Starting /dee2/code/volunteer_pipeline.sh SRR14639583 current disk space = 3115106668544 free memory = 1566545620 SRR14639583 SRAfilesize fb012384a8f0d74fd8a4fe490f756614 SRR14639583.sra SRR14639583.sra file validated SRR14639583 is paired end SRR14639583 is conventional basespace SRR14639583 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639583_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.62125 32.0 32.0 32.0 32.0 32.0 2 31.51375 32.0 32.0 32.0 32.0 32.0 3 35.23625 37.0 32.0 37.0 32.0 37.0 4 36.255 37.0 37.0 37.0 37.0 37.0 5 36.33875 37.0 37.0 37.0 37.0 37.0 6 39.91325 41.0 41.0 41.0 37.0 41.0 7 40.00925 41.0 41.0 41.0 37.0 41.0 8 40.21825 41.0 41.0 41.0 37.0 41.0 9 40.2455 41.0 41.0 41.0 37.0 41.0 10-14 40.2822 41.0 41.0 41.0 41.0 41.0 15-19 40.353449999999995 41.0 41.0 41.0 41.0 41.0 20-24 40.29944999999999 41.0 41.0 41.0 41.0 41.0 25-29 40.251200000000004 41.0 41.0 41.0 41.0 41.0 30-34 40.25545 41.0 41.0 41.0 41.0 41.0 35-39 40.1323 41.0 41.0 41.0 38.6 41.0 40-44 40.11215 41.0 41.0 41.0 38.6 41.0 45-49 40.07565 41.0 41.0 41.0 37.0 41.0 50-54 40.0338 41.0 41.0 41.0 37.0 41.0 55-59 39.95335 41.0 41.0 41.0 37.0 41.0 60-64 39.955200000000005 41.0 41.0 41.0 37.0 41.0 65-69 39.8746 41.0 41.0 41.0 37.0 41.0 70-74 39.6542 41.0 41.0 41.0 37.0 41.0 75-79 39.242200000000004 41.0 40.2 41.0 36.0 41.0 80-84 39.6836 41.0 41.0 41.0 37.0 41.0 85-89 39.70825 41.0 41.0 41.0 37.0 41.0 90-94 39.7105 41.0 41.0 41.0 37.0 41.0 95-99 39.61865 41.0 41.0 41.0 37.0 41.0 100-104 39.47195000000001 41.0 41.0 41.0 37.0 41.0 105-109 39.4205 41.0 41.0 41.0 37.0 41.0 110-114 39.356 41.0 41.0 41.0 37.0 41.0 115-119 39.33515 41.0 41.0 41.0 37.0 41.0 120-124 39.2898 41.0 41.0 41.0 37.0 41.0 125-129 39.37055 41.0 41.0 41.0 37.0 41.0 130-134 39.0307 41.0 41.0 41.0 35.0 41.0 135-139 38.8532 41.0 41.0 41.0 32.0 41.0 140-144 38.6121 41.0 41.0 41.0 32.0 41.0 145-149 38.38395 41.0 37.0 41.0 32.0 41.0 150 38.2075 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 3.0 24 4.0 25 5.0 26 7.0 27 7.0 28 9.0 29 14.0 30 21.0 31 28.0 32 44.0 33 53.0 34 57.0 35 90.0 36 98.0 37 122.0 38 238.0 39 479.0 40 2718.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.875 13.8 9.1 41.225 2 15.975 12.375 40.275 31.374999999999996 3 16.05 18.125 29.4 36.425000000000004 4 20.974999999999998 24.349999999999998 25.775 28.9 5 22.35 32.05 25.224999999999998 20.375 6 17.299999999999997 33.425 28.050000000000004 21.224999999999998 7 15.174999999999999 27.85 39.35 17.625 8 14.499999999999998 25.924999999999997 35.775 23.799999999999997 9 15.55 24.275 35.675000000000004 24.5 10-14 18.595 29.325000000000003 28.810000000000002 23.27 15-19 18.709999999999997 27.725 28.99 24.575 20-24 18.83 29.03 28.065 24.075 25-29 19.245 28.470000000000002 28.749999999999996 23.535 30-34 18.325 29.09 28.470000000000002 24.115000000000002 35-39 18.990000000000002 28.28 28.365000000000002 24.365000000000002 40-44 19.095000000000002 29.115000000000002 28.565 23.225 45-49 18.615000000000002 28.88 28.139999999999997 24.365000000000002 50-54 19.165 28.9 27.894999999999996 24.04 55-59 18.955 28.494999999999997 28.525 24.025 60-64 19.035 28.449999999999996 28.57 23.945 65-69 19.0 27.955000000000002 28.985 24.060000000000002 70-74 19.34 28.78 28.645 23.235 75-79 19.11 27.900000000000002 28.854999999999997 24.135 80-84 19.259999999999998 28.16 28.625 23.955000000000002 85-89 19.525000000000002 28.705000000000002 28.194999999999997 23.575 90-94 19.29 27.97 28.22 24.52 95-99 19.275000000000002 28.74 27.975 24.01 100-104 19.125 28.665000000000003 28.475 23.735 105-109 19.61 28.265 28.294999999999998 23.830000000000002 110-114 19.91 27.725 28.875 23.49 115-119 19.725 28.115000000000002 28.34 23.82 120-124 19.59 27.82 28.415000000000003 24.175 125-129 20.169999999999998 27.605 28.235 23.990000000000002 130-134 19.54 28.26 28.165000000000003 24.035 135-139 19.12 28.194999999999997 28.194999999999997 24.490000000000002 140-144 20.125031257814456 27.871967991997998 28.077019254813703 23.925981495373843 145-149 19.830000000000002 28.07 28.310000000000002 23.79 150 20.625 26.150000000000002 28.1 25.124999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.0 24 2.5 25 3.0 26 4.0 27 8.0 28 10.5 29 10.0 30 15.5 31 20.5 32 32.0 33 46.5 34 59.5 35 77.5 36 96.5 37 132.0 38 175.0 39 193.0 40 212.5 41 243.5 42 263.0 43 279.0 44 288.0 45 272.0 46 254.0 47 246.5 48 228.0 49 200.0 50 156.5 51 120.5 52 97.0 53 69.0 54 50.0 55 39.5 56 27.0 57 17.0 58 12.5 59 6.5 60 3.5 61 4.0 62 3.5 63 2.5 64 1.0 65 0.5 66 1.0 67 0.5 68 1.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.60602855631942 89.45 2 5.050237969328398 9.55 3 0.31729243786356426 0.8999999999999999 4 0.026441036488630353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0125 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0125 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.025 0.0 0.0 0.025 0.0 96-97 0.025 0.0 0.0 0.025 0.0 98-99 0.037500000000000006 0.0 0.0 0.025 0.0 100-101 0.075 0.0 0.0 0.025 0.0 102-103 0.075 0.0 0.0 0.025 0.0 104-105 0.1125 0.0 0.0 0.025 0.0 106-107 0.175 0.0 0.0 0.025 0.0 108-109 0.21250000000000002 0.0 0.0 0.025 0.0 110-111 0.25 0.0 0.0 0.025 0.0 112-113 0.325 0.0 0.0 0.025 0.0 114-115 0.375 0.0 0.0 0.025 0.0 116-117 0.44999999999999996 0.0 0.0 0.025 0.0 118-119 0.5 0.0 0.0 0.025 0.0 120-121 0.525 0.0 0.0 0.025 0.0 122-123 0.5875 0.0 0.0 0.025 0.0 124-125 0.65 0.0 0.0 0.025 0.0 126-127 0.6875 0.0 0.0 0.025 0.0 128-129 0.725 0.0 0.0 0.025 0.0 130-131 0.8 0.0 0.0 0.025 0.0 132-133 0.8625 0.0 0.0 0.025 0.0 134-135 1.0750000000000002 0.0 0.0 0.025 0.0 136-137 1.1625 0.0 0.0 0.025 0.0 138 1.3 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTCT 10 0.006973645 144.0 3 >>END_MODULE SRR14639583 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639583_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9625 32.0 32.0 32.0 32.0 32.0 2 31.02875 32.0 32.0 32.0 32.0 32.0 3 34.4775 37.0 32.0 37.0 32.0 37.0 4 35.3675 37.0 37.0 37.0 32.0 37.0 5 35.45125 37.0 37.0 37.0 32.0 37.0 6 38.696 41.0 41.0 41.0 32.0 41.0 7 38.5175 41.0 41.0 41.0 32.0 41.0 8 38.667 41.0 41.0 41.0 32.0 41.0 9 38.7095 41.0 41.0 41.0 37.0 41.0 10-14 38.83405 41.0 41.0 41.0 36.0 41.0 15-19 38.583299999999994 41.0 41.0 41.0 32.0 41.0 20-24 38.48945 41.0 41.0 41.0 32.0 41.0 25-29 38.100649999999995 41.0 40.2 41.0 31.0 41.0 30-34 38.09765 41.0 40.2 41.0 31.0 41.0 35-39 37.9316 41.0 37.8 41.0 28.0 41.0 40-44 37.83 41.0 37.0 41.0 27.0 41.0 45-49 37.7495 41.0 37.0 41.0 27.0 41.0 50-54 37.6069 41.0 37.0 41.0 27.0 41.0 55-59 37.5402 41.0 37.0 41.0 27.0 41.0 60-64 37.4918 41.0 37.0 41.0 27.0 41.0 65-69 37.2576 41.0 37.0 41.0 27.0 41.0 70-74 37.08755 41.0 37.0 41.0 26.0 41.0 75-79 36.31785 40.2 36.0 41.0 23.0 41.0 80-84 37.16635 41.0 37.0 41.0 26.0 41.0 85-89 37.36355 41.0 37.0 41.0 27.0 41.0 90-94 36.9343 41.0 37.0 41.0 23.0 41.0 95-99 37.0511 41.0 37.0 41.0 23.0 41.0 100-104 36.78445000000001 41.0 37.0 41.0 23.0 41.0 105-109 36.6941 41.0 37.0 41.0 22.0 41.0 110-114 36.7732 41.0 37.0 41.0 22.0 41.0 115-119 36.45115 41.0 37.0 41.0 22.0 41.0 120-124 36.5773 41.0 37.0 41.0 22.0 41.0 125-129 36.07445 41.0 36.0 41.0 22.0 41.0 130-134 36.141999999999996 41.0 37.0 41.0 22.0 41.0 135-139 35.7372 41.0 35.0 41.0 20.0 41.0 140-144 35.5089 41.0 35.0 41.0 20.0 41.0 145-149 35.2886 41.0 36.0 41.0 20.0 41.0 150 34.751 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 8.0 17 13.0 18 23.0 19 17.0 20 27.0 21 20.0 22 38.0 23 28.0 24 39.0 25 40.0 26 47.0 27 51.0 28 52.0 29 56.0 30 63.0 31 89.0 32 93.0 33 92.0 34 112.0 35 142.0 36 188.0 37 194.0 38 317.0 39 546.0 40 1701.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.172344689378754 29.183366733466933 8.592184368737476 26.052104208416832 2 21.099999999999998 29.049999999999997 34.525 15.325 3 17.175 28.999999999999996 33.925 19.900000000000002 4 21.7 34.150000000000006 24.175 19.975 5 24.85 37.1 22.15 15.9 6 18.625 37.45 24.775 19.15 7 19.900000000000002 23.5 36.425000000000004 20.175 8 16.775000000000002 24.95 32.2 26.075 9 19.8 25.05 31.275 23.875 10-14 21.475 29.330000000000002 27.63 21.565 15-19 22.07 28.285 28.28 21.365000000000002 20-24 22.82 28.804999999999996 27.884999999999998 20.49 25-29 22.555 28.185 28.15 21.11 30-34 22.495 27.92 28.74 20.845 35-39 22.564999999999998 27.794999999999998 28.51 21.13 40-44 22.31 28.985 28.199999999999996 20.505000000000003 45-49 22.495 27.950000000000003 28.46 21.095 50-54 22.25 28.060000000000002 29.09 20.599999999999998 55-59 22.49 28.494999999999997 28.27 20.745 60-64 22.564999999999998 28.075 28.22 21.14 65-69 22.82 28.67 27.43 21.08 70-74 23.875 28.27 27.415 20.44 75-79 23.345 27.655 27.279999999999998 21.72 80-84 23.474999999999998 27.450000000000003 28.16 20.915 85-89 23.43 28.705000000000002 27.325 20.54 90-94 22.775000000000002 27.839999999999996 28.105000000000004 21.279999999999998 95-99 23.1 28.15 27.32 21.43 100-104 23.51 28.22 27.750000000000004 20.52 105-109 22.855 28.005000000000003 28.64 20.5 110-114 23.375 28.384999999999998 27.915 20.325 115-119 23.43 28.565 27.750000000000004 20.255000000000003 120-124 23.325000000000003 28.7 28.08 19.895 125-129 22.814999999999998 28.26 27.794999999999998 21.13 130-134 23.635 27.72 28.389999999999997 20.255000000000003 135-139 23.355 28.395 27.750000000000004 20.5 140-144 23.615 28.455000000000002 27.445000000000004 20.485 145-149 23.625 28.189999999999998 27.275 20.91 150 23.549999999999997 28.999999999999996 27.675 19.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 1.0 22 3.5 23 4.0 24 2.5 25 3.5 26 5.5 27 6.0 28 9.0 29 12.0 30 14.0 31 23.5 32 41.0 33 50.0 34 51.0 35 69.5 36 91.5 37 121.0 38 152.5 39 177.0 40 204.0 41 222.0 42 243.0 43 279.5 44 295.0 45 303.5 46 291.5 47 238.5 48 191.5 49 176.5 50 154.5 51 119.5 52 102.0 53 79.0 54 61.0 55 49.0 56 35.5 57 24.0 58 23.5 59 20.5 60 12.5 61 6.5 62 6.0 63 5.0 64 2.0 65 2.0 66 0.5 67 1.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.02893214097843 90.325 2 4.734350341925302 9.0 3 0.23671751709626512 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.48750000000000004 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.9624999999999999 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141500 spots for SRR14639583.sra Written 1141500 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra Read 1141492 spots for SRR14639583.sra Written 1141492 spots for SRR14639583.sra SRR ids: ['SRR14639583.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_93y4voh1 SRR14639583.sra spots: 22829848 blocks: [[1, 1141492], [1141493, 2282984], [2282985, 3424476], [3424477, 4565968], [4565969, 5707460], [5707461, 6848952], [6848953, 7990444], [7990445, 9131936], [9131937, 10273428], [10273429, 11414920], [11414921, 12556412], [12556413, 13697904], [13697905, 14839396], [14839397, 15980888], [15980889, 17122380], [17122381, 18263872], [18263873, 19405364], [19405365, 20546856], [20546857, 21688348], [21688349, 22829848]] SRR14639583 file size 8450782 SRR14639583 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639583 SRR14639583_1.fastq SRR14639583_2.fastq Input file: SRR14639583_1.fastq Paired file: SRR14639583_2.fastq trimmed: SRR14639583-trimmed-pair1.fastq, SRR14639583-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:07:51 2025 >> started Fri Feb 14 11:08:15 2025 >> done (24.712s) 22829848 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 213 ( 0.00%) empty read pairs filtered out after trimming by size control 22829510 (100.00%) read pairs available; of these: 871515 ( 3.82%) trimmed read pairs available after processing 21957995 (96.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 21 0.00% 20 17 0.00% 21 23 0.00% 22 28 0.00% 23 43 0.00% 24 24 0.00% 25 32 0.00% 26 24 0.00% 27 36 0.00% 28 38 0.00% 29 32 0.00% 30 22 0.00% 31 38 0.00% 32 40 0.00% 33 44 0.00% 34 40 0.00% 35 45 0.00% 36 48 0.00% 37 57 0.00% 38 57 0.00% 39 56 0.00% 40 60 0.00% 41 55 0.00% 42 68 0.00% 43 71 0.00% 44 63 0.00% 45 71 0.00% 46 72 0.00% 47 80 0.00% 48 83 0.00% 49 84 0.00% 50 90 0.00% 51 102 0.00% 52 96 0.00% 53 80 0.00% 54 93 0.00% 55 115 0.00% 56 129 0.00% 57 110 0.00% 58 143 0.00% 59 138 0.00% 60 176 0.00% 61 179 0.00% 62 191 0.00% 63 159 0.00% 64 198 0.00% 65 225 0.00% 66 216 0.00% 67 221 0.00% 68 244 0.00% 69 266 0.00% 70 321 0.00% 71 331 0.00% 72 338 0.00% 73 339 0.00% 74 382 0.00% 75 379 0.00% 76 445 0.00% 77 415 0.00% 78 481 0.00% 79 501 0.00% 80 574 0.00% 81 594 0.00% 82 638 0.00% 83 726 0.00% 84 750 0.00% 85 803 0.00% 86 875 0.00% 87 861 0.00% 88 963 0.00% 89 1021 0.00% 90 1129 0.00% 91 1237 0.01% 92 1326 0.01% 93 1383 0.01% 94 1446 0.01% 95 1556 0.01% 96 1717 0.01% 97 1824 0.01% 98 1971 0.01% 99 2086 0.01% 100 2104 0.01% 101 2288 0.01% 102 2459 0.01% 103 2699 0.01% 104 2872 0.01% 105 3041 0.01% 106 3227 0.01% 107 3600 0.02% 108 3667 0.02% 109 3908 0.02% 110 4234 0.02% 111 4410 0.02% 112 4838 0.02% 113 5127 0.02% 114 5282 0.02% 115 5712 0.03% 116 6095 0.03% 117 6487 0.03% 118 6890 0.03% 119 7130 0.03% 120 7649 0.03% 121 8050 0.04% 122 8527 0.04% 123 9105 0.04% 124 9459 0.04% 125 10102 0.04% 126 10525 0.05% 127 11053 0.05% 128 11669 0.05% 129 12184 0.05% 130 12887 0.06% 131 13168 0.06% 132 13632 0.06% 133 14525 0.06% 134 14656 0.06% 135 15847 0.07% 136 16199 0.07% 137 17406 0.08% 138 17830 0.08% 139 18395 0.08% 140 19332 0.08% 141 20162 0.09% 142 20637 0.09% 143 21548 0.09% 144 22521 0.10% 145 23188 0.10% 146 24499 0.11% 147 27431 0.12% 148 40596 0.18% 149 280584 1.23% 150 21957995 96.18% 22829510 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=37 prefix-density=0.67 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=81.08 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=15.6 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=41 prefix-density=0.96 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=257.19 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=12.3 sequence=TAGGGTTTTAGTAGCCAGACCACATAGTTGAGGATAAACAGGAGATTGTGAAAAAAGAAAGGCAGAAGCAAGTTCAGTAATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR14639583 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:09:28 Started mapping on | Feb 14 11:09:29 Finished on | Feb 14 11:12:20 Mapping speed, Million of reads per hour | 480.62 Number of input reads | 22829510 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20978304 Uniquely mapped reads % | 91.89% Average mapped length | 296.79 Number of splices: Total | 22222345 Number of splices: Annotated (sjdb) | 21684631 Number of splices: GT/AG | 21821612 Number of splices: GC/AG | 318176 Number of splices: AT/AC | 17011 Number of splices: Non-canonical | 65546 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.03% Deletion average length | 3.17 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467033 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 49488 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.77% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1384173 1384173 1384173 N_multimapping 467033 467033 467033 N_noFeature 643349 20683085 701014 N_ambiguous 358894 1119 120866 UnstrandedReadsAssigned:19976061 PositiveStrandReadsAssigned:294100 NegativeStrandReadsAssigned:20156424 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639583 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639583-trimmed-pair1.fastq SRR14639583-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,829,510 reads, 20,434,153 reads pseudoaligned [quant] estimated average fragment length: 335.108 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR14639583.ke.tsv 34699 SRR14639583.se.tsv 87100 total ==> SRR14639583.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1683.89 1047 23.8421 Potri.005G024800.1.v4.1 1035 700.892 461 25.2209 Potri.004G059700.1.v4.1 961 627.503 127 7.76066 Potri.007G009000.2.v4.1 1416 1081.89 0 0 Potri.003G141000.2.v4.1 2943 2608.89 1716 25.2216 Potri.016G087400.1.v4.1 270 65.9392 1856.77 1079.76 Potri.015G069301.1.v4.1 564 264.584 0 0 Potri.010G195200.1.v4.1 1773 1438.89 216.936 5.78115 Potri.012G127500.1.v4.1 977 643.194 36 2.14621 ==> SRR14639583.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 236 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 20 SRR14639583 completed mapping pipeline successfully