00% 40 44 0.00% 41 42 0.00% 42 59 0.00% 43 45 0.00% 44 47 0.00% 45 74 0.00% 46 79 0.00% 47 59 0.00% 48 62 0.00% 49 49 0.00% 50 55 0.00% 51 74 0.00% 52 92 0.00% 53 67 0.00% 54 79 0.00% 55 98 0.00% 56 87 0.00% 57 80 0.00% 58 69 0.00% 59 106 0.00% 60 87 0.00% 61 109 0.00% 62 102 0.00% 63 110 0.00% 64 113 0.00% 65 119 0.00% 66 143 0.00% 67 130 0.00% 68 149 0.00% 69 135 0.00% 70 138 0.00% 71 168 0.00% 72 143 0.00% 73 161 0.00% 74 195 0.00% 75 181 0.00% 76 191 0.00% 77 170 0.00% 78 163 0.00% 79 213 0.00% 80 209 0.00% 81 221 0.00% 82 236 0.00% 83 270 0.00% 84 289 0.00% 85 260 0.00% 86 291 0.00% 87 290 0.00% 88 287 0.00% 89 328 0.00% 90 366 0.00% 91 384 0.00% 92 410 0.00% 93 436 0.00% 94 462 0.00% 95 429 0.00% 96 467 0.00% 97 494 0.00% 98 518 0.00% 99 556 0.00% 100 576 0.00% 101 549 0.00% 102 649 0.00% 103 644 0.00% 104 679 0.00% 105 785 0.00% 106 747 0.00% 107 740 0.00% 108 806 0.00% 109 862 0.00% 110 909 0.00% 111 991 0.00% 112 991 0.00% 113 1055 0.00% 114 1141 0.00% 115 1140 0.00% 116 1250 0.01% 117 1274 0.01% 118 1399 0.01% 119 1454 0.01% 120 1463 0.01% 121 1448 0.01% 122 1575 0.01% 123 1696 0.01% 124 1810 0.01% 125 1777 0.01% 126 1967 0.01% 127 1940 0.01% 128 1994 0.01% 129 2130 0.01% 130 2183 0.01% 131 2344 0.01% 132 2310 0.01% 133 2365 0.01% 134 2513 0.01% 135 2682 0.01% 136 2778 0.01% 137 2852 0.01% 138 2950 0.01% 139 3151 0.01% 140 3247 0.01% 141 3273 0.01% 142 3483 0.01% 143 3478 0.01% 144 3674 0.02% 145 3975 0.02% 146 4624 0.02% 147 6998 0.03% 148 22562 0.10% 149 320140 1.37% 150 22971313 98.08% 23421473 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=28 prefix-density=0.70 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=181.56 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.6 sequence=ATCAAGTTCGGGACAAGTAGTACATCATGTGGAGATCGAGTTTATGCGAAGGTTCGAAATAGATAAATACAAGTTCCTAATCAAAAAGCCCTACTATTTTCATGCATCAACTATCTCTCCAGCCTCAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATTTGGTTGCCCCAAAGCCTTCAAAGCCAAGTGTGCAGCCTTCTGCCCTGAGATCATCATTGC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=37 prefix-density=0.91 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=129.87 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.7 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639579 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:06:01 Started mapping on | Feb 14 11:06:01 Finished on | Feb 14 11:08:53 Mapping speed, Million of reads per hour | 490.22 Number of input reads | 23421473 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21690051 Uniquely mapped reads % | 92.61% Average mapped length | 297.28 Number of splices: Total | 22757276 Number of splices: Annotated (sjdb) | 22220541 Number of splices: GT/AG | 22341756 Number of splices: GC/AG | 335070 Number of splices: AT/AC | 16925 Number of splices: Non-canonical | 63525 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.02% Deletion average length | 3.20 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 476051 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 17798 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.24% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1255371 1255371 1255371 N_multimapping 476051 476051 476051 N_noFeature 650832 21370694 704153 N_ambiguous 393513 1287 126955 UnstrandedReadsAssigned:20645706 PositiveStrandReadsAssigned:318070 NegativeStrandReadsAssigned:20858943 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639579 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639579-trimmed-pair1.fastq SRR14639579-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,421,473 reads, 21,135,636 reads pseudoaligned [quant] estimated average fragment length: 386.893 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR14639579.ke.tsv 34699 SRR14639579.se.tsv 87100 total ==> SRR14639579.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1632.11 967 22.9222 Potri.005G024800.1.v4.1 1035 649.107 427 25.4502 Potri.004G059700.1.v4.1 961 575.698 61 4.09934 Potri.007G009000.2.v4.1 1416 1030.11 0 0 Potri.003G141000.2.v4.1 2943 2557.11 1921 29.0642 Potri.016G087400.1.v4.1 270 46.9394 1369 1128.35 Potri.015G069301.1.v4.1 564 215.023 0 0 Potri.010G195200.1.v4.1 1773 1387.11 116 3.2354 Potri.012G127500.1.v4.1 977 591.419 76 4.97161 ==> SRR14639579.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 202 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 241 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 39 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR14639579 completed mapping pipeline successfully