Starting /dee2/code/volunteer_pipeline.sh SRR14639586 current disk space = 2824119484416 free memory = 1575735260 SRR14639586 SRAfilesize 15b159cd513186ec4639b5ace4f38ab5 SRR14639586.sra SRR14639586.sra file validated SRR14639586 is paired end SRR14639586 is conventional basespace SRR14639586 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639586_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70875 32.0 32.0 32.0 32.0 32.0 2 31.5475 32.0 32.0 32.0 32.0 32.0 3 35.3725 37.0 32.0 37.0 32.0 37.0 4 36.15625 37.0 37.0 37.0 32.0 37.0 5 36.24875 37.0 37.0 37.0 37.0 37.0 6 39.78825 41.0 41.0 41.0 37.0 41.0 7 39.9205 41.0 41.0 41.0 37.0 41.0 8 40.25925 41.0 41.0 41.0 37.0 41.0 9 40.23125 41.0 41.0 41.0 37.0 41.0 10-14 40.2358 41.0 41.0 41.0 39.4 41.0 15-19 40.27305 41.0 41.0 41.0 41.0 41.0 20-24 40.2522 41.0 41.0 41.0 38.6 41.0 25-29 40.246449999999996 41.0 41.0 41.0 41.0 41.0 30-34 40.16365 41.0 41.0 41.0 40.2 41.0 35-39 40.093450000000004 41.0 41.0 41.0 37.0 41.0 40-44 40.138999999999996 41.0 41.0 41.0 37.0 41.0 45-49 40.08795 41.0 41.0 41.0 37.0 41.0 50-54 40.0085 41.0 41.0 41.0 37.0 41.0 55-59 39.9799 41.0 41.0 41.0 37.0 41.0 60-64 39.9016 41.0 41.0 41.0 37.0 41.0 65-69 39.79445 41.0 41.0 41.0 37.0 41.0 70-74 39.64065000000001 41.0 41.0 41.0 37.0 41.0 75-79 39.201750000000004 41.0 40.2 41.0 36.0 41.0 80-84 39.6442 41.0 41.0 41.0 37.0 41.0 85-89 39.67005 41.0 41.0 41.0 37.0 41.0 90-94 39.56079999999999 41.0 41.0 41.0 37.0 41.0 95-99 39.49985 41.0 41.0 41.0 37.0 41.0 100-104 39.38065 41.0 41.0 41.0 37.0 41.0 105-109 39.29975 41.0 41.0 41.0 37.0 41.0 110-114 39.34105 41.0 41.0 41.0 37.0 41.0 115-119 39.33 41.0 41.0 41.0 37.0 41.0 120-124 39.23265 41.0 41.0 41.0 37.0 41.0 125-129 39.2593 41.0 41.0 41.0 37.0 41.0 130-134 38.9889 41.0 41.0 41.0 34.0 41.0 135-139 38.6863 41.0 41.0 41.0 32.0 41.0 140-144 38.462149999999994 41.0 40.2 41.0 32.0 41.0 145-149 38.30505 41.0 37.0 41.0 32.0 41.0 150 38.118 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 0.0 24 3.0 25 5.0 26 8.0 27 9.0 28 15.0 29 13.0 30 20.0 31 36.0 32 45.0 33 52.0 34 60.0 35 77.0 36 102.0 37 158.0 38 259.0 39 455.0 40 2680.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.625000000000004 13.275 8.774999999999999 47.325 2 12.975 12.875 44.65 29.5 3 14.299999999999999 17.549999999999997 29.95 38.2 4 18.775 24.85 26.25 30.125 5 20.200000000000003 32.95 27.200000000000003 19.650000000000002 6 16.925 33.050000000000004 28.449999999999996 21.575 7 14.774999999999999 27.125 40.2 17.9 8 13.825000000000001 25.75 37.375 23.05 9 13.850000000000001 24.075 38.125 23.95 10-14 18.475 28.485 29.060000000000002 23.98 15-19 18.385 28.29 28.955 24.37 20-24 18.69 28.744999999999997 28.07 24.495 25-29 19.015 29.225 27.950000000000003 23.810000000000002 30-34 19.255 28.42 27.765 24.560000000000002 35-39 18.65 28.299999999999997 28.685 24.365000000000002 40-44 18.845 28.925 28.055000000000003 24.175 45-49 18.985 29.12 28.310000000000002 23.585 50-54 18.94 28.7 27.915 24.445 55-59 18.86 28.449999999999996 28.515 24.175 60-64 19.11 28.76 27.985 24.145 65-69 19.32 28.565 27.91 24.205 70-74 19.139999999999997 29.025000000000002 27.855 23.98 75-79 19.220000000000002 28.46 28.215 24.104999999999997 80-84 19.05 28.74 27.735 24.474999999999998 85-89 19.439999999999998 28.02 28.24 24.3 90-94 18.905 28.835 27.85 24.41 95-99 19.485 28.46 28.189999999999998 23.865 100-104 19.56 29.099999999999998 27.389999999999997 23.95 105-109 18.836883688368836 28.70787078707871 27.93779377937794 24.51745174517452 110-114 19.82 28.405 28.275 23.5 115-119 19.23 28.49 27.705000000000002 24.575 120-124 19.585 27.735 28.410000000000004 24.27 125-129 19.715 28.299999999999997 27.98 24.005000000000003 130-134 19.575 28.275 28.345 23.805 135-139 19.885 27.794999999999998 28.18 24.14 140-144 19.977996699504928 27.819172875931393 27.659148872330853 24.543681552232837 145-149 19.935 28.384999999999998 28.325 23.355 150 19.05 28.075 27.750000000000004 25.124999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 1.0 25 3.0 26 5.0 27 4.5 28 10.0 29 16.5 30 21.5 31 28.5 32 40.0 33 51.5 34 60.0 35 80.5 36 94.5 37 115.5 38 155.0 39 182.5 40 205.5 41 230.0 42 266.5 43 299.0 44 297.5 45 274.5 46 264.0 47 255.5 48 225.5 49 182.0 50 140.5 51 107.5 52 89.0 53 75.5 54 53.0 55 39.5 56 33.0 57 27.0 58 17.5 59 11.0 60 9.0 61 5.5 62 4.5 63 3.5 64 2.0 65 1.0 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.43118536197295 89.025 2 5.0914876690533015 9.6 3 0.45080880403076107 1.275 4 0.026518164942985947 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0125 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.0625 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.075 0.0 0.0 0.025 0.0 96-97 0.075 0.0 0.0 0.025 0.0 98-99 0.075 0.0 0.0 0.025 0.0 100-101 0.075 0.0 0.0 0.025 0.0 102-103 0.075 0.0 0.0 0.025 0.0 104-105 0.075 0.0 0.0 0.025 0.0 106-107 0.075 0.0 0.0 0.025 0.0 108-109 0.075 0.0 0.0 0.025 0.0 110-111 0.0875 0.0 0.0 0.025 0.0 112-113 0.1 0.0 0.0 0.025 0.0 114-115 0.1 0.0 0.0 0.025 0.0 116-117 0.1 0.0 0.0 0.037500000000000006 0.0 118-119 0.1125 0.0 0.0 0.05 0.0 120-121 0.125 0.0 0.0 0.05 0.0 122-123 0.125 0.0 0.0 0.05 0.0 124-125 0.175 0.0 0.0 0.05 0.0 126-127 0.175 0.0 0.0 0.05 0.0 128-129 0.175 0.0 0.0 0.05 0.0 130-131 0.175 0.0 0.0 0.05 0.0 132-133 0.1875 0.0 0.0 0.05 0.0 134-135 0.21250000000000002 0.0 0.0 0.05 0.0 136-137 0.225 0.0 0.0 0.05 0.0 138 0.225 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639586 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639586_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9875 32.0 32.0 32.0 32.0 32.0 2 30.9275 32.0 32.0 32.0 32.0 32.0 3 34.21 37.0 32.0 37.0 32.0 37.0 4 35.10125 37.0 37.0 37.0 32.0 37.0 5 35.37 37.0 37.0 37.0 32.0 37.0 6 38.57875 41.0 41.0 41.0 32.0 41.0 7 38.42575 41.0 41.0 41.0 32.0 41.0 8 38.50825 41.0 41.0 41.0 32.0 41.0 9 38.6585 41.0 41.0 41.0 32.0 41.0 10-14 38.7377 41.0 41.0 41.0 33.0 41.0 15-19 38.5082 41.0 41.0 41.0 33.0 41.0 20-24 38.3294 41.0 41.0 41.0 31.0 41.0 25-29 37.9919 41.0 39.4 41.0 30.0 41.0 30-34 38.017250000000004 41.0 37.8 41.0 30.0 41.0 35-39 37.895450000000004 41.0 37.0 41.0 28.0 41.0 40-44 37.7968 41.0 37.0 41.0 27.0 41.0 45-49 37.559200000000004 41.0 37.0 41.0 27.0 41.0 50-54 37.50775 41.0 37.0 41.0 27.0 41.0 55-59 37.50085 41.0 37.0 41.0 27.0 41.0 60-64 37.45100000000001 41.0 37.0 41.0 27.0 41.0 65-69 37.2395 41.0 37.0 41.0 27.0 41.0 70-74 36.94815 41.0 37.0 41.0 26.0 41.0 75-79 36.0939 40.2 35.0 41.0 23.0 41.0 80-84 37.1636 41.0 37.0 41.0 27.0 41.0 85-89 37.30890000000001 41.0 37.0 41.0 26.0 41.0 90-94 36.818400000000004 41.0 37.0 41.0 23.0 41.0 95-99 37.019400000000005 41.0 37.0 41.0 26.0 41.0 100-104 36.73195 41.0 37.0 41.0 22.0 41.0 105-109 36.68745 41.0 37.0 41.0 22.0 41.0 110-114 36.63440000000001 41.0 37.0 41.0 22.0 41.0 115-119 36.22995 41.0 36.0 41.0 22.0 41.0 120-124 36.441649999999996 41.0 37.0 41.0 22.0 41.0 125-129 35.94125 41.0 35.0 41.0 22.0 41.0 130-134 35.949999999999996 41.0 37.0 41.0 22.0 41.0 135-139 35.55785 41.0 35.0 41.0 20.0 41.0 140-144 35.229099999999995 41.0 32.0 41.0 18.0 41.0 145-149 35.05695 41.0 33.0 41.0 16.0 41.0 150 34.6975 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 12.0 18 24.0 19 15.0 20 20.0 21 24.0 22 25.0 23 36.0 24 36.0 25 37.0 26 42.0 27 60.0 28 59.0 29 73.0 30 66.0 31 88.0 32 108.0 33 114.0 34 131.0 35 135.0 36 180.0 37 247.0 38 348.0 39 590.0 40 1527.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.49210328403108 26.67335171722236 8.097267485585359 31.737277513161192 2 19.900000000000002 27.474999999999998 37.724999999999994 14.899999999999999 3 15.925 28.549999999999997 35.0 20.525 4 21.775 33.875 25.874999999999996 18.475 5 23.724999999999998 38.6 22.3 15.375 6 18.85 37.425000000000004 25.424999999999997 18.3 7 18.7 23.425 38.800000000000004 19.075 8 16.825000000000003 25.55 32.225 25.4 9 19.900000000000002 24.8 32.625 22.675 10-14 22.475 28.925 27.400000000000002 21.2 15-19 22.46 28.53 28.199999999999996 20.810000000000002 20-24 22.21 28.875 28.23 20.685000000000002 25-29 22.495 27.985 28.33 21.19 30-34 22.439999999999998 28.825 27.6 21.135 35-39 22.715 27.96 28.249999999999996 21.075 40-44 22.06 28.785 28.285 20.87 45-49 22.14 28.27 28.395 21.195 50-54 22.155 28.175 27.994999999999997 21.675 55-59 22.59 27.744999999999997 28.455000000000002 21.21 60-64 22.925 27.445000000000004 28.435 21.195 65-69 22.825 27.87 28.24 21.065 70-74 23.5 27.915 27.175 21.41 75-79 22.895 28.49 27.425 21.19 80-84 22.695 28.68 27.16 21.465 85-89 22.68 28.194999999999997 27.560000000000002 21.565 90-94 23.195 27.305 28.57 20.93 95-99 22.925 28.485 27.345000000000002 21.245 100-104 23.14 27.97 27.51 21.38 105-109 23.125 28.360000000000003 27.500000000000004 21.015 110-114 23.14 28.185 27.935 20.74 115-119 23.54 27.99 27.339999999999996 21.13 120-124 23.380000000000003 28.125 27.425 21.07 125-129 22.975 28.494999999999997 27.605 20.925 130-134 23.695 27.73 28.105000000000004 20.47 135-139 23.825 27.779999999999998 27.465 20.93 140-144 23.369999999999997 27.985 27.58 21.065 145-149 23.72 28.685 27.42 20.175 150 23.3 29.125 27.250000000000004 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 3.0 22 3.5 23 2.0 24 3.0 25 3.5 26 4.5 27 6.0 28 7.5 29 12.5 30 18.0 31 27.0 32 36.0 33 41.0 34 52.0 35 66.5 36 94.0 37 117.5 38 146.0 39 191.0 40 229.0 41 255.5 42 262.0 43 264.0 44 266.0 45 283.5 46 273.0 47 236.5 48 214.5 49 186.5 50 151.0 51 115.5 52 91.5 53 82.0 54 66.5 55 40.0 56 29.5 57 27.0 58 23.5 59 19.0 60 14.0 61 9.0 62 5.0 63 5.0 64 4.5 65 1.5 66 0.5 67 1.0 68 2.5 69 2.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.1302974466965 90.35 2 4.501184522242696 8.55 3 0.315872598052119 0.8999999999999999 4 0.052645433008686494 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.21250000000000002 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.2625 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra Read 1225539 spots for SRR14639586.sra Written 1225539 spots for SRR14639586.sra Read 1225538 spots for SRR14639586.sra Written 1225538 spots for SRR14639586.sra SRR ids: ['SRR14639586.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nxh8rut1 SRR14639586.sra spots: 24510761 blocks: [[1, 1225538], [1225539, 2451076], [2451077, 3676614], [3676615, 4902152], [4902153, 6127690], [6127691, 7353228], [7353229, 8578766], [8578767, 9804304], [9804305, 11029842], [11029843, 12255380], [12255381, 13480918], [13480919, 14706456], [14706457, 15931994], [15931995, 17157532], [17157533, 18383070], [18383071, 19608608], [19608609, 20834146], [20834147, 22059684], [22059685, 23285222], [23285223, 24510761]] SRR14639586 file size 9073786 SRR14639586 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639586 SRR14639586_1.fastq SRR14639586_2.fastq Input file: SRR14639586_1.fastq Paired file: SRR14639586_2.fastq trimmed: SRR14639586-trimmed-pair1.fastq, SRR14639586-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 12:41:57 2025 >> started Thu Apr 10 12:42:29 2025 >> done (31.904s) 24510761 read pairs processed; of these: 141 ( 0.00%) short read pairs filtered out after trimming by size control 30 ( 0.00%) empty read pairs filtered out after trimming by size control 24510590 (100.00%) read pairs available; of these: 442386 ( 1.80%) trimmed read pairs available after processing 24068204 (98.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 13 0.00% 20 19 0.00% 21 23 0.00% 22 27 0.00% 23 35 0.00% 24 40 0.00% 25 32 0.00% 26 33 0.00% 27 34 0.00% 28 43 0.00% 29 40 0.00% 30 44 0.00% 31 35 0.00% 32 65 0.00% 33 56 0.00% 34 45 0.00% 35 53 0.00% 36 50 0.00% 37 43 0.00% 38 93 0.00% 39 65 0.00% 40 61 0.00% 41 74 0.00% 42 61 0.00% 43 73 0.00% 44 73 0.00% 45 86 0.00% 46 99 0.00% 47 87 0.00% 48 79 0.00% 49 91 0.00% 50 94 0.00% 51 99 0.00% 52 86 0.00% 53 85 0.00% 54 85 0.00% 55 117 0.00% 56 104 0.00% 57 105 0.00% 58 133 0.00% 59 120 0.00% 60 135 0.00% 61 113 0.00% 62 109 0.00% 63 157 0.00% 64 130 0.00% 65 144 0.00% 66 159 0.00% 67 148 0.00% 68 171 0.00% 69 147 0.00% 70 185 0.00% 71 173 0.00% 72 178 0.00% 73 206 0.00% 74 223 0.00% 75 216 0.00% 76 203 0.00% 77 207 0.00% 78 227 0.00% 79 234 0.00% 80 229 0.00% 81 256 0.00% 82 283 0.00% 83 286 0.00% 84 313 0.00% 85 348 0.00% 86 332 0.00% 87 329 0.00% 88 382 0.00% 89 361 0.00% 90 464 0.00% 91 437 0.00% 92 479 0.00% 93 455 0.00% 94 482 0.00% 95 552 0.00% 96 555 0.00% 97 557 0.00% 98 618 0.00% 99 670 0.00% 100 710 0.00% 101 704 0.00% 102 765 0.00% 103 801 0.00% 104 769 0.00% 105 949 0.00% 106 932 0.00% 107 956 0.00% 108 1103 0.00% 109 1126 0.00% 110 1196 0.00% 111 1190 0.00% 112 1219 0.00% 113 1252 0.01% 114 1355 0.01% 115 1413 0.01% 116 1528 0.01% 117 1649 0.01% 118 1693 0.01% 119 1764 0.01% 120 1828 0.01% 121 1980 0.01% 122 2010 0.01% 123 2114 0.01% 124 2240 0.01% 125 2280 0.01% 126 2413 0.01% 127 2601 0.01% 128 2614 0.01% 129 2740 0.01% 130 2877 0.01% 131 2923 0.01% 132 3121 0.01% 133 3223 0.01% 134 3327 0.01% 135 3511 0.01% 136 3566 0.01% 137 3862 0.02% 138 3966 0.02% 139 4058 0.02% 140 4408 0.02% 141 4376 0.02% 142 4513 0.02% 143 4598 0.02% 144 4874 0.02% 145 5158 0.02% 146 5665 0.02% 147 7769 0.03% 148 21040 0.09% 149 285080 1.16% 150 24068204 98.20% 24510590 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=33 prefix-density=0.52 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=121.96 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.6 sequence=ATAGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.67 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=80.21 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=11.6 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639586 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 12:43:14 Started mapping on | Apr 10 12:43:14 Finished on | Apr 10 12:46:22 Mapping speed, Million of reads per hour | 469.35 Number of input reads | 24510590 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 23050015 Uniquely mapped reads % | 94.04% Average mapped length | 297.48 Number of splices: Total | 24036549 Number of splices: Annotated (sjdb) | 23471947 Number of splices: GT/AG | 23594670 Number of splices: GC/AG | 358691 Number of splices: AT/AC | 16994 Number of splices: Non-canonical | 66194 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.02% Deletion average length | 3.15 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 495023 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 23006 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 965552 965552 965552 N_multimapping 495023 495023 495023 N_noFeature 713940 22759018 771448 N_ambiguous 369319 1272 135369 UnstrandedReadsAssigned:21966756 PositiveStrandReadsAssigned:289725 NegativeStrandReadsAssigned:22143198 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639586 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639586-trimmed-pair1.fastq SRR14639586-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,510,590 reads, 22,298,372 reads pseudoaligned [quant] estimated average fragment length: 368.893 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR14639586.ke.tsv 34699 SRR14639586.se.tsv 87100 total ==> SRR14639586.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1650.11 1166 27.2009 Potri.005G024800.1.v4.1 1035 667.107 417 24.0623 Potri.004G059700.1.v4.1 961 593.434 57 3.69742 Potri.007G009000.2.v4.1 1416 1048.11 0 0 Potri.003G141000.2.v4.1 2943 2575.11 2022 30.2261 Potri.016G087400.1.v4.1 270 46.5916 1371 1132.73 Potri.015G069301.1.v4.1 564 225.553 0 0 Potri.010G195200.1.v4.1 1773 1405.11 123 3.36971 Potri.012G127500.1.v4.1 977 609.325 35 2.21114 ==> SRR14639586.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 344 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 49 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR14639586 completed mapping pipeline successfully