Starting /dee2/code/volunteer_pipeline.sh SRR14639582 current disk space = 3115976704000 free memory = 1496059464 SRR14639582 SRAfilesize 1ac4e3479ff0e17388b8dc970b18d230 SRR14639582.sra SRR14639582.sra file validated SRR14639582 is paired end SRR14639582 is conventional basespace SRR14639582 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639582_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5875 32.0 32.0 32.0 32.0 32.0 2 31.4375 32.0 32.0 32.0 32.0 32.0 3 35.1225 37.0 32.0 37.0 32.0 37.0 4 36.205 37.0 37.0 37.0 32.0 37.0 5 36.18375 37.0 37.0 37.0 37.0 37.0 6 39.75875 41.0 41.0 41.0 37.0 41.0 7 39.81825 41.0 41.0 41.0 37.0 41.0 8 39.99275 41.0 41.0 41.0 37.0 41.0 9 40.0845 41.0 41.0 41.0 37.0 41.0 10-14 40.1942 41.0 41.0 41.0 37.8 41.0 15-19 40.2216 41.0 41.0 41.0 37.8 41.0 20-24 40.233450000000005 41.0 41.0 41.0 39.4 41.0 25-29 40.21995 41.0 41.0 41.0 40.2 41.0 30-34 40.12445 41.0 41.0 41.0 37.8 41.0 35-39 40.0744 41.0 41.0 41.0 37.0 41.0 40-44 40.047250000000005 41.0 41.0 41.0 37.0 41.0 45-49 40.0663 41.0 41.0 41.0 37.0 41.0 50-54 39.94305 41.0 41.0 41.0 37.0 41.0 55-59 39.901500000000006 41.0 41.0 41.0 37.0 41.0 60-64 39.87485 41.0 41.0 41.0 37.0 41.0 65-69 39.7498 41.0 41.0 41.0 37.0 41.0 70-74 39.61555 41.0 41.0 41.0 37.0 41.0 75-79 39.1752 41.0 40.2 41.0 36.0 41.0 80-84 39.6789 41.0 41.0 41.0 37.0 41.0 85-89 39.673100000000005 41.0 41.0 41.0 37.0 41.0 90-94 39.57145 41.0 41.0 41.0 37.0 41.0 95-99 39.4774 41.0 41.0 41.0 37.0 41.0 100-104 39.45115 41.0 41.0 41.0 37.0 41.0 105-109 39.3457 41.0 41.0 41.0 37.0 41.0 110-114 39.30915 41.0 41.0 41.0 37.0 41.0 115-119 39.217650000000006 41.0 41.0 41.0 37.0 41.0 120-124 39.22985 41.0 41.0 41.0 37.0 41.0 125-129 39.229 41.0 41.0 41.0 37.0 41.0 130-134 38.96015 41.0 41.0 41.0 34.0 41.0 135-139 38.68265 41.0 41.0 41.0 32.0 41.0 140-144 38.48125 41.0 39.4 41.0 32.0 41.0 145-149 38.2198 41.0 37.0 41.0 32.0 41.0 150 38.152 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 0.0 25 2.0 26 6.0 27 9.0 28 11.0 29 13.0 30 36.0 31 32.0 32 34.0 33 53.0 34 57.0 35 98.0 36 93.0 37 178.0 38 255.0 39 534.0 40 2585.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.15 14.274999999999999 11.924999999999999 35.65 2 16.375 13.575000000000001 40.0 30.049999999999997 3 16.45 20.3 28.825 34.425 4 20.75 28.925 24.85 25.474999999999998 5 22.725 32.5 25.3 19.475 6 16.925 33.35 28.849999999999998 20.875 7 14.149999999999999 28.499999999999996 38.824999999999996 18.525 8 14.05 23.5 38.625 23.825 9 14.625 25.45 35.925000000000004 24.0 10-14 18.84 29.085 28.28 23.794999999999998 15-19 18.865000000000002 27.935 29.044999999999998 24.154999999999998 20-24 18.905 27.845 29.23 24.02 25-29 19.045 28.595 29.110000000000003 23.25 30-34 19.02 28.48 28.610000000000003 23.89 35-39 19.81 28.395 27.810000000000002 23.985 40-44 19.915 28.675 28.49 22.919999999999998 45-49 18.935 28.395 28.144999999999996 24.525 50-54 19.615 28.689999999999998 28.439999999999998 23.255 55-59 19.08 28.910000000000004 28.04 23.97 60-64 19.36 28.439999999999998 28.225 23.974999999999998 65-69 19.59 27.96 28.095 24.355 70-74 18.96 28.59 28.325 24.125 75-79 19.2 27.939999999999998 29.03 23.830000000000002 80-84 18.765 28.499999999999996 28.595 24.14 85-89 18.815 28.58 28.515 24.09 90-94 18.98 28.875 28.125 24.02 95-99 19.634999999999998 28.410000000000004 27.644999999999996 24.310000000000002 100-104 19.475 28.64 28.13 23.755000000000003 105-109 19.400000000000002 28.410000000000004 28.625 23.565 110-114 19.07 27.725 28.835 24.37 115-119 19.89 28.28 28.12 23.71 120-124 19.470000000000002 28.244999999999997 28.544999999999998 23.74 125-129 19.735 28.310000000000002 28.23 23.724999999999998 130-134 19.634999999999998 28.095 28.410000000000004 23.86 135-139 20.515 27.67 28.375 23.44 140-144 19.2059602980149 28.241412070603527 28.351417570878546 24.201210060503026 145-149 20.025000000000002 27.985 27.779999999999998 24.21 150 20.549999999999997 27.05 27.425 24.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 1.5 24 3.5 25 6.5 26 5.5 27 7.5 28 13.0 29 15.5 30 21.0 31 31.5 32 45.5 33 57.5 34 70.5 35 78.5 36 99.5 37 120.0 38 137.5 39 180.5 40 208.5 41 241.0 42 262.5 43 285.5 44 288.0 45 267.0 46 263.5 47 235.5 48 200.0 49 180.0 50 161.0 51 120.5 52 82.5 53 74.0 54 65.0 55 44.5 56 33.0 57 25.5 58 23.5 59 15.0 60 6.5 61 5.0 62 3.0 63 2.0 64 2.5 65 1.5 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.69999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.85216473072862 89.825 2 4.7518479408658925 9.0 3 0.34318901795142553 0.975 4 0.05279831045406547 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.075 0.0 0.0 0.0 0.0 122-123 0.075 0.0 0.0 0.0 0.0 124-125 0.075 0.0 0.0 0.0 0.0 126-127 0.1125 0.0 0.0 0.0 0.0 128-129 0.1375 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.21250000000000002 0.0 0.0 0.0 0.0 136-137 0.2375 0.0 0.0 0.0 0.0 138 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639582 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639582_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.90625 32.0 32.0 32.0 32.0 32.0 2 30.93125 32.0 32.0 32.0 32.0 32.0 3 34.1625 37.0 32.0 37.0 32.0 37.0 4 35.015 37.0 37.0 37.0 32.0 37.0 5 35.21875 37.0 37.0 37.0 32.0 37.0 6 38.572 41.0 41.0 41.0 32.0 41.0 7 38.45225 41.0 41.0 41.0 32.0 41.0 8 38.499 41.0 41.0 41.0 32.0 41.0 9 38.7915 41.0 41.0 41.0 37.0 41.0 10-14 38.671049999999994 41.0 41.0 41.0 32.0 41.0 15-19 38.41785 41.0 41.0 41.0 32.0 41.0 20-24 38.30800000000001 41.0 41.0 41.0 32.0 41.0 25-29 38.0099 41.0 39.4 41.0 30.0 41.0 30-34 37.790299999999995 41.0 37.0 41.0 27.0 41.0 35-39 37.77290000000001 41.0 37.0 41.0 27.0 41.0 40-44 37.498400000000004 41.0 37.0 41.0 27.0 41.0 45-49 37.479499999999994 41.0 37.0 41.0 27.0 41.0 50-54 37.30525 41.0 37.0 41.0 27.0 41.0 55-59 37.3144 41.0 37.0 41.0 27.0 41.0 60-64 37.2505 41.0 37.0 41.0 27.0 41.0 65-69 36.99785000000001 41.0 37.0 41.0 27.0 41.0 70-74 36.67355 41.0 37.0 41.0 24.0 41.0 75-79 35.909150000000004 40.2 35.0 41.0 22.0 41.0 80-84 36.87220000000001 41.0 37.0 41.0 22.0 41.0 85-89 36.85145 41.0 37.0 41.0 23.0 41.0 90-94 36.634100000000004 41.0 37.0 41.0 22.0 41.0 95-99 36.80105 41.0 37.0 41.0 22.0 41.0 100-104 36.49045 41.0 37.0 41.0 22.0 41.0 105-109 36.44585 41.0 37.0 41.0 22.0 41.0 110-114 36.51905 41.0 37.0 41.0 22.0 41.0 115-119 36.19284999999999 41.0 36.0 41.0 22.0 41.0 120-124 36.135000000000005 41.0 37.0 41.0 22.0 41.0 125-129 35.6455 41.0 36.0 41.0 20.0 41.0 130-134 35.61055 41.0 35.0 41.0 22.0 41.0 135-139 35.097849999999994 41.0 34.0 41.0 18.0 41.0 140-144 34.8801 41.0 32.0 41.0 16.0 41.0 145-149 34.7039 40.2 32.0 41.0 12.0 41.0 150 34.4085 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 5.0 16 11.0 17 13.0 18 21.0 19 29.0 20 22.0 21 31.0 22 25.0 23 39.0 24 39.0 25 34.0 26 45.0 27 51.0 28 44.0 29 71.0 30 97.0 31 79.0 32 105.0 33 117.0 34 123.0 35 145.0 36 204.0 37 271.0 38 321.0 39 537.0 40 1521.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.65162907268171 26.81704260651629 9.548872180451127 22.982456140350877 2 20.424999999999997 27.800000000000004 36.5 15.275 3 16.85 27.425 35.55 20.175 4 22.3 34.525 24.425 18.75 5 23.549999999999997 36.95 23.775 15.725 6 17.224999999999998 37.625 26.075 19.075 7 20.3 24.575 35.3 19.825 8 16.775000000000002 25.775 31.45 26.0 9 19.15 27.025 30.775000000000002 23.05 10-14 22.03 28.715000000000003 27.505000000000003 21.75 15-19 22.470000000000002 28.050000000000004 27.705000000000002 21.775 20-24 21.67 28.895 27.994999999999997 21.44 25-29 22.285 28.560000000000002 28.720000000000002 20.435 30-34 22.08 27.775 28.285 21.86 35-39 21.7 28.315 28.575 21.41 40-44 22.12 28.265 28.42 21.195 45-49 22.82 28.175 28.105000000000004 20.9 50-54 22.555 28.43 28.015 21.0 55-59 22.21 28.58 28.035 21.175 60-64 22.405 27.894999999999996 28.645 21.055 65-69 22.865 27.810000000000002 27.965 21.36 70-74 23.29 28.1 27.375 21.235 75-79 22.564999999999998 28.455000000000002 27.955000000000002 21.025 80-84 22.745 28.005000000000003 27.625 21.625 85-89 22.965 27.950000000000003 28.194999999999997 20.89 90-94 23.064999999999998 28.015 27.71 21.21 95-99 23.365 27.889999999999997 27.525 21.22 100-104 22.6 28.12 27.155 22.125 105-109 22.575 27.884999999999998 28.1 21.44 110-114 22.755 27.715 28.555000000000003 20.974999999999998 115-119 23.145 27.575 28.205000000000002 21.075 120-124 22.755 27.889999999999997 28.084999999999997 21.27 125-129 23.165 27.689999999999998 28.050000000000004 21.095 130-134 23.13 28.125 27.584999999999997 21.16 135-139 23.035 27.87 27.965 21.13 140-144 22.875 27.785 28.225 21.115000000000002 145-149 23.189999999999998 28.705000000000002 27.27 20.835 150 24.175 28.275 26.950000000000003 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.0 19 0.0 20 0.5 21 1.0 22 3.5 23 5.5 24 4.0 25 3.5 26 7.5 27 10.0 28 10.0 29 10.5 30 17.0 31 29.0 32 36.5 33 46.0 34 64.5 35 84.5 36 96.5 37 110.5 38 137.5 39 183.5 40 215.5 41 234.5 42 256.5 43 267.0 44 268.5 45 270.5 46 274.5 47 247.5 48 198.0 49 173.5 50 146.5 51 112.5 52 101.5 53 83.5 54 64.0 55 55.0 56 37.5 57 27.5 58 25.5 59 16.5 60 14.0 61 13.0 62 9.5 63 6.0 64 4.0 65 2.5 66 0.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.43067226890757 90.85 2 4.1228991596638656 7.85 3 0.42016806722689076 1.2 4 0.026260504201680673 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.075 0.0 0.0 0.0 0.0 122-123 0.075 0.0 0.0 0.0 0.0 124-125 0.075 0.0 0.0 0.0 0.0 126-127 0.0875 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.2375 0.0 0.0 0.0 0.0 136-137 0.2625 0.0 0.0 0.0 0.0 138 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183667 spots for SRR14639582.sra Written 1183667 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra Read 1183648 spots for SRR14639582.sra Written 1183648 spots for SRR14639582.sra SRR ids: ['SRR14639582.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nxvlwf1o SRR14639582.sra spots: 23672979 blocks: [[1, 1183648], [1183649, 2367296], [2367297, 3550944], [3550945, 4734592], [4734593, 5918240], [5918241, 7101888], [7101889, 8285536], [8285537, 9469184], [9469185, 10652832], [10652833, 11836480], [11836481, 13020128], [13020129, 14203776], [14203777, 15387424], [15387425, 16571072], [16571073, 17754720], [17754721, 18938368], [18938369, 20122016], [20122017, 21305664], [21305665, 22489312], [22489313, 23672979]] SRR14639582 file size 8763301 SRR14639582 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639582 SRR14639582_1.fastq SRR14639582_2.fastq Input file: SRR14639582_1.fastq Paired file: SRR14639582_2.fastq trimmed: SRR14639582-trimmed-pair1.fastq, SRR14639582-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:09:56 2025 >> started Fri Feb 14 10:10:31 2025 >> done (34.804s) 23672979 read pairs processed; of these: 120 ( 0.00%) short read pairs filtered out after trimming by size control 359 ( 0.00%) empty read pairs filtered out after trimming by size control 23672500 (100.00%) read pairs available; of these: 462845 ( 1.96%) trimmed read pairs available after processing 23209655 (98.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 22 0.00% 20 20 0.00% 21 26 0.00% 22 32 0.00% 23 18 0.00% 24 24 0.00% 25 30 0.00% 26 21 0.00% 27 38 0.00% 28 36 0.00% 29 44 0.00% 30 39 0.00% 31 33 0.00% 32 44 0.00% 33 52 0.00% 34 44 0.00% 35 55 0.00% 36 46 0.00% 37 53 0.00% 38 70 0.00% 39 51 0.00% 40 57 0.00% 41 65 0.00% 42 65 0.00% 43 59 0.00% 44 57 0.00% 45 69 0.00% 46 83 0.00% 47 65 0.00% 48 81 0.00% 49 89 0.00% 50 92 0.00% 51 98 0.00% 52 106 0.00% 53 78 0.00% 54 94 0.00% 55 104 0.00% 56 106 0.00% 57 117 0.00% 58 112 0.00% 59 111 0.00% 60 113 0.00% 61 110 0.00% 62 141 0.00% 63 102 0.00% 64 121 0.00% 65 130 0.00% 66 138 0.00% 67 140 0.00% 68 132 0.00% 69 160 0.00% 70 169 0.00% 71 152 0.00% 72 166 0.00% 73 190 0.00% 74 176 0.00% 75 214 0.00% 76 199 0.00% 77 196 0.00% 78 222 0.00% 79 225 0.00% 80 241 0.00% 81 253 0.00% 82 294 0.00% 83 290 0.00% 84 290 0.00% 85 327 0.00% 86 298 0.00% 87 306 0.00% 88 358 0.00% 89 368 0.00% 90 371 0.00% 91 376 0.00% 92 425 0.00% 93 475 0.00% 94 471 0.00% 95 485 0.00% 96 522 0.00% 97 536 0.00% 98 632 0.00% 99 609 0.00% 100 662 0.00% 101 662 0.00% 102 689 0.00% 103 715 0.00% 104 823 0.00% 105 790 0.00% 106 903 0.00% 107 968 0.00% 108 901 0.00% 109 1091 0.00% 110 1131 0.00% 111 1152 0.00% 112 1169 0.00% 113 1248 0.01% 114 1348 0.01% 115 1387 0.01% 116 1481 0.01% 117 1594 0.01% 118 1742 0.01% 119 1737 0.01% 120 1895 0.01% 121 2060 0.01% 122 2110 0.01% 123 2309 0.01% 124 2327 0.01% 125 2352 0.01% 126 2469 0.01% 127 2713 0.01% 128 2919 0.01% 129 2910 0.01% 130 3070 0.01% 131 3209 0.01% 132 3317 0.01% 133 3442 0.01% 134 3521 0.01% 135 3785 0.02% 136 3952 0.02% 137 4162 0.02% 138 4404 0.02% 139 4534 0.02% 140 4576 0.02% 141 4896 0.02% 142 5111 0.02% 143 5342 0.02% 144 5655 0.02% 145 5807 0.02% 146 6673 0.03% 147 8998 0.04% 148 23222 0.10% 149 295268 1.25% 150 23209655 98.04% 23672500 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=18.74 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=6.1 sequence=CCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=35 prefix-density=0.86 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=132.33 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.8 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR14639582 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:11:27 Started mapping on | Feb 14 10:11:28 Finished on | Feb 14 10:15:18 Mapping speed, Million of reads per hour | 370.53 Number of input reads | 23672500 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21968089 Uniquely mapped reads % | 92.80% Average mapped length | 297.38 Number of splices: Total | 23160716 Number of splices: Annotated (sjdb) | 22617824 Number of splices: GT/AG | 22735130 Number of splices: GC/AG | 341824 Number of splices: AT/AC | 17190 Number of splices: Non-canonical | 66572 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.02% Deletion average length | 3.15 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471847 % of reads mapped to multiple loci | 1.99% Number of reads mapped to too many loci | 22809 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.06% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1232564 1232564 1232564 N_multimapping 471847 471847 471847 N_noFeature 703094 21649612 760979 N_ambiguous 389114 1228 128079 UnstrandedReadsAssigned:20875881 PositiveStrandReadsAssigned:317249 NegativeStrandReadsAssigned:21079031 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639582 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639582-trimmed-pair1.fastq SRR14639582-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,672,500 reads, 21,319,827 reads pseudoaligned [quant] estimated average fragment length: 368.006 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR14639582.ke.tsv 34699 SRR14639582.se.tsv 87100 total ==> SRR14639582.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1650.99 1059 24.4703 Potri.005G024800.1.v4.1 1035 667.994 401 22.9013 Potri.004G059700.1.v4.1 961 594.608 68 4.36281 Potri.007G009000.2.v4.1 1416 1048.99 0 0 Potri.003G141000.2.v4.1 2943 2575.99 1783.53 26.4134 Potri.016G087400.1.v4.1 270 49.3457 1335 1032.1 Potri.015G069301.1.v4.1 564 231.375 0 0 Potri.010G195200.1.v4.1 1773 1405.99 159 4.31422 Potri.012G127500.1.v4.1 977 610.329 73 4.56297 ==> SRR14639582.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 191 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 47 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 12 SRR14639582 completed mapping pipeline successfully