Starting /dee2/code/volunteer_pipeline.sh SRR14639584 current disk space = 3116087844864 free memory = 1448166260 SRR14639584 SRAfilesize e8d052290b6aae1665f6cc73a1095ed7 SRR14639584.sra SRR14639584.sra file validated SRR14639584 is paired end SRR14639584 is conventional basespace SRR14639584 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639584_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.74875 32.0 32.0 32.0 32.0 32.0 2 31.56375 32.0 32.0 32.0 32.0 32.0 3 35.1525 37.0 32.0 37.0 32.0 37.0 4 36.11125 37.0 37.0 37.0 32.0 37.0 5 36.35875 37.0 37.0 37.0 37.0 37.0 6 39.91475 41.0 41.0 41.0 37.0 41.0 7 39.7765 41.0 41.0 41.0 37.0 41.0 8 40.19625 41.0 41.0 41.0 37.0 41.0 9 40.19075 41.0 41.0 41.0 37.0 41.0 10-14 40.2315 41.0 41.0 41.0 38.6 41.0 15-19 40.25445 41.0 41.0 41.0 38.6 41.0 20-24 40.23405 41.0 41.0 41.0 37.8 41.0 25-29 40.22635 41.0 41.0 41.0 39.4 41.0 30-34 40.1836 41.0 41.0 41.0 40.2 41.0 35-39 40.11155 41.0 41.0 41.0 37.0 41.0 40-44 40.059999999999995 41.0 41.0 41.0 37.0 41.0 45-49 40.0457 41.0 41.0 41.0 37.0 41.0 50-54 39.95844999999999 41.0 41.0 41.0 37.0 41.0 55-59 39.914 41.0 41.0 41.0 37.0 41.0 60-64 39.850300000000004 41.0 41.0 41.0 37.0 41.0 65-69 39.76175 41.0 41.0 41.0 37.0 41.0 70-74 39.58945 41.0 41.0 41.0 37.0 41.0 75-79 39.134350000000005 41.0 40.2 41.0 36.0 41.0 80-84 39.58895 41.0 41.0 41.0 37.0 41.0 85-89 39.59695000000001 41.0 41.0 41.0 37.0 41.0 90-94 39.48155 41.0 41.0 41.0 37.0 41.0 95-99 39.4036 41.0 41.0 41.0 37.0 41.0 100-104 39.343849999999996 41.0 41.0 41.0 37.0 41.0 105-109 39.287699999999994 41.0 41.0 41.0 37.0 41.0 110-114 39.26805 41.0 41.0 41.0 37.0 41.0 115-119 39.19885000000001 41.0 41.0 41.0 37.0 41.0 120-124 39.19525 41.0 41.0 41.0 37.0 41.0 125-129 39.1749 41.0 41.0 41.0 37.0 41.0 130-134 38.94085 41.0 41.0 41.0 34.0 41.0 135-139 38.63925 41.0 41.0 41.0 32.0 41.0 140-144 38.43855 41.0 39.4 41.0 32.0 41.0 145-149 38.19995 41.0 37.0 41.0 32.0 41.0 150 38.01775 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 3.0 24 3.0 25 6.0 26 6.0 27 12.0 28 14.0 29 10.0 30 22.0 31 32.0 32 39.0 33 58.0 34 74.0 35 80.0 36 111.0 37 148.0 38 276.0 39 516.0 40 2587.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.125 13.925 10.975 35.975 2 15.15 12.875 42.15 29.825000000000003 3 15.174999999999999 20.075000000000003 30.9 33.85 4 21.675 26.3 25.900000000000002 26.125 5 21.675 32.300000000000004 27.500000000000004 18.525 6 16.675 32.675 29.325000000000003 21.325 7 14.399999999999999 28.4 38.9 18.3 8 13.600000000000001 25.8 36.925000000000004 23.674999999999997 9 14.875 26.474999999999998 36.075 22.575 10-14 19.36 29.054999999999996 27.765 23.82 15-19 19.59 28.29 28.21 23.91 20-24 18.94 28.37 28.73 23.96 25-29 18.715 28.655 28.544999999999998 24.085 30-34 18.39 29.625 27.755000000000003 24.23 35-39 18.84 28.494999999999997 28.599999999999998 24.065 40-44 19.35 29.025000000000002 27.97 23.655 45-49 19.665 28.665000000000003 28.37 23.3 50-54 19.509999999999998 27.71 28.525 24.255 55-59 19.825 28.854999999999997 27.625 23.695 60-64 18.975 28.48 28.265 24.279999999999998 65-69 19.72 28.465 28.105000000000004 23.71 70-74 19.785 28.12 28.325 23.77 75-79 18.98 29.065 27.894999999999996 24.060000000000002 80-84 19.225 28.384999999999998 27.944999999999997 24.445 85-89 19.665 28.720000000000002 28.335 23.28 90-94 19.935 28.134999999999998 28.015 23.915 95-99 19.259999999999998 29.535 27.744999999999997 23.46 100-104 20.165 28.194999999999997 28.139999999999997 23.5 105-109 20.135 27.74 28.299999999999997 23.825 110-114 19.885 27.83 28.34 23.945 115-119 19.72 28.299999999999997 28.255000000000003 23.724999999999998 120-124 19.939999999999998 27.944999999999997 28.095 24.02 125-129 20.39 27.99 28.15 23.47 130-134 19.575 28.310000000000002 28.439999999999998 23.674999999999997 135-139 19.845 28.360000000000003 27.875 23.919999999999998 140-144 19.913982796559313 28.83076615323065 28.180636127225444 23.074614922984598 145-149 20.005 28.575 27.644999999999996 23.775 150 20.349999999999998 28.050000000000004 27.1 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 4.0 23 4.5 24 2.5 25 4.0 26 4.0 27 4.0 28 9.0 29 12.5 30 16.5 31 29.5 32 47.0 33 57.5 34 63.0 35 74.0 36 103.0 37 120.5 38 146.5 39 186.5 40 204.5 41 231.5 42 254.0 43 277.0 44 286.0 45 280.0 46 271.0 47 246.0 48 221.5 49 190.0 50 154.5 51 118.0 52 87.0 53 73.0 54 63.5 55 42.0 56 28.0 57 24.0 58 14.0 59 9.5 60 8.5 61 7.0 62 5.0 63 4.5 64 3.0 65 1.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.87143977005488 91.725 2 3.8149986934935978 7.3 3 0.28743140841390125 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.026130128037627383 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATG 6 0.15 TruSeq Adapter, Index 7 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0125 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.025 0.0 0.0 0.025 0.0 108-109 0.025 0.0 0.0 0.025 0.0 110-111 0.025 0.0 0.0 0.025 0.0 112-113 0.025 0.0 0.0 0.025 0.0 114-115 0.025 0.0 0.0 0.025 0.0 116-117 0.075 0.0 0.0 0.025 0.0 118-119 0.1125 0.0 0.0 0.025 0.0 120-121 0.125 0.0 0.0 0.025 0.0 122-123 0.175 0.0 0.0 0.025 0.0 124-125 0.25 0.0 0.0 0.025 0.0 126-127 0.35 0.0 0.0 0.025 0.0 128-129 0.4 0.0 0.0 0.025 0.0 130-131 0.4625 0.0 0.0 0.025 0.0 132-133 0.525 0.0 0.0 0.025 0.0 134-135 0.5625 0.0 0.0 0.025 0.0 136-137 0.6375 0.0 0.0 0.025 0.0 138 0.675 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCAAA 10 0.006973645 144.0 6 >>END_MODULE SRR14639584 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639584_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.935 32.0 32.0 32.0 32.0 32.0 2 30.935 32.0 32.0 32.0 32.0 32.0 3 34.53625 37.0 32.0 37.0 32.0 37.0 4 35.2925 37.0 37.0 37.0 32.0 37.0 5 35.495 37.0 37.0 37.0 32.0 37.0 6 38.75525 41.0 41.0 41.0 37.0 41.0 7 38.65925 41.0 41.0 41.0 32.0 41.0 8 38.51225 41.0 41.0 41.0 32.0 41.0 9 38.63 41.0 41.0 41.0 32.0 41.0 10-14 38.7277 41.0 41.0 41.0 35.0 41.0 15-19 38.469950000000004 41.0 41.0 41.0 32.0 41.0 20-24 38.3427 41.0 41.0 41.0 32.0 41.0 25-29 38.0875 41.0 39.4 41.0 30.0 41.0 30-34 38.071400000000004 41.0 41.0 41.0 29.0 41.0 35-39 37.98775 41.0 37.8 41.0 29.0 41.0 40-44 37.8159 41.0 37.0 41.0 28.0 41.0 45-49 37.6959 41.0 37.0 41.0 27.0 41.0 50-54 37.55435 41.0 37.0 41.0 27.0 41.0 55-59 37.517849999999996 41.0 37.0 41.0 27.0 41.0 60-64 37.4517 41.0 37.0 41.0 27.0 41.0 65-69 37.24005 41.0 37.0 41.0 27.0 41.0 70-74 37.08284999999999 41.0 37.0 41.0 27.0 41.0 75-79 36.2707 40.2 36.0 41.0 23.0 41.0 80-84 37.215 41.0 37.0 41.0 25.0 41.0 85-89 37.089749999999995 41.0 37.0 41.0 23.0 41.0 90-94 36.920249999999996 41.0 37.0 41.0 24.0 41.0 95-99 37.0224 41.0 37.0 41.0 24.0 41.0 100-104 36.64105 41.0 37.0 41.0 22.0 41.0 105-109 36.813599999999994 41.0 37.0 41.0 22.0 41.0 110-114 36.6887 41.0 37.0 41.0 22.0 41.0 115-119 36.379650000000005 41.0 37.0 41.0 22.0 41.0 120-124 36.4543 41.0 37.0 41.0 22.0 41.0 125-129 35.95725 41.0 36.0 41.0 20.0 41.0 130-134 36.101099999999995 41.0 37.0 41.0 22.0 41.0 135-139 35.5199 41.0 35.0 41.0 18.0 41.0 140-144 35.402100000000004 41.0 34.0 41.0 18.0 41.0 145-149 35.14955 41.0 35.0 41.0 16.0 41.0 150 34.829 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 3.0 16 13.0 17 14.0 18 30.0 19 20.0 20 23.0 21 27.0 22 29.0 23 26.0 24 32.0 25 28.0 26 42.0 27 54.0 28 57.0 29 58.0 30 68.0 31 93.0 32 92.0 33 119.0 34 138.0 35 129.0 36 147.0 37 218.0 38 314.0 39 544.0 40 1681.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.34837092731829 27.44360902255639 9.348370927318296 23.859649122807017 2 19.75 28.749999999999996 35.55 15.950000000000001 3 17.45 29.075 33.725 19.75 4 22.425 34.825 24.65 18.099999999999998 5 23.400000000000002 37.625 23.549999999999997 15.425 6 18.9 36.5 26.400000000000002 18.2 7 18.85 23.625 37.225 20.3 8 17.8 25.025 33.025 24.15 9 20.849999999999998 25.35 30.625000000000004 23.175 10-14 22.41 28.71 27.685 21.195 15-19 22.564999999999998 27.33 28.54 21.565 20-24 21.965 29.01 28.075 20.95 25-29 22.895 28.345 28.4 20.36 30-34 22.96 28.005000000000003 27.994999999999997 21.04 35-39 22.065 28.799999999999997 28.07 21.065 40-44 22.470000000000002 27.82 28.515 21.195 45-49 22.74 28.175 28.465 20.62 50-54 22.66 28.105000000000004 28.310000000000002 20.925 55-59 22.785 28.515 27.61 21.09 60-64 22.89 28.07 28.42 20.62 65-69 23.1 27.675 28.03 21.195 70-74 22.775000000000002 29.095 27.389999999999997 20.74 75-79 22.73 27.900000000000002 28.165000000000003 21.205 80-84 23.315 28.189999999999998 27.6 20.895 85-89 23.43 28.09 28.225 20.255000000000003 90-94 23.395 28.34 27.700000000000003 20.565 95-99 23.189999999999998 27.944999999999997 28.560000000000002 20.305 100-104 23.630000000000003 28.084999999999997 27.800000000000004 20.485 105-109 23.35 27.775 27.800000000000004 21.075 110-114 22.895 28.15 27.825 21.13 115-119 23.105 28.67 27.810000000000002 20.415 120-124 23.93 27.73 28.065 20.275000000000002 125-129 23.43 27.994999999999997 28.155 20.419999999999998 130-134 23.555 28.075 27.79 20.580000000000002 135-139 23.18 27.785 27.825 21.21 140-144 23.330000000000002 28.255000000000003 27.55 20.865000000000002 145-149 23.26 28.305000000000003 27.61 20.825 150 23.025000000000002 28.925 26.900000000000002 21.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.5 22 1.0 23 1.0 24 1.0 25 2.5 26 6.0 27 7.0 28 7.5 29 19.5 30 25.5 31 26.5 32 37.5 33 51.0 34 63.5 35 74.0 36 91.5 37 109.0 38 142.0 39 177.0 40 206.0 41 243.0 42 268.5 43 285.5 44 289.5 45 272.5 46 253.0 47 247.0 48 226.0 49 183.0 50 144.5 51 113.5 52 91.0 53 77.0 54 59.0 55 44.0 56 37.0 57 24.5 58 17.5 59 17.0 60 14.5 61 10.5 62 5.0 63 4.0 64 4.5 65 3.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.60357791029297 93.15 2 3.163080114078299 6.1 3 0.2074150894477573 0.6 4 0.0 0.0 5 0.0 0.0 6 0.025926886180969663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCTC 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2375 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.3625 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4375 0.0 0.0 0.0 0.0 132-133 0.5125 0.0 0.0 0.0 0.0 134-135 0.5625 0.0 0.0 0.0 0.0 136-137 0.6125 0.0 0.0 0.0 0.0 138 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAATG 10 0.0069754543 143.9875 3 >>END_MODULE Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916704 spots for SRR14639584.sra Written 916704 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra Read 916703 spots for SRR14639584.sra Written 916703 spots for SRR14639584.sra SRR ids: ['SRR14639584.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z8g3kif0 SRR14639584.sra spots: 18334061 blocks: [[1, 916703], [916704, 1833406], [1833407, 2750109], [2750110, 3666812], [3666813, 4583515], [4583516, 5500218], [5500219, 6416921], [6416922, 7333624], [7333625, 8250327], [8250328, 9167030], [9167031, 10083733], [10083734, 11000436], [11000437, 11917139], [11917140, 12833842], [12833843, 13750545], [13750546, 14667248], [14667249, 15583951], [15583952, 16500654], [16500655, 17417357], [17417358, 18334061]] SRR14639584 file size 6784497 SRR14639584 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639584 SRR14639584_1.fastq SRR14639584_2.fastq Input file: SRR14639584_1.fastq Paired file: SRR14639584_2.fastq trimmed: SRR14639584-trimmed-pair1.fastq, SRR14639584-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 10:02:00 2025 >> started Fri Feb 14 10:02:20 2025 >> done (20.077s) 18334061 read pairs processed; of these: 100 ( 0.00%) short read pairs filtered out after trimming by size control 308 ( 0.00%) empty read pairs filtered out after trimming by size control 18333653 (100.00%) read pairs available; of these: 610938 ( 3.33%) trimmed read pairs available after processing 17722715 (96.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 21 0.00% 20 19 0.00% 21 21 0.00% 22 16 0.00% 23 28 0.00% 24 23 0.00% 25 19 0.00% 26 25 0.00% 27 34 0.00% 28 34 0.00% 29 33 0.00% 30 41 0.00% 31 23 0.00% 32 42 0.00% 33 41 0.00% 34 50 0.00% 35 37 0.00% 36 44 0.00% 37 53 0.00% 38 63 0.00% 39 57 0.00% 40 52 0.00% 41 54 0.00% 42 57 0.00% 43 59 0.00% 44 52 0.00% 45 69 0.00% 46 57 0.00% 47 57 0.00% 48 50 0.00% 49 67 0.00% 50 70 0.00% 51 62 0.00% 52 97 0.00% 53 72 0.00% 54 77 0.00% 55 89 0.00% 56 86 0.00% 57 88 0.00% 58 108 0.00% 59 92 0.00% 60 115 0.00% 61 103 0.00% 62 87 0.00% 63 119 0.00% 64 118 0.00% 65 123 0.00% 66 118 0.00% 67 138 0.00% 68 128 0.00% 69 133 0.00% 70 153 0.00% 71 172 0.00% 72 177 0.00% 73 180 0.00% 74 172 0.00% 75 207 0.00% 76 185 0.00% 77 195 0.00% 78 250 0.00% 79 252 0.00% 80 244 0.00% 81 269 0.00% 82 304 0.00% 83 280 0.00% 84 330 0.00% 85 344 0.00% 86 360 0.00% 87 419 0.00% 88 425 0.00% 89 472 0.00% 90 540 0.00% 91 489 0.00% 92 561 0.00% 93 580 0.00% 94 696 0.00% 95 674 0.00% 96 779 0.00% 97 771 0.00% 98 820 0.00% 99 973 0.01% 100 1055 0.01% 101 1133 0.01% 102 1241 0.01% 103 1272 0.01% 104 1425 0.01% 105 1509 0.01% 106 1597 0.01% 107 1637 0.01% 108 1841 0.01% 109 2086 0.01% 110 2139 0.01% 111 2267 0.01% 112 2608 0.01% 113 2737 0.01% 114 2902 0.02% 115 3215 0.02% 116 3311 0.02% 117 3688 0.02% 118 3897 0.02% 119 4092 0.02% 120 4356 0.02% 121 4634 0.03% 122 4811 0.03% 123 5326 0.03% 124 5822 0.03% 125 5989 0.03% 126 6629 0.04% 127 7059 0.04% 128 7235 0.04% 129 7999 0.04% 130 8128 0.04% 131 8500 0.05% 132 8799 0.05% 133 9466 0.05% 134 9710 0.05% 135 10587 0.06% 136 10901 0.06% 137 11654 0.06% 138 12288 0.07% 139 12604 0.07% 140 13423 0.07% 141 14301 0.08% 142 14601 0.08% 143 15458 0.08% 144 16289 0.09% 145 16953 0.09% 146 18108 0.10% 147 20921 0.11% 148 31862 0.17% 149 225257 1.23% 150 17722715 96.67% 18333653 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=30 prefix-density=0.51 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=95.13 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=20.6 sequence=CAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATTTGG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=39 prefix-density=0.70 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=89.70 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=19.7 sequence=TCATCATCAACAAT SRR14639584 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 10:03:21 Started mapping on | Feb 14 10:03:21 Finished on | Feb 14 10:05:45 Mapping speed, Million of reads per hour | 458.34 Number of input reads | 18333653 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16772873 Uniquely mapped reads % | 91.49% Average mapped length | 297.10 Number of splices: Total | 17582789 Number of splices: Annotated (sjdb) | 17159998 Number of splices: GT/AG | 17260230 Number of splices: GC/AG | 255385 Number of splices: AT/AC | 13222 Number of splices: Non-canonical | 53952 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.03% Deletion average length | 3.16 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373505 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 8893 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.39% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1187275 1187275 1187275 N_multimapping 373505 373505 373505 N_noFeature 571635 16571854 616794 N_ambiguous 252152 774 96070 UnstrandedReadsAssigned:15949086 PositiveStrandReadsAssigned:200245 NegativeStrandReadsAssigned:16060009 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639584 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639584-trimmed-pair1.fastq SRR14639584-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,333,653 reads, 16,333,366 reads pseudoaligned [quant] estimated average fragment length: 320.998 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 983 rounds 52401 SRR14639584.ke.tsv 34699 SRR14639584.se.tsv 87100 total ==> SRR14639584.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1698 929 29.1947 Potri.005G024800.1.v4.1 1035 715.002 367 27.3896 Potri.004G059700.1.v4.1 961 641.389 49 4.07663 Potri.007G009000.2.v4.1 1416 1096 0 0 Potri.003G141000.2.v4.1 2943 2623 1518.53 30.8923 Potri.016G087400.1.v4.1 270 64.1079 1221.77 1016.96 Potri.015G069301.1.v4.1 564 272.216 0 0 Potri.010G195200.1.v4.1 1773 1453 135 4.95786 Potri.012G127500.1.v4.1 977 657.206 43 3.49135 ==> SRR14639584.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 178 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 46 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR14639584 completed mapping pipeline successfully