Starting /dee2/code/volunteer_pipeline.sh SRR14639585 current disk space = 3114459361280 free memory = 1572434948 SRR14639585 SRAfilesize 7c7c25f24f95f5e1fe1160bf3300396d SRR14639585.sra SRR14639585.sra file validated SRR14639585 is paired end SRR14639585 is conventional basespace SRR14639585 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639585_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69 32.0 32.0 32.0 32.0 32.0 2 31.62375 32.0 32.0 32.0 32.0 32.0 3 35.3925 37.0 37.0 37.0 32.0 37.0 4 36.24 37.0 37.0 37.0 37.0 37.0 5 36.39375 37.0 37.0 37.0 37.0 37.0 6 39.86225 41.0 41.0 41.0 37.0 41.0 7 39.998 41.0 41.0 41.0 37.0 41.0 8 40.13975 41.0 41.0 41.0 37.0 41.0 9 40.3515 41.0 41.0 41.0 37.0 41.0 10-14 40.31535 41.0 41.0 41.0 40.2 41.0 15-19 40.33370000000001 41.0 41.0 41.0 41.0 41.0 20-24 40.305 41.0 41.0 41.0 41.0 41.0 25-29 40.295100000000005 41.0 41.0 41.0 41.0 41.0 30-34 40.29 41.0 41.0 41.0 41.0 41.0 35-39 40.2085 41.0 41.0 41.0 39.4 41.0 40-44 40.166 41.0 41.0 41.0 37.8 41.0 45-49 40.158100000000005 41.0 41.0 41.0 37.8 41.0 50-54 40.0649 41.0 41.0 41.0 37.0 41.0 55-59 39.99715 41.0 41.0 41.0 37.0 41.0 60-64 39.96045 41.0 41.0 41.0 37.0 41.0 65-69 39.83055 41.0 41.0 41.0 37.0 41.0 70-74 39.69995 41.0 41.0 41.0 37.0 41.0 75-79 39.299600000000005 41.0 40.2 41.0 36.0 41.0 80-84 39.72324999999999 41.0 41.0 41.0 37.0 41.0 85-89 39.693 41.0 41.0 41.0 37.0 41.0 90-94 39.6241 41.0 41.0 41.0 37.0 41.0 95-99 39.55175 41.0 41.0 41.0 37.0 41.0 100-104 39.3985 41.0 41.0 41.0 37.0 41.0 105-109 39.379000000000005 41.0 41.0 41.0 37.0 41.0 110-114 39.3665 41.0 41.0 41.0 37.0 41.0 115-119 39.316700000000004 41.0 41.0 41.0 37.0 41.0 120-124 39.2582 41.0 41.0 41.0 37.0 41.0 125-129 39.26215 41.0 41.0 41.0 37.0 41.0 130-134 38.9691 41.0 41.0 41.0 34.0 41.0 135-139 38.747150000000005 41.0 41.0 41.0 32.0 41.0 140-144 38.57665000000001 41.0 40.2 41.0 32.0 41.0 145-149 38.29585 41.0 37.0 41.0 32.0 41.0 150 38.08225 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 4.0 25 1.0 26 6.0 27 8.0 28 12.0 29 17.0 30 23.0 31 34.0 32 36.0 33 50.0 34 56.0 35 77.0 36 99.0 37 152.0 38 265.0 39 479.0 40 2678.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.48337084271068 12.4031007751938 7.226806701675419 46.88672168042011 2 16.125 12.675 41.475 29.725 3 16.275000000000002 17.025000000000002 27.55 39.15 4 21.0 24.325 25.124999999999996 29.549999999999997 5 22.125 31.1 27.05 19.725 6 17.775 32.6 26.75 22.875 7 14.000000000000002 26.825 41.475 17.7 8 15.875 24.95 36.75 22.425 9 15.0 24.15 36.525 24.325 10-14 18.575 29.330000000000002 28.7 23.395 15-19 18.8 29.345 27.955000000000002 23.9 20-24 18.845 28.32 28.610000000000003 24.224999999999998 25-29 18.95 28.475 28.694999999999997 23.880000000000003 30-34 18.995 28.985 27.38 24.64 35-39 18.945 28.525 28.465 24.065 40-44 19.28 28.48 28.694999999999997 23.544999999999998 45-49 19.555 28.499999999999996 27.965 23.98 50-54 19.634999999999998 28.46 27.985 23.919999999999998 55-59 19.605 28.215 28.035 24.145 60-64 20.035 28.095 27.865000000000002 24.005000000000003 65-69 19.335 28.565 28.315 23.785 70-74 19.509999999999998 28.815 27.72 23.955000000000002 75-79 19.56 28.34 28.005000000000003 24.095 80-84 19.49 28.4 28.125 23.985 85-89 19.400000000000002 28.335 27.915 24.349999999999998 90-94 20.14 27.395000000000003 28.360000000000003 24.104999999999997 95-99 19.675 28.249999999999996 27.900000000000002 24.175 100-104 19.869999999999997 28.294999999999998 28.115000000000002 23.72 105-109 19.65294794219133 27.914187128069212 28.569285392808926 23.86357953693054 110-114 20.119999999999997 28.13 27.939999999999998 23.810000000000002 115-119 19.36 27.51 28.23 24.9 120-124 20.02 27.450000000000003 28.389999999999997 24.14 125-129 20.14 27.894999999999996 27.810000000000002 24.154999999999998 130-134 19.85 27.694999999999997 28.655 23.799999999999997 135-139 20.724999999999998 27.439999999999998 27.88 23.955000000000002 140-144 20.37305595839376 27.81417212581887 27.71915787368105 24.093614042106314 145-149 20.29 28.165000000000003 27.834999999999997 23.71 150 19.6 27.175 27.900000000000002 25.324999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 4.0 26 4.0 27 5.5 28 9.5 29 11.0 30 10.5 31 17.5 32 36.5 33 50.5 34 60.0 35 81.5 36 109.0 37 128.5 38 141.0 39 169.5 40 191.5 41 226.0 42 273.5 43 283.0 44 276.0 45 260.5 46 253.5 47 250.5 48 235.0 49 197.0 50 153.5 51 131.0 52 109.5 53 81.0 54 60.5 55 45.0 56 33.5 57 26.0 58 17.0 59 12.5 60 11.0 61 8.0 62 6.0 63 5.5 64 3.5 65 3.0 66 1.0 67 0.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.15406900184355 90.325 2 4.450882275480643 8.450000000000001 3 0.3687121411640769 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02633658151171978 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATG 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0125 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.075 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.075 0.0 0.0 0.025 0.0 96-97 0.1375 0.0 0.0 0.025 0.0 98-99 0.15 0.0 0.0 0.025 0.0 100-101 0.16249999999999998 0.0 0.0 0.025 0.0 102-103 0.2 0.0 0.0 0.025 0.0 104-105 0.21250000000000002 0.0 0.0 0.025 0.0 106-107 0.225 0.0 0.0 0.025 0.0 108-109 0.2375 0.0 0.0 0.025 0.0 110-111 0.2625 0.0 0.0 0.025 0.0 112-113 0.275 0.0 0.0 0.025 0.0 114-115 0.3125 0.0 0.0 0.025 0.0 116-117 0.375 0.0 0.0 0.025 0.0 118-119 0.5 0.0 0.0 0.025 0.0 120-121 0.6 0.0 0.0 0.025 0.0 122-123 0.65 0.0 0.0 0.025 0.0 124-125 0.6875 0.0 0.0 0.025 0.0 126-127 0.8 0.0 0.0 0.025 0.0 128-129 0.875 0.0 0.0 0.025 0.0 130-131 0.9375 0.0 0.0 0.025 0.0 132-133 1.0750000000000002 0.0 0.0 0.025 0.0 134-135 1.2374999999999998 0.0 0.0 0.025 0.0 136-137 1.3375 0.0 0.0 0.025 0.0 138 1.525 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCTAT 10 0.006973645 144.0 9 AAAAAAA 40 0.007966741 18.0 65-69 >>END_MODULE SRR14639585 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639585_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.12875 32.0 32.0 32.0 32.0 32.0 2 31.18 32.0 32.0 32.0 32.0 32.0 3 34.7975 37.0 32.0 37.0 32.0 37.0 4 35.5725 37.0 37.0 37.0 32.0 37.0 5 35.825 37.0 37.0 37.0 32.0 37.0 6 39.19 41.0 41.0 41.0 37.0 41.0 7 39.12875 41.0 41.0 41.0 37.0 41.0 8 39.16475 41.0 41.0 41.0 37.0 41.0 9 39.1675 41.0 41.0 41.0 37.0 41.0 10-14 39.19905 41.0 41.0 41.0 37.0 41.0 15-19 39.007450000000006 41.0 41.0 41.0 37.0 41.0 20-24 38.8431 41.0 41.0 41.0 35.0 41.0 25-29 38.577299999999994 41.0 41.0 41.0 34.0 41.0 30-34 38.46095 41.0 41.0 41.0 32.0 41.0 35-39 38.461200000000005 41.0 41.0 41.0 32.0 41.0 40-44 38.3713 41.0 41.0 41.0 32.0 41.0 45-49 38.27735 41.0 41.0 41.0 32.0 41.0 50-54 38.14755 41.0 38.6 41.0 32.0 41.0 55-59 38.182550000000006 41.0 40.2 41.0 32.0 41.0 60-64 38.0445 41.0 37.8 41.0 30.0 41.0 65-69 37.8061 41.0 37.0 41.0 29.0 41.0 70-74 37.6289 41.0 37.0 41.0 27.0 41.0 75-79 36.9991 40.2 36.0 41.0 26.0 41.0 80-84 37.8404 41.0 37.0 41.0 29.0 41.0 85-89 37.84205 41.0 37.0 41.0 27.0 41.0 90-94 37.54215000000001 41.0 37.0 41.0 27.0 41.0 95-99 37.7158 41.0 37.0 41.0 28.0 41.0 100-104 37.38605 41.0 37.0 41.0 25.0 41.0 105-109 37.3562 41.0 37.0 41.0 27.0 41.0 110-114 37.39125 41.0 37.0 41.0 27.0 41.0 115-119 37.10815 41.0 37.0 41.0 25.0 41.0 120-124 37.07725000000001 41.0 37.0 41.0 25.0 41.0 125-129 36.592650000000006 41.0 37.0 41.0 23.0 41.0 130-134 36.55385 41.0 37.0 41.0 22.0 41.0 135-139 36.13285 41.0 36.0 41.0 22.0 41.0 140-144 35.892649999999996 41.0 37.0 41.0 22.0 41.0 145-149 35.69095 41.0 36.0 41.0 20.0 41.0 150 35.5415 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 3.0 17 7.0 18 8.0 19 17.0 20 19.0 21 16.0 22 24.0 23 22.0 24 28.0 25 32.0 26 42.0 27 47.0 28 56.0 29 70.0 30 69.0 31 57.0 32 65.0 33 71.0 34 113.0 35 139.0 36 169.0 37 222.0 38 313.0 39 544.0 40 1846.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.11764705882353 26.207759699624532 9.136420525657071 30.538172715894866 2 21.8 27.400000000000002 35.925000000000004 14.875 3 17.299999999999997 28.549999999999997 33.85 20.3 4 22.1 34.875 23.225 19.8 5 25.5 37.9 20.875 15.725 6 19.925 40.125 22.025 17.925 7 19.1 23.625 37.5 19.775000000000002 8 19.25 25.724999999999998 31.324999999999996 23.7 9 20.4 24.075 31.924999999999997 23.599999999999998 10-14 22.735 29.115000000000002 26.8 21.349999999999998 15-19 22.535 28.415000000000003 28.345 20.705000000000002 20-24 22.8 28.38 28.035 20.785 25-29 22.64 28.83 27.810000000000002 20.72 30-34 22.795 28.32 27.900000000000002 20.985 35-39 23.075000000000003 28.225 27.855 20.845 40-44 22.53 28.275 27.96 21.235 45-49 22.475 28.095 27.92 21.51 50-54 22.99 27.88 28.255000000000003 20.875 55-59 22.869999999999997 28.345 27.815 20.97 60-64 23.455000000000002 28.499999999999996 27.105 20.94 65-69 22.595000000000002 28.88 27.134999999999998 21.39 70-74 23.585 28.13 27.405 20.880000000000003 75-79 23.544999999999998 28.67 27.43 20.355 80-84 22.96 28.67 27.12 21.25 85-89 23.525 28.49 27.060000000000002 20.925 90-94 23.185 28.634999999999998 27.575 20.605 95-99 23.419999999999998 28.015 27.779999999999998 20.785 100-104 23.990000000000002 28.07 26.895000000000003 21.044999999999998 105-109 23.27 28.660000000000004 27.334999999999997 20.735 110-114 22.814999999999998 28.68 27.855 20.65 115-119 24.275 28.025 26.765 20.935000000000002 120-124 23.830000000000002 28.055000000000003 27.76 20.355 125-129 23.919999999999998 27.975 26.545 21.560000000000002 130-134 23.955000000000002 27.805000000000003 27.560000000000002 20.68 135-139 24.060000000000002 28.310000000000002 26.950000000000003 20.68 140-144 23.52 28.244999999999997 27.250000000000004 20.985 145-149 24.375 28.175 26.905 20.544999999999998 150 23.575 27.575 28.575 20.275000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 2.0 24 2.5 25 2.5 26 4.5 27 5.5 28 7.0 29 10.0 30 12.0 31 17.5 32 24.5 33 33.0 34 50.5 35 73.5 36 97.0 37 110.0 38 126.0 39 157.0 40 207.0 41 251.5 42 278.5 43 300.0 44 304.0 45 277.5 46 263.0 47 260.0 48 214.5 49 179.0 50 150.5 51 119.5 52 103.5 53 86.0 54 73.5 55 49.0 56 31.5 57 30.0 58 19.5 59 15.0 60 16.0 61 11.5 62 5.5 63 4.0 64 3.0 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 95.78864765890663 91.55 2 3.923620193565263 7.5 3 0.23541721161391577 0.675 4 0.02615746795710175 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02615746795710175 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCTC 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 31bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.9874999999999999 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAACTT 10 0.006973645 144.0 1 >>END_MODULE Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033453 spots for SRR14639585.sra Written 1033453 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra Read 1033439 spots for SRR14639585.sra Written 1033439 spots for SRR14639585.sra SRR ids: ['SRR14639585.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fg4n2kwh SRR14639585.sra spots: 20668794 blocks: [[1, 1033439], [1033440, 2066878], [2066879, 3100317], [3100318, 4133756], [4133757, 5167195], [5167196, 6200634], [6200635, 7234073], [7234074, 8267512], [8267513, 9300951], [9300952, 10334390], [10334391, 11367829], [11367830, 12401268], [12401269, 13434707], [13434708, 14468146], [14468147, 15501585], [15501586, 16535024], [16535025, 17568463], [17568464, 18601902], [18601903, 19635341], [19635342, 20668794]] SRR14639585 file size 7649829 SRR14639585 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639585 SRR14639585_1.fastq SRR14639585_2.fastq Input file: SRR14639585_1.fastq Paired file: SRR14639585_2.fastq trimmed: SRR14639585-trimmed-pair1.fastq, SRR14639585-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 11:31:22 2025 >> started Fri Feb 14 11:31:54 2025 >> done (31.884s) 20668794 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 301 ( 0.00%) empty read pairs filtered out after trimming by size control 20668392 (100.00%) read pairs available; of these: 879275 ( 4.25%) trimmed read pairs available after processing 19789117 (95.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 19 0.00% 20 17 0.00% 21 17 0.00% 22 16 0.00% 23 18 0.00% 24 22 0.00% 25 18 0.00% 26 23 0.00% 27 23 0.00% 28 24 0.00% 29 43 0.00% 30 36 0.00% 31 20 0.00% 32 45 0.00% 33 28 0.00% 34 28 0.00% 35 39 0.00% 36 48 0.00% 37 38 0.00% 38 46 0.00% 39 51 0.00% 40 49 0.00% 41 44 0.00% 42 74 0.00% 43 81 0.00% 44 56 0.00% 45 70 0.00% 46 48 0.00% 47 62 0.00% 48 60 0.00% 49 73 0.00% 50 82 0.00% 51 73 0.00% 52 82 0.00% 53 75 0.00% 54 74 0.00% 55 103 0.00% 56 95 0.00% 57 81 0.00% 58 114 0.00% 59 102 0.00% 60 118 0.00% 61 117 0.00% 62 128 0.00% 63 115 0.00% 64 130 0.00% 65 119 0.00% 66 143 0.00% 67 142 0.00% 68 147 0.00% 69 192 0.00% 70 192 0.00% 71 213 0.00% 72 189 0.00% 73 236 0.00% 74 251 0.00% 75 273 0.00% 76 257 0.00% 77 300 0.00% 78 308 0.00% 79 376 0.00% 80 309 0.00% 81 398 0.00% 82 454 0.00% 83 488 0.00% 84 481 0.00% 85 535 0.00% 86 572 0.00% 87 596 0.00% 88 737 0.00% 89 774 0.00% 90 787 0.00% 91 789 0.00% 92 914 0.00% 93 1009 0.00% 94 1097 0.01% 95 1117 0.01% 96 1355 0.01% 97 1346 0.01% 98 1610 0.01% 99 1633 0.01% 100 1895 0.01% 101 1856 0.01% 102 2012 0.01% 103 2249 0.01% 104 2480 0.01% 105 2629 0.01% 106 2839 0.01% 107 3095 0.01% 108 3380 0.02% 109 3639 0.02% 110 3820 0.02% 111 4202 0.02% 112 4445 0.02% 113 4948 0.02% 114 5279 0.03% 115 5712 0.03% 116 5895 0.03% 117 6668 0.03% 118 7065 0.03% 119 7405 0.04% 120 7963 0.04% 121 8296 0.04% 122 8976 0.04% 123 9549 0.05% 124 10320 0.05% 125 10585 0.05% 126 11564 0.06% 127 12138 0.06% 128 12809 0.06% 129 13821 0.07% 130 14518 0.07% 131 15194 0.07% 132 15991 0.08% 133 16914 0.08% 134 17500 0.08% 135 18621 0.09% 136 19349 0.09% 137 20284 0.10% 138 21552 0.10% 139 22374 0.11% 140 23385 0.11% 141 24789 0.12% 142 25571 0.12% 143 26858 0.13% 144 27668 0.13% 145 28669 0.14% 146 30484 0.15% 147 32242 0.16% 148 43156 0.21% 149 223539 1.08% 150 19789117 95.75% 20668392 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=37 prefix-density=0.56 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATG criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=83.08 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=19.2 sequence=CAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATT criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=36 prefix-density=0.80 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=87.40 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=9.9 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639585 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 11:32:55 Started mapping on | Feb 14 11:32:55 Finished on | Feb 14 11:35:29 Mapping speed, Million of reads per hour | 483.16 Number of input reads | 20668392 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19025452 Uniquely mapped reads % | 92.05% Average mapped length | 297.08 Number of splices: Total | 20472129 Number of splices: Annotated (sjdb) | 20007913 Number of splices: GT/AG | 20105587 Number of splices: GC/AG | 293394 Number of splices: AT/AC | 15271 Number of splices: Non-canonical | 57877 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 3.14 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435152 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 27687 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.66% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1207788 1207788 1207788 N_multimapping 435152 435152 435152 N_noFeature 520006 18775614 573498 N_ambiguous 300951 915 104351 UnstrandedReadsAssigned:18204495 PositiveStrandReadsAssigned:248923 NegativeStrandReadsAssigned:18347603 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639585 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639585-trimmed-pair1.fastq SRR14639585-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,668,392 reads, 18,510,106 reads pseudoaligned [quant] estimated average fragment length: 308.141 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR14639585.ke.tsv 34699 SRR14639585.se.tsv 87100 total ==> SRR14639585.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1710.86 1211 30.8828 Potri.005G024800.1.v4.1 1035 727.859 470 28.1733 Potri.004G059700.1.v4.1 961 654.084 95 6.3369 Potri.007G009000.2.v4.1 1416 1108.86 0 0 Potri.003G141000.2.v4.1 2943 2635.86 1597.04 26.4351 Potri.016G087400.1.v4.1 270 68.0897 1789 1146.35 Potri.015G069301.1.v4.1 564 280.111 0 0 Potri.010G195200.1.v4.1 1773 1465.86 167 4.97063 Potri.012G127500.1.v4.1 977 669.957 65 4.23305 ==> SRR14639585.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 181 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 293 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 53 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 17 SRR14639585 completed mapping pipeline successfully