Starting /dee2/code/volunteer_pipeline.sh SRR14639581 current disk space = 3115184627712 free memory = 1578175380 SRR14639581 SRAfilesize 2d0b0d5e1b3a9b7c15735107fb32cc0f SRR14639581.sra SRR14639581.sra file validated SRR14639581 is paired end SRR14639581 is conventional basespace SRR14639581 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639581_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.595 32.0 32.0 32.0 32.0 32.0 2 31.375 32.0 32.0 32.0 32.0 32.0 3 35.07875 37.0 32.0 37.0 32.0 37.0 4 36.08 37.0 37.0 37.0 32.0 37.0 5 36.2375 37.0 37.0 37.0 37.0 37.0 6 39.69575 41.0 41.0 41.0 37.0 41.0 7 39.73875 41.0 41.0 41.0 37.0 41.0 8 39.983 41.0 41.0 41.0 37.0 41.0 9 40.07375 41.0 41.0 41.0 37.0 41.0 10-14 40.1092 41.0 41.0 41.0 37.0 41.0 15-19 40.105900000000005 41.0 41.0 41.0 37.0 41.0 20-24 40.138549999999995 41.0 41.0 41.0 37.0 41.0 25-29 40.1451 41.0 41.0 41.0 37.0 41.0 30-34 40.0746 41.0 41.0 41.0 37.0 41.0 35-39 39.951800000000006 41.0 41.0 41.0 37.0 41.0 40-44 39.94355 41.0 41.0 41.0 37.0 41.0 45-49 39.871700000000004 41.0 41.0 41.0 37.0 41.0 50-54 39.85955 41.0 41.0 41.0 37.0 41.0 55-59 39.74425 41.0 41.0 41.0 37.0 41.0 60-64 39.7082 41.0 41.0 41.0 37.0 41.0 65-69 39.6126 41.0 41.0 41.0 37.0 41.0 70-74 39.45890000000001 41.0 41.0 41.0 37.0 41.0 75-79 39.0118 41.0 40.2 41.0 35.0 41.0 80-84 39.4514 41.0 41.0 41.0 37.0 41.0 85-89 39.3946 41.0 41.0 41.0 37.0 41.0 90-94 39.3425 41.0 41.0 41.0 37.0 41.0 95-99 39.3039 41.0 41.0 41.0 37.0 41.0 100-104 39.2024 41.0 41.0 41.0 37.0 41.0 105-109 39.11495 41.0 41.0 41.0 37.0 41.0 110-114 39.10075 41.0 41.0 41.0 37.0 41.0 115-119 39.02585 41.0 41.0 41.0 37.0 41.0 120-124 39.0483 41.0 41.0 41.0 37.0 41.0 125-129 39.0572 41.0 41.0 41.0 37.0 41.0 130-134 38.75745 41.0 41.0 41.0 32.0 41.0 135-139 38.535000000000004 41.0 41.0 41.0 32.0 41.0 140-144 38.2532 41.0 37.8 41.0 32.0 41.0 145-149 37.96465 41.0 37.0 41.0 32.0 41.0 150 37.74725 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 5.0 24 4.0 25 6.0 26 6.0 27 13.0 28 20.0 29 21.0 30 22.0 31 39.0 32 51.0 33 60.0 34 71.0 35 89.0 36 131.0 37 170.0 38 266.0 39 490.0 40 2533.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.2 14.549999999999999 12.6 33.650000000000006 2 15.9 14.924999999999999 40.25 28.925 3 15.35 21.2 30.099999999999998 33.35 4 21.775 28.799999999999997 24.675 24.75 5 19.275000000000002 34.125 27.450000000000003 19.15 6 14.524999999999999 33.324999999999996 30.099999999999998 22.05 7 14.174999999999999 26.6 39.800000000000004 19.425 8 14.224999999999998 26.075 35.05 24.65 9 14.249999999999998 26.224999999999998 35.6 23.925 10-14 18.96 28.825 28.410000000000004 23.805 15-19 18.83 28.455000000000002 28.585 24.13 20-24 18.81 28.255000000000003 28.349999999999998 24.585 25-29 18.52 28.794999999999998 29.015 23.669999999999998 30-34 19.165 28.125 29.03 23.68 35-39 18.65 29.154999999999998 28.494999999999997 23.7 40-44 18.815 28.74 28.435 24.01 45-49 18.78 29.439999999999998 27.985 23.794999999999998 50-54 19.055 29.25 28.345 23.35 55-59 19.125 28.925 28.155 23.794999999999998 60-64 19.295 28.76 27.855 24.09 65-69 18.775 28.645 28.749999999999996 23.830000000000002 70-74 19.53 28.43 28.595 23.445 75-79 19.86 28.175 28.01 23.955000000000002 80-84 18.86 28.689999999999998 28.439999999999998 24.01 85-89 19.525000000000002 28.84 28.03 23.605 90-94 19.580000000000002 28.299999999999997 28.175 23.945 95-99 19.42 28.24 28.1 24.240000000000002 100-104 19.86 27.889999999999997 28.43 23.82 105-109 19.60598029901495 27.886394319715986 28.016400820041003 24.491224561228062 110-114 19.715 28.244999999999997 28.345 23.695 115-119 19.12 29.32 27.875 23.685000000000002 120-124 19.75 28.345 27.975 23.93 125-129 20.11 27.800000000000004 27.965 24.125 130-134 19.689999999999998 28.194999999999997 28.73 23.385 135-139 20.505000000000003 27.72 28.025 23.75 140-144 20.217021702170218 28.257825782578255 27.997799779978 23.527352735273528 145-149 20.595 27.560000000000002 28.16 23.685000000000002 150 20.4 27.400000000000002 27.325 24.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 2.0 20 2.0 21 1.0 22 2.5 23 3.0 24 2.5 25 3.0 26 7.5 27 12.0 28 12.5 29 14.0 30 20.5 31 28.5 32 44.0 33 57.0 34 65.0 35 82.5 36 103.5 37 121.5 38 144.0 39 186.5 40 229.0 41 247.5 42 260.5 43 271.5 44 277.5 45 272.5 46 270.0 47 253.5 48 213.5 49 175.0 50 147.0 51 113.5 52 82.5 53 76.0 54 50.5 55 34.0 56 36.0 57 23.0 58 11.0 59 11.5 60 10.0 61 5.0 62 3.5 63 2.5 64 1.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.3 #Duplication Level Percentage of deduplicated Percentage of total 1 95.38300104931794 90.9 2 4.328436516264428 8.25 3 0.26232948583420773 0.75 4 0.026232948583420776 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.0625 0.0 0.0 0.0 0.0 128-129 0.075 0.0 0.0 0.0 0.0 130-131 0.0875 0.0 0.0 0.0 0.0 132-133 0.125 0.0 0.0 0.0 0.0 134-135 0.15 0.0 0.0 0.0 0.0 136-137 0.175 0.0 0.0 0.0 0.0 138 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCCAC 10 0.006973645 144.0 2 GTCCACA 10 0.006973645 144.0 1 GTAGCCA 10 0.006973645 144.0 1 >>END_MODULE SRR14639581 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639581_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7125 32.0 32.0 32.0 32.0 32.0 2 30.6725 32.0 32.0 32.0 32.0 32.0 3 34.1025 37.0 32.0 37.0 32.0 37.0 4 34.9725 37.0 37.0 37.0 32.0 37.0 5 35.2825 37.0 37.0 37.0 32.0 37.0 6 38.43275 41.0 37.0 41.0 32.0 41.0 7 38.19925 41.0 41.0 41.0 32.0 41.0 8 38.18225 41.0 41.0 41.0 32.0 41.0 9 38.491 41.0 41.0 41.0 32.0 41.0 10-14 38.46805 41.0 41.0 41.0 32.0 41.0 15-19 38.22355 41.0 41.0 41.0 31.0 41.0 20-24 38.087 41.0 41.0 41.0 32.0 41.0 25-29 37.7099 41.0 37.8 41.0 28.0 41.0 30-34 37.630849999999995 41.0 37.0 41.0 27.0 41.0 35-39 37.503800000000005 41.0 37.0 41.0 27.0 41.0 40-44 37.4666 41.0 37.0 41.0 27.0 41.0 45-49 37.23465 41.0 37.0 41.0 27.0 41.0 50-54 37.05375 41.0 37.0 41.0 26.0 41.0 55-59 37.02835 41.0 37.0 41.0 27.0 41.0 60-64 36.9876 41.0 37.0 41.0 26.0 41.0 65-69 36.6799 41.0 37.0 41.0 24.0 41.0 70-74 36.5654 41.0 37.0 41.0 24.0 41.0 75-79 35.738350000000004 40.2 35.0 41.0 22.0 41.0 80-84 36.75725 41.0 37.0 41.0 22.0 41.0 85-89 36.81375 41.0 37.0 41.0 22.0 41.0 90-94 36.397000000000006 41.0 37.0 41.0 22.0 41.0 95-99 36.5647 41.0 37.0 41.0 22.0 41.0 100-104 36.17985 41.0 37.0 41.0 20.0 41.0 105-109 36.1841 41.0 37.0 41.0 22.0 41.0 110-114 36.165049999999994 41.0 37.0 41.0 22.0 41.0 115-119 35.8969 41.0 36.0 41.0 20.0 41.0 120-124 35.900150000000004 41.0 37.0 41.0 22.0 41.0 125-129 35.3712 41.0 34.0 41.0 18.0 41.0 130-134 35.30025 41.0 32.0 41.0 22.0 41.0 135-139 34.8343 41.0 32.0 41.0 18.0 41.0 140-144 34.556999999999995 41.0 32.0 41.0 12.0 41.0 145-149 34.55185 40.2 31.0 41.0 12.0 41.0 150 33.9535 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 4.0 16 6.0 17 14.0 18 25.0 19 38.0 20 37.0 21 28.0 22 34.0 23 37.0 24 44.0 25 45.0 26 51.0 27 58.0 28 68.0 29 65.0 30 82.0 31 83.0 32 95.0 33 116.0 34 131.0 35 154.0 36 158.0 37 230.0 38 365.0 39 536.0 40 1494.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.23289044873402 28.102281273502133 9.801955377287541 22.86287290047631 2 20.375 28.775000000000002 34.9 15.950000000000001 3 18.475 29.975 33.225 18.325 4 21.75 35.925000000000004 23.150000000000002 19.175 5 23.125 39.5 22.1 15.275 6 19.900000000000002 37.7 23.724999999999998 18.675 7 20.45 23.674999999999997 35.35 20.525 8 16.55 26.450000000000003 32.225 24.775 9 20.125 24.825 31.125000000000004 23.925 10-14 22.134999999999998 29.154999999999998 27.11 21.6 15-19 22.314999999999998 28.884999999999998 27.800000000000004 21.0 20-24 22.535 28.68 27.834999999999997 20.95 25-29 22.57 28.505000000000003 28.310000000000002 20.615 30-34 22.34 28.615000000000002 27.72 21.325 35-39 22.67 28.035 27.82 21.475 40-44 22.34 28.765 27.439999999999998 21.455 45-49 22.21 28.265 27.99 21.535 50-54 22.75 28.384999999999998 27.950000000000003 20.915 55-59 23.385 28.34 27.58 20.695 60-64 22.770000000000003 27.985 28.249999999999996 20.995 65-69 23.615 27.134999999999998 27.785 21.465 70-74 22.8 28.185 27.450000000000003 21.565 75-79 22.895 27.279999999999998 28.360000000000003 21.465 80-84 22.57 28.16 28.044999999999998 21.224999999999998 85-89 23.51 27.935 27.400000000000002 21.154999999999998 90-94 23.27 27.944999999999997 27.82 20.965 95-99 23.35 28.499999999999996 27.125 21.025 100-104 23.305 27.71 27.634999999999998 21.349999999999998 105-109 23.105 27.82 27.42 21.654999999999998 110-114 22.439999999999998 28.395 28.29 20.875 115-119 22.78 28.225 27.250000000000004 21.745 120-124 22.759999999999998 27.455000000000002 28.16 21.625 125-129 22.795 27.715 27.61 21.88 130-134 23.305 27.655 27.634999999999998 21.404999999999998 135-139 23.585 27.49 27.41 21.515 140-144 23.015 27.534999999999997 28.415000000000003 21.035 145-149 23.674999999999997 27.52 27.35 21.455 150 22.15 27.575 28.7 21.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 1.0 20 2.0 21 1.5 22 2.0 23 2.5 24 4.0 25 5.5 26 7.0 27 8.0 28 8.0 29 15.0 30 23.5 31 30.0 32 31.0 33 36.0 34 48.5 35 67.0 36 87.0 37 107.5 38 143.5 39 176.0 40 203.5 41 245.0 42 253.0 43 247.5 44 260.5 45 283.5 46 286.5 47 251.5 48 225.0 49 191.0 50 154.5 51 121.0 52 99.0 53 82.0 54 65.0 55 53.0 56 38.5 57 34.5 58 32.0 59 22.0 60 12.0 61 9.5 62 5.5 63 2.5 64 4.5 65 4.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 96.008348552048 92.0 2 3.7046699713018523 7.1 3 0.2348030263501174 0.675 4 0.026089225150013044 0.1 5 0.026089225150013044 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.037500000000000006 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.16249999999999998 0.0 0.0 0.0 0.0 126-127 0.1875 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.21250000000000002 0.0 0.0 0.0 0.0 132-133 0.25 0.0 0.0 0.0 0.0 134-135 0.2875 0.0 0.0 0.0 0.0 136-137 0.325 0.0 0.0 0.0 0.0 138 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171926 spots for SRR14639581.sra Written 1171926 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra Read 1171925 spots for SRR14639581.sra Written 1171925 spots for SRR14639581.sra SRR ids: ['SRR14639581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9mssmvou SRR14639581.sra spots: 23438501 blocks: [[1, 1171925], [1171926, 2343850], [2343851, 3515775], [3515776, 4687700], [4687701, 5859625], [5859626, 7031550], [7031551, 8203475], [8203476, 9375400], [9375401, 10547325], [10547326, 11719250], [11719251, 12891175], [12891176, 14063100], [14063101, 15235025], [15235026, 16406950], [16406951, 17578875], [17578876, 18750800], [18750801, 19922725], [19922726, 21094650], [21094651, 22266575], [22266576, 23438501]] SRR14639581 file size 8676374 SRR14639581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639581 SRR14639581_1.fastq SRR14639581_2.fastq Input file: SRR14639581_1.fastq Paired file: SRR14639581_2.fastq trimmed: SRR14639581-trimmed-pair1.fastq, SRR14639581-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:04:32 2025 >> started Fri Feb 14 11:05:15 2025 >> done (43.136s) 23438501 read pairs processed; of these: 130 ( 0.00%) short read pairs filtered out after trimming by size control 76 ( 0.00%) empty read pairs filtered out after trimming by size control 23438295 (100.00%) read pairs available; of these: 502160 ( 2.14%) trimmed read pairs available after processing 22936135 (97.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 19 0.00% 20 18 0.00% 21 23 0.00% 22 29 0.00% 23 25 0.00% 24 28 0.00% 25 23 0.00% 26 27 0.00% 27 29 0.00% 28 31 0.00% 29 35 0.00% 30 39 0.00% 31 36 0.00% 32 41 0.00% 33 45 0.00% 34 34 0.00% 35 46 0.00% 36 24 0.00% 37 44 0.00% 38 67 0.00% 39 39 0.00% 40 41 0.00% 41 52 0.00% 42 68 0.00% 43 47 0.00% 44 64 0.00% 45 63 0.00% 46 64 0.00% 47 76 0.00% 48 59 0.00% 49 76 0.00% 50 74 0.00% 51 91 0.00% 52 57 0.00% 53 87 0.00% 54 84 0.00% 55 89 0.00% 56 108 0.00% 57 120 0.00% 58 113 0.00% 59 98 0.00% 60 101 0.00% 61 104 0.00% 62 102 0.00% 63 113 0.00% 64 130 0.00% 65 114 0.00% 66 117 0.00% 67 139 0.00% 68 130 0.00% 69 149 0.00% 70 153 0.00% 71 173 0.00% 72 158 0.00% 73 189 0.00% 74 175 0.00% 75 157 0.00% 76 192 0.00% 77 189 0.00% 78 209 0.00% 79 237 0.00% 80 207 0.00% 81 265 0.00% 82 245 0.00% 83 253 0.00% 84 300 0.00% 85 304 0.00% 86 305 0.00% 87 291 0.00% 88 319 0.00% 89 321 0.00% 90 374 0.00% 91 341 0.00% 92 359 0.00% 93 406 0.00% 94 419 0.00% 95 476 0.00% 96 477 0.00% 97 509 0.00% 98 536 0.00% 99 610 0.00% 100 681 0.00% 101 675 0.00% 102 736 0.00% 103 757 0.00% 104 763 0.00% 105 879 0.00% 106 885 0.00% 107 915 0.00% 108 928 0.00% 109 1007 0.00% 110 1064 0.00% 111 1181 0.01% 112 1148 0.00% 113 1321 0.01% 114 1427 0.01% 115 1528 0.01% 116 1552 0.01% 117 1637 0.01% 118 1800 0.01% 119 1921 0.01% 120 1922 0.01% 121 2049 0.01% 122 2121 0.01% 123 2346 0.01% 124 2487 0.01% 125 2563 0.01% 126 2729 0.01% 127 2779 0.01% 128 2967 0.01% 129 3095 0.01% 130 3172 0.01% 131 3416 0.01% 132 3523 0.02% 133 3648 0.02% 134 3741 0.02% 135 3934 0.02% 136 4154 0.02% 137 4344 0.02% 138 4429 0.02% 139 4737 0.02% 140 4915 0.02% 141 5099 0.02% 142 5544 0.02% 143 5724 0.02% 144 5988 0.03% 145 6543 0.03% 146 7244 0.03% 147 10378 0.04% 148 27452 0.12% 149 323710 1.38% 150 22936135 97.86% 23438295 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=33 prefix-density=0.68 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=89.64 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=20.6 sequence=CAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGT criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.91 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=112.00 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=9.5 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639581 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:06:02 Started mapping on | Feb 14 11:06:02 Finished on | Feb 14 11:08:58 Mapping speed, Million of reads per hour | 479.42 Number of input reads | 23438295 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21213264 Uniquely mapped reads % | 90.51% Average mapped length | 297.26 Number of splices: Total | 22327011 Number of splices: Annotated (sjdb) | 21793044 Number of splices: GT/AG | 21919752 Number of splices: GC/AG | 322798 Number of splices: AT/AC | 17046 Number of splices: Non-canonical | 67415 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.03% Deletion average length | 3.17 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484563 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 19204 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.29% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1740468 1740468 1740468 N_multimapping 484563 484563 484563 N_noFeature 683716 20905572 739502 N_ambiguous 387843 1122 135552 UnstrandedReadsAssigned:20141705 PositiveStrandReadsAssigned:306570 NegativeStrandReadsAssigned:20338210 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639581 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639581-trimmed-pair1.fastq SRR14639581-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,438,295 reads, 20,766,080 reads pseudoaligned [quant] estimated average fragment length: 358.607 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52401 SRR14639581.ke.tsv 34699 SRR14639581.se.tsv 87100 total ==> SRR14639581.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1660.39 1240.5 28.2022 Potri.005G024800.1.v4.1 1035 677.393 480 26.7483 Potri.004G059700.1.v4.1 961 604.006 91 5.68717 Potri.007G009000.2.v4.1 1416 1058.39 0 0 Potri.003G141000.2.v4.1 2943 2585.39 1954.06 28.5304 Potri.016G087400.1.v4.1 270 50.1868 1704.53 1282.07 Potri.015G069301.1.v4.1 564 237.628 0 0 Potri.010G195200.1.v4.1 1773 1415.39 245 6.53409 Potri.012G127500.1.v4.1 977 619.706 66 4.02026 ==> SRR14639581.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 215 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 252 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 103 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 10 SRR14639581 completed mapping pipeline successfully