Starting /dee2/code/volunteer_pipeline.sh SRR14639580 current disk space = 3115020173312 free memory = 1565750412 SRR14639580 SRAfilesize 485ff56a192400843b12ca768192c084 SRR14639580.sra SRR14639580.sra file validated SRR14639580 is paired end SRR14639580 is conventional basespace SRR14639580 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66375 32.0 32.0 32.0 32.0 32.0 2 31.515 32.0 32.0 32.0 32.0 32.0 3 35.325 37.0 32.0 37.0 32.0 37.0 4 36.1475 37.0 37.0 37.0 37.0 37.0 5 36.335 37.0 37.0 37.0 37.0 37.0 6 39.86275 41.0 41.0 41.0 37.0 41.0 7 39.9 41.0 41.0 41.0 37.0 41.0 8 40.20275 41.0 41.0 41.0 37.0 41.0 9 40.22 41.0 41.0 41.0 37.0 41.0 10-14 40.26845 41.0 41.0 41.0 40.2 41.0 15-19 40.286750000000005 41.0 41.0 41.0 41.0 41.0 20-24 40.278949999999995 41.0 41.0 41.0 39.4 41.0 25-29 40.217650000000006 41.0 41.0 41.0 41.0 41.0 30-34 40.2386 41.0 41.0 41.0 41.0 41.0 35-39 40.1312 41.0 41.0 41.0 38.6 41.0 40-44 40.089099999999995 41.0 41.0 41.0 37.8 41.0 45-49 40.04805 41.0 41.0 41.0 37.0 41.0 50-54 40.01735 41.0 41.0 41.0 37.0 41.0 55-59 39.933 41.0 41.0 41.0 37.0 41.0 60-64 39.89319999999999 41.0 41.0 41.0 37.0 41.0 65-69 39.83085 41.0 41.0 41.0 37.0 41.0 70-74 39.59905 41.0 41.0 41.0 37.0 41.0 75-79 39.2156 41.0 40.2 41.0 36.0 41.0 80-84 39.6592 41.0 41.0 41.0 37.0 41.0 85-89 39.6574 41.0 41.0 41.0 37.0 41.0 90-94 39.59995 41.0 41.0 41.0 37.0 41.0 95-99 39.479200000000006 41.0 41.0 41.0 37.0 41.0 100-104 39.354850000000006 41.0 41.0 41.0 37.0 41.0 105-109 39.32745 41.0 41.0 41.0 37.0 41.0 110-114 39.30795 41.0 41.0 41.0 37.0 41.0 115-119 39.22665000000001 41.0 41.0 41.0 37.0 41.0 120-124 39.22495 41.0 41.0 41.0 37.0 41.0 125-129 39.1644 41.0 41.0 41.0 37.0 41.0 130-134 38.9277 41.0 41.0 41.0 33.0 41.0 135-139 38.5732 41.0 41.0 41.0 32.0 41.0 140-144 38.336999999999996 41.0 38.6 41.0 32.0 41.0 145-149 38.24615000000001 41.0 37.0 41.0 32.0 41.0 150 38.0 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 1.0 24 1.0 25 3.0 26 7.0 27 6.0 28 19.0 29 21.0 30 22.0 31 29.0 32 40.0 33 60.0 34 61.0 35 82.0 36 113.0 37 145.0 38 237.0 39 514.0 40 2637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.843921960980495 13.306653326663332 10.630315157578789 38.21910955477739 2 15.275 13.775 41.475 29.475 3 15.1 19.425 31.0 34.475 4 20.674999999999997 26.625 25.174999999999997 27.525 5 21.625 33.925 25.1 19.35 6 16.45 33.425 29.175 20.95 7 14.274999999999999 25.650000000000002 41.525 18.55 8 14.099999999999998 23.875 37.775 24.25 9 14.875 24.0 36.8 24.325 10-14 18.045 28.48 29.475 24.0 15-19 18.72 28.465 28.735 24.08 20-24 18.435000000000002 29.099999999999998 28.435 24.03 25-29 18.125 29.134999999999998 28.845 23.895 30-34 19.175 28.815 28.549999999999997 23.46 35-39 19.005 29.07 28.349999999999998 23.575 40-44 18.83 28.685 28.49 23.995 45-49 19.57 28.544999999999998 28.305000000000003 23.580000000000002 50-54 18.955 29.49 28.04 23.515 55-59 19.3 28.23 28.58 23.89 60-64 19.259999999999998 28.065 28.7 23.974999999999998 65-69 18.955 28.955 27.955000000000002 24.135 70-74 19.139999999999997 28.68 28.439999999999998 23.74 75-79 18.459999999999997 29.134999999999998 28.499999999999996 23.905 80-84 18.88 28.860000000000003 28.315 23.945 85-89 19.265 28.84 28.125 23.77 90-94 19.48 28.62 27.98 23.919999999999998 95-99 19.415 28.24 28.595 23.75 100-104 19.375 28.345 28.110000000000003 24.169999999999998 105-109 19.71 27.87 28.449999999999996 23.97 110-114 19.580000000000002 27.894999999999996 28.660000000000004 23.865 115-119 19.564999999999998 28.299999999999997 28.065 24.07 120-124 19.335 27.92 28.415000000000003 24.33 125-129 20.015 28.035 27.900000000000002 24.05 130-134 19.505 28.815 27.985 23.695 135-139 19.75 28.660000000000004 27.450000000000003 24.14 140-144 19.963992798559712 28.170634126825366 28.580716143228646 23.284656931386277 145-149 19.54 28.560000000000002 27.85 24.05 150 19.825 29.225 27.125 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.5 20 1.5 21 1.0 22 1.5 23 2.0 24 2.5 25 2.0 26 4.5 27 8.0 28 11.5 29 19.5 30 26.0 31 32.0 32 42.5 33 50.0 34 71.0 35 94.5 36 108.5 37 136.0 38 171.0 39 193.5 40 198.5 41 232.5 42 267.0 43 279.5 44 293.0 45 277.5 46 247.5 47 225.5 48 204.5 49 175.0 50 151.0 51 121.0 52 84.0 53 72.5 54 56.5 55 37.0 56 27.0 57 18.5 58 18.0 59 12.5 60 4.5 61 3.5 62 4.5 63 1.5 64 1.0 65 1.0 66 1.0 67 1.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.1829428797052 90.4 2 4.4222163727296655 8.4 3 0.315872598052119 0.8999999999999999 4 0.07896814951302975 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.075 0.0 0.0 0.0 0.0 128-129 0.0875 0.0 0.0 0.0 0.0 130-131 0.1 0.0 0.0 0.0 0.0 132-133 0.125 0.0 0.0 0.0 0.0 134-135 0.16249999999999998 0.0 0.0 0.0 0.0 136-137 0.1875 0.0 0.0 0.0 0.0 138 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAGAG 10 0.006973645 144.0 9 >>END_MODULE SRR14639580 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639580_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.77125 32.0 32.0 32.0 32.0 32.0 2 30.91 32.0 32.0 32.0 32.0 32.0 3 34.1825 37.0 32.0 37.0 32.0 37.0 4 35.05375 37.0 37.0 37.0 32.0 37.0 5 35.27875 37.0 37.0 37.0 32.0 37.0 6 38.39425 41.0 37.0 41.0 32.0 41.0 7 38.27025 41.0 41.0 41.0 32.0 41.0 8 38.31825 41.0 41.0 41.0 32.0 41.0 9 38.459 41.0 41.0 41.0 32.0 41.0 10-14 38.491499999999995 41.0 41.0 41.0 32.0 41.0 15-19 38.2972 41.0 41.0 41.0 32.0 41.0 20-24 38.1513 41.0 40.2 41.0 31.0 41.0 25-29 37.9416 41.0 38.6 41.0 29.0 41.0 30-34 37.778099999999995 41.0 37.0 41.0 27.0 41.0 35-39 37.7341 41.0 37.0 41.0 27.0 41.0 40-44 37.43655 41.0 37.0 41.0 27.0 41.0 45-49 37.338049999999996 41.0 37.0 41.0 27.0 41.0 50-54 37.14035 41.0 37.0 41.0 27.0 41.0 55-59 37.17835 41.0 37.0 41.0 27.0 41.0 60-64 37.11755000000001 41.0 37.0 41.0 27.0 41.0 65-69 36.829899999999995 41.0 37.0 41.0 25.0 41.0 70-74 36.67625 41.0 37.0 41.0 24.0 41.0 75-79 35.861850000000004 40.2 35.0 41.0 22.0 41.0 80-84 36.802350000000004 41.0 37.0 41.0 22.0 41.0 85-89 36.91645 41.0 37.0 41.0 22.0 41.0 90-94 36.5554 41.0 37.0 41.0 22.0 41.0 95-99 36.5669 41.0 37.0 41.0 22.0 41.0 100-104 36.33595 41.0 37.0 41.0 22.0 41.0 105-109 36.34675 41.0 37.0 41.0 22.0 41.0 110-114 36.2436 41.0 37.0 41.0 22.0 41.0 115-119 35.71605000000001 41.0 35.0 41.0 20.0 41.0 120-124 35.931200000000004 41.0 37.0 41.0 22.0 41.0 125-129 35.4875 41.0 34.0 41.0 20.0 41.0 130-134 35.550200000000004 41.0 34.0 41.0 22.0 41.0 135-139 34.9845 41.0 33.0 41.0 18.0 41.0 140-144 34.73694999999999 41.0 32.0 41.0 14.0 41.0 145-149 34.40645 40.2 31.0 41.0 12.0 41.0 150 34.198 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 6.0 16 7.0 17 13.0 18 17.0 19 29.0 20 30.0 21 32.0 22 27.0 23 39.0 24 39.0 25 39.0 26 48.0 27 62.0 28 57.0 29 71.0 30 80.0 31 101.0 32 98.0 33 108.0 34 127.0 35 152.0 36 194.0 37 243.0 38 369.0 39 562.0 40 1448.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.596996245306634 27.434292866082604 10.012515644555695 24.956195244055067 2 21.0 26.3 37.675 15.024999999999999 3 16.625 28.075 35.05 20.25 4 21.025 35.449999999999996 24.65 18.875 5 22.275 38.275 23.125 16.325 6 17.95 38.025 24.925 19.1 7 18.625 23.3 38.35 19.725 8 16.400000000000002 24.625 33.25 25.724999999999998 9 19.325 25.424999999999997 30.55 24.7 10-14 22.305 28.63 27.950000000000003 21.115000000000002 15-19 21.7 28.975 28.095 21.23 20-24 21.6 28.945 28.285 21.17 25-29 21.834999999999997 29.075 28.105000000000004 20.985 30-34 22.1 27.88 28.38 21.64 35-39 21.825 28.16 28.055000000000003 21.959999999999997 40-44 22.6 28.265 27.950000000000003 21.185000000000002 45-49 21.935 28.494999999999997 28.925 20.645 50-54 22.665 27.79 28.27 21.275 55-59 22.07 28.23 28.235 21.465 60-64 22.81 28.18 27.935 21.075 65-69 23.11 28.09 27.735 21.065 70-74 22.595000000000002 28.565 27.57 21.27 75-79 22.634999999999998 28.615000000000002 27.375 21.375 80-84 23.115 28.49 27.705000000000002 20.69 85-89 23.435 27.37 27.894999999999996 21.3 90-94 23.035 27.775 28.199999999999996 20.990000000000002 95-99 23.145 28.18 27.834999999999997 20.84 100-104 23.200000000000003 28.115000000000002 27.36 21.325 105-109 22.56 27.665 28.349999999999998 21.425 110-114 22.75 28.32 27.965 20.965 115-119 22.775000000000002 27.939999999999998 27.73 21.555 120-124 22.575 27.894999999999996 28.515 21.015 125-129 23.32 28.32 27.275 21.085 130-134 23.080000000000002 28.475 28.044999999999998 20.4 135-139 22.98 28.084999999999997 27.744999999999997 21.19 140-144 23.135 28.775000000000002 27.365000000000002 20.724999999999998 145-149 23.315 27.634999999999998 28.335 20.715 150 23.575 26.825 28.050000000000004 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.5 18 0.5 19 0.5 20 0.5 21 0.0 22 3.0 23 5.5 24 7.0 25 10.0 26 8.0 27 6.5 28 12.5 29 18.5 30 23.5 31 23.0 32 26.0 33 43.0 34 56.0 35 73.5 36 100.5 37 119.5 38 141.0 39 182.5 40 216.5 41 248.5 42 265.0 43 269.5 44 282.0 45 279.0 46 254.0 47 227.0 48 196.0 49 167.5 50 152.5 51 123.5 52 102.5 53 83.0 54 66.5 55 59.0 56 42.5 57 25.5 58 19.0 59 15.5 60 9.5 61 8.5 62 8.5 63 5.0 64 2.0 65 1.0 66 1.5 67 2.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.025 #Duplication Level Percentage of deduplicated Percentage of total 1 96.22494142150482 92.4 2 3.436605050768029 6.6000000000000005 3 0.31241864097891175 0.8999999999999999 4 0.02603488674824265 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.037500000000000006 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.11249999999999999 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.175 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.2375 0.0 0.0 0.0 0.0 132-133 0.25 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 0.3625 0.0 0.0 0.0 0.0 138 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACATT 10 0.006973645 144.0 4 GAACACA 10 0.006973645 144.0 2 ATTCATA 10 0.006973645 144.0 8 >>END_MODULE Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050346 spots for SRR14639580.sra Written 1050346 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra Read 1050340 spots for SRR14639580.sra Written 1050340 spots for SRR14639580.sra SRR ids: ['SRR14639580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o11yg2gg SRR14639580.sra spots: 21006806 blocks: [[1, 1050340], [1050341, 2100680], [2100681, 3151020], [3151021, 4201360], [4201361, 5251700], [5251701, 6302040], [6302041, 7352380], [7352381, 8402720], [8402721, 9453060], [9453061, 10503400], [10503401, 11553740], [11553741, 12604080], [12604081, 13654420], [13654421, 14704760], [14704761, 15755100], [15755101, 16805440], [16805441, 17855780], [17855781, 18906120], [18906121, 19956460], [19956461, 21006806]] SRR14639580 file size 7775102 SRR14639580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639580 SRR14639580_1.fastq SRR14639580_2.fastq Input file: SRR14639580_1.fastq Paired file: SRR14639580_2.fastq trimmed: SRR14639580-trimmed-pair1.fastq, SRR14639580-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:10:54 2025 >> started Fri Feb 14 11:11:25 2025 >> done (30.652s) 21006806 read pairs processed; of these: 136 ( 0.00%) short read pairs filtered out after trimming by size control 147 ( 0.00%) empty read pairs filtered out after trimming by size control 21006523 (100.00%) read pairs available; of these: 407942 ( 1.94%) trimmed read pairs available after processing 20598581 (98.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 14 0.00% 20 18 0.00% 21 21 0.00% 22 34 0.00% 23 22 0.00% 24 20 0.00% 25 22 0.00% 26 24 0.00% 27 40 0.00% 28 31 0.00% 29 32 0.00% 30 39 0.00% 31 44 0.00% 32 42 0.00% 33 29 0.00% 34 39 0.00% 35 42 0.00% 36 37 0.00% 37 51 0.00% 38 65 0.00% 39 58 0.00% 40 51 0.00% 41 52 0.00% 42 45 0.00% 43 53 0.00% 44 51 0.00% 45 60 0.00% 46 79 0.00% 47 59 0.00% 48 49 0.00% 49 63 0.00% 50 80 0.00% 51 71 0.00% 52 64 0.00% 53 79 0.00% 54 91 0.00% 55 79 0.00% 56 85 0.00% 57 73 0.00% 58 88 0.00% 59 111 0.00% 60 103 0.00% 61 97 0.00% 62 104 0.00% 63 111 0.00% 64 111 0.00% 65 125 0.00% 66 129 0.00% 67 121 0.00% 68 106 0.00% 69 130 0.00% 70 135 0.00% 71 128 0.00% 72 125 0.00% 73 156 0.00% 74 149 0.00% 75 162 0.00% 76 205 0.00% 77 183 0.00% 78 188 0.00% 79 192 0.00% 80 166 0.00% 81 193 0.00% 82 228 0.00% 83 240 0.00% 84 209 0.00% 85 262 0.00% 86 262 0.00% 87 259 0.00% 88 296 0.00% 89 257 0.00% 90 303 0.00% 91 300 0.00% 92 334 0.00% 93 342 0.00% 94 387 0.00% 95 369 0.00% 96 405 0.00% 97 427 0.00% 98 459 0.00% 99 494 0.00% 100 468 0.00% 101 495 0.00% 102 566 0.00% 103 586 0.00% 104 693 0.00% 105 697 0.00% 106 692 0.00% 107 740 0.00% 108 745 0.00% 109 742 0.00% 110 791 0.00% 111 911 0.00% 112 928 0.00% 113 990 0.00% 114 1026 0.00% 115 1168 0.01% 116 1160 0.01% 117 1212 0.01% 118 1246 0.01% 119 1322 0.01% 120 1381 0.01% 121 1452 0.01% 122 1526 0.01% 123 1637 0.01% 124 1767 0.01% 125 1816 0.01% 126 1898 0.01% 127 1930 0.01% 128 2049 0.01% 129 2141 0.01% 130 2347 0.01% 131 2388 0.01% 132 2402 0.01% 133 2478 0.01% 134 2640 0.01% 135 2749 0.01% 136 2887 0.01% 137 3025 0.01% 138 3250 0.02% 139 3343 0.02% 140 3327 0.02% 141 3635 0.02% 142 3725 0.02% 143 3830 0.02% 144 4095 0.02% 145 4291 0.02% 146 4919 0.02% 147 7299 0.03% 148 21191 0.10% 149 278273 1.32% 150 20598581 98.06% 21006523 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=32 prefix-density=0.62 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=61.68 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.3 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=35 prefix-density=0.81 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=113.59 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.1 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639580 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:12:23 Started mapping on | Feb 14 11:12:23 Finished on | Feb 14 11:14:48 Mapping speed, Million of reads per hour | 521.54 Number of input reads | 21006523 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19290672 Uniquely mapped reads % | 91.83% Average mapped length | 297.34 Number of splices: Total | 20103781 Number of splices: Annotated (sjdb) | 19622274 Number of splices: GT/AG | 19734988 Number of splices: GC/AG | 296584 Number of splices: AT/AC | 14541 Number of splices: Non-canonical | 57668 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.02% Deletion average length | 3.19 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429910 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 21941 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.96% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1285941 1285941 1285941 N_multimapping 429910 429910 429910 N_noFeature 639912 19018807 687496 N_ambiguous 345459 1047 120845 UnstrandedReadsAssigned:18305301 PositiveStrandReadsAssigned:270818 NegativeStrandReadsAssigned:18482331 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639580 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639580-trimmed-pair1.fastq SRR14639580-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,006,523 reads, 18,758,742 reads pseudoaligned [quant] estimated average fragment length: 375.868 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR14639580.ke.tsv 34699 SRR14639580.se.tsv 87100 total ==> SRR14639580.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1643.13 904 24.7566 Potri.005G024800.1.v4.1 1035 660.132 362 24.6759 Potri.004G059700.1.v4.1 961 586.535 39 2.99203 Potri.007G009000.2.v4.1 1416 1041.13 0 0 Potri.003G141000.2.v4.1 2943 2568.13 1776.52 31.1278 Potri.016G087400.1.v4.1 270 47.9634 1307 1226.2 Potri.015G069301.1.v4.1 564 221.661 0 0 Potri.010G195200.1.v4.1 1773 1398.13 201.945 6.49951 Potri.012G127500.1.v4.1 977 602.379 48 3.58564 ==> SRR14639580.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 191 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 69 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR14639580 completed mapping pipeline successfully