Starting /dee2/code/volunteer_pipeline.sh SRR14639587 current disk space = 3059224805376 free memory = 1409561084 SRR14639587 SRAfilesize eaef81a59138cc0932777a6cb0dc83a7 SRR14639587.sra SRR14639587.sra file validated SRR14639587 is paired end SRR14639587 is conventional basespace SRR14639587 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639587_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6175 32.0 32.0 32.0 32.0 32.0 2 31.505 32.0 32.0 32.0 32.0 32.0 3 35.25625 37.0 32.0 37.0 32.0 37.0 4 36.18875 37.0 37.0 37.0 37.0 37.0 5 36.2925 37.0 37.0 37.0 37.0 37.0 6 39.8405 41.0 41.0 41.0 37.0 41.0 7 39.83275 41.0 41.0 41.0 37.0 41.0 8 40.174 41.0 41.0 41.0 37.0 41.0 9 40.21525 41.0 41.0 41.0 37.0 41.0 10-14 40.2193 41.0 41.0 41.0 37.8 41.0 15-19 40.17775 41.0 41.0 41.0 37.8 41.0 20-24 40.1862 41.0 41.0 41.0 38.6 41.0 25-29 40.17725 41.0 41.0 41.0 39.4 41.0 30-34 40.11405 41.0 41.0 41.0 37.8 41.0 35-39 40.068599999999996 41.0 41.0 41.0 37.0 41.0 40-44 40.0745 41.0 41.0 41.0 37.0 41.0 45-49 39.994550000000004 41.0 41.0 41.0 37.0 41.0 50-54 39.9687 41.0 41.0 41.0 37.0 41.0 55-59 39.907599999999995 41.0 41.0 41.0 37.0 41.0 60-64 39.89615 41.0 41.0 41.0 37.0 41.0 65-69 39.75375 41.0 41.0 41.0 37.0 41.0 70-74 39.581100000000006 41.0 41.0 41.0 37.0 41.0 75-79 39.1536 41.0 40.2 41.0 36.0 41.0 80-84 39.58815 41.0 41.0 41.0 37.0 41.0 85-89 39.54765 41.0 41.0 41.0 37.0 41.0 90-94 39.48969999999999 41.0 41.0 41.0 37.0 41.0 95-99 39.42205 41.0 41.0 41.0 37.0 41.0 100-104 39.36990000000001 41.0 41.0 41.0 37.0 41.0 105-109 39.29600000000001 41.0 41.0 41.0 37.0 41.0 110-114 39.17145 41.0 41.0 41.0 37.0 41.0 115-119 39.19245 41.0 41.0 41.0 37.0 41.0 120-124 39.11625 41.0 41.0 41.0 37.0 41.0 125-129 39.17100000000001 41.0 41.0 41.0 37.0 41.0 130-134 38.8776 41.0 41.0 41.0 33.0 41.0 135-139 38.6015 41.0 41.0 41.0 32.0 41.0 140-144 38.45675 41.0 40.2 41.0 32.0 41.0 145-149 38.25435 41.0 37.0 41.0 32.0 41.0 150 37.97075 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 5.0 25 7.0 26 3.0 27 9.0 28 13.0 29 27.0 30 32.0 31 29.0 32 45.0 33 51.0 34 60.0 35 91.0 36 98.0 37 168.0 38 233.0 39 469.0 40 2655.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.483120780195044 13.978494623655912 10.327581895473868 43.21080270067517 2 13.875000000000002 12.275 42.175000000000004 31.674999999999997 3 14.299999999999999 17.95 30.5 37.25 4 20.025000000000002 26.35 26.224999999999998 27.400000000000002 5 22.125 32.175 26.174999999999997 19.525000000000002 6 16.575 33.175 29.425 20.825 7 14.025000000000002 28.050000000000004 41.25 16.675 8 13.450000000000001 25.05 37.35 24.15 9 15.875 25.55 35.425000000000004 23.150000000000002 10-14 18.555 28.76 28.804999999999996 23.880000000000003 15-19 18.125 28.965000000000003 28.655 24.255 20-24 18.990000000000002 28.525 28.665000000000003 23.82 25-29 18.790000000000003 28.92 28.24 24.05 30-34 18.495 28.71 28.655 24.14 35-39 18.875 28.525 28.57 24.03 40-44 19.075 28.849999999999998 28.82 23.255 45-49 18.95 29.304999999999996 27.765 23.98 50-54 18.945 29.465000000000003 27.985 23.605 55-59 19.2 29.4 28.110000000000003 23.29 60-64 19.134999999999998 29.37 27.6 23.895 65-69 18.834999999999997 29.404999999999998 28.365000000000002 23.395 70-74 19.175 29.695 27.400000000000002 23.73 75-79 19.134999999999998 28.720000000000002 28.525 23.62 80-84 19.470000000000002 28.655 28.055000000000003 23.82 85-89 19.585 28.96 28.01 23.445 90-94 19.36 28.49 29.085 23.064999999999998 95-99 19.259999999999998 28.48 28.439999999999998 23.82 100-104 19.74 28.139999999999997 28.110000000000003 24.01 105-109 19.080954047702388 28.646432321616082 28.126406320316015 24.14620731036552 110-114 19.805 28.155 28.255000000000003 23.785 115-119 19.400000000000002 28.595 27.839999999999996 24.165 120-124 19.63 27.415 28.92 24.035 125-129 19.175 28.4 28.63 23.794999999999998 130-134 19.275000000000002 28.000000000000004 28.499999999999996 24.224999999999998 135-139 19.655 27.66 28.665000000000003 24.02 140-144 19.876956934927225 27.509628369929473 28.6600310108538 23.953383684289502 145-149 19.805 28.299999999999997 28.01 23.885 150 20.325 26.825 27.525 25.324999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 2.5 21 3.0 22 4.0 23 3.0 24 0.5 25 3.5 26 8.5 27 11.5 28 14.0 29 16.5 30 19.5 31 29.0 32 41.0 33 52.0 34 71.0 35 97.0 36 107.5 37 124.0 38 165.5 39 200.0 40 216.0 41 236.5 42 248.5 43 268.5 44 287.0 45 271.0 46 259.0 47 237.5 48 220.5 49 187.5 50 143.0 51 108.0 52 97.0 53 81.5 54 41.5 55 28.0 56 27.0 57 23.0 58 14.0 59 8.0 60 4.5 61 4.0 62 2.5 63 1.5 64 2.5 65 1.5 66 0.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.034999999999999996 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.80348193088895 89.85 2 4.879978897388551 9.25 3 0.3165391717225006 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.16249999999999998 0.0 0.0 0.0 0.0 128-129 0.175 0.0 0.0 0.0 0.0 130-131 0.175 0.0 0.0 0.0 0.0 132-133 0.175 0.0 0.0 0.0 0.0 134-135 0.175 0.0 0.0 0.0 0.0 136-137 0.175 0.0 0.0 0.0 0.0 138 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639587 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639587_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9325 32.0 32.0 32.0 32.0 32.0 2 30.825 32.0 32.0 32.0 32.0 32.0 3 33.89 37.0 32.0 37.0 32.0 37.0 4 35.0025 37.0 37.0 37.0 32.0 37.0 5 35.43375 37.0 37.0 37.0 32.0 37.0 6 38.49825 41.0 41.0 41.0 32.0 41.0 7 38.32275 41.0 37.0 41.0 32.0 41.0 8 38.45925 41.0 41.0 41.0 32.0 41.0 9 38.531 41.0 41.0 41.0 32.0 41.0 10-14 38.65505 41.0 41.0 41.0 33.0 41.0 15-19 38.33239999999999 41.0 41.0 41.0 32.0 41.0 20-24 38.29835 41.0 41.0 41.0 32.0 41.0 25-29 38.0102 41.0 39.4 41.0 30.0 41.0 30-34 37.9095 41.0 37.0 41.0 28.0 41.0 35-39 37.8258 41.0 37.0 41.0 27.0 41.0 40-44 37.659400000000005 41.0 37.0 41.0 27.0 41.0 45-49 37.47815000000001 41.0 37.0 41.0 27.0 41.0 50-54 37.35785 41.0 37.0 41.0 27.0 41.0 55-59 37.3791 41.0 37.0 41.0 27.0 41.0 60-64 37.342699999999994 41.0 37.0 41.0 27.0 41.0 65-69 37.0052 41.0 37.0 41.0 27.0 41.0 70-74 36.89395 41.0 37.0 41.0 26.0 41.0 75-79 36.099000000000004 40.2 35.0 41.0 24.0 41.0 80-84 36.99665 41.0 37.0 41.0 25.0 41.0 85-89 37.00655 41.0 37.0 41.0 24.0 41.0 90-94 36.74115 41.0 37.0 41.0 24.0 41.0 95-99 36.89975 41.0 37.0 41.0 24.0 41.0 100-104 36.5834 41.0 37.0 41.0 23.0 41.0 105-109 36.5084 41.0 37.0 41.0 22.0 41.0 110-114 36.569399999999995 41.0 37.0 41.0 22.0 41.0 115-119 36.20905 41.0 37.0 41.0 22.0 41.0 120-124 36.272450000000006 41.0 37.0 41.0 22.0 41.0 125-129 35.77025 41.0 36.0 41.0 20.0 41.0 130-134 35.86125 41.0 37.0 41.0 22.0 41.0 135-139 35.23015 41.0 34.0 41.0 18.0 41.0 140-144 34.96294999999999 41.0 32.0 41.0 16.0 41.0 145-149 34.91234999999999 40.2 32.0 41.0 14.0 41.0 150 34.5185 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 6.0 17 12.0 18 21.0 19 24.0 20 24.0 21 26.0 22 24.0 23 33.0 24 38.0 25 44.0 26 47.0 27 47.0 28 65.0 29 71.0 30 63.0 31 80.0 32 114.0 33 103.0 34 136.0 35 147.0 36 199.0 37 246.0 38 343.0 39 614.0 40 1469.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.03007518796993 28.39598997493734 10.200501253132831 29.3734335839599 2 19.675 28.199999999999996 37.25 14.875 3 17.150000000000002 28.249999999999996 34.300000000000004 20.3 4 20.8 34.0 25.7 19.5 5 23.75 38.95 21.775 15.525 6 18.7 36.75 25.7 18.85 7 19.7 22.85 37.625 19.825 8 17.25 23.525 33.475 25.75 9 19.725 25.3 31.4 23.575 10-14 22.295 28.799999999999997 27.775 21.13 15-19 22.08 27.82 28.904999999999998 21.195 20-24 22.355 27.985 28.849999999999998 20.810000000000002 25-29 22.939999999999998 28.235 28.4 20.424999999999997 30-34 22.05 27.900000000000002 28.675 21.375 35-39 21.975 28.165000000000003 28.535 21.325 40-44 22.23 28.249999999999996 28.29 21.23 45-49 22.575 28.910000000000004 27.87 20.645 50-54 22.775000000000002 27.800000000000004 28.244999999999997 21.18 55-59 23.189999999999998 27.6 28.38 20.830000000000002 60-64 22.655 28.68 28.04 20.625 65-69 23.165 28.025 27.88 20.93 70-74 22.925 28.165000000000003 27.83 21.08 75-79 22.43 28.67 27.450000000000003 21.45 80-84 23.43 28.000000000000004 27.894999999999996 20.674999999999997 85-89 22.855 28.15 27.77 21.224999999999998 90-94 22.755 28.21 28.125 20.91 95-99 22.81 28.675 28.13 20.385 100-104 23.135 28.005000000000003 28.065 20.794999999999998 105-109 23.27 28.410000000000004 27.605 20.715 110-114 23.57 28.21 28.075 20.145 115-119 23.69 28.105000000000004 27.505000000000003 20.7 120-124 23.26 28.305000000000003 27.500000000000004 20.935000000000002 125-129 23.685000000000002 28.165000000000003 27.005000000000003 21.145 130-134 23.465 28.305000000000003 27.93 20.3 135-139 23.365 29.13 27.029999999999998 20.474999999999998 140-144 23.305 28.199999999999996 28.035 20.46 145-149 23.32 28.1 27.889999999999997 20.69 150 22.55 27.775 29.349999999999998 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 3.0 19 3.5 20 2.0 21 3.5 22 4.0 23 4.0 24 3.5 25 5.0 26 7.0 27 6.0 28 9.5 29 14.5 30 20.0 31 25.0 32 33.0 33 48.5 34 62.0 35 82.5 36 101.5 37 117.0 38 148.0 39 187.0 40 210.0 41 225.5 42 253.0 43 278.5 44 277.5 45 273.5 46 259.0 47 236.5 48 217.0 49 179.0 50 144.5 51 120.5 52 95.5 53 71.5 54 66.0 55 55.5 56 42.0 57 32.0 58 20.5 59 18.0 60 14.5 61 6.0 62 2.5 63 3.0 64 2.5 65 2.0 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.54857292484944 91.225 2 4.189578423671119 8.0 3 0.2356637863315004 0.675 4 0.02618486514794449 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.1875 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.2 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.2 0.0 0.0 0.0 0.0 136-137 0.2 0.0 0.0 0.0 0.0 138 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 165 0.005713853 8.727273 6 >>END_MODULE Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193301 spots for SRR14639587.sra Written 1193301 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra Read 1193300 spots for SRR14639587.sra Written 1193300 spots for SRR14639587.sra SRR ids: ['SRR14639587.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rqft1pq8 SRR14639587.sra spots: 23866001 blocks: [[1, 1193300], [1193301, 2386600], [2386601, 3579900], [3579901, 4773200], [4773201, 5966500], [5966501, 7159800], [7159801, 8353100], [8353101, 9546400], [9546401, 10739700], [10739701, 11933000], [11933001, 13126300], [13126301, 14319600], [14319601, 15512900], [15512901, 16706200], [16706201, 17899500], [17899501, 19092800], [19092801, 20286100], [20286101, 21479400], [21479401, 22672700], [22672701, 23866001]] SRR14639587 file size 8834854 SRR14639587 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639587 SRR14639587_1.fastq SRR14639587_2.fastq Input file: SRR14639587_1.fastq Paired file: SRR14639587_2.fastq trimmed: SRR14639587-trimmed-pair1.fastq, SRR14639587-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:36:16 2025 >> started Mon Feb 10 10:36:45 2025 >> done (28.808s) 23866001 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 19 ( 0.00%) empty read pairs filtered out after trimming by size control 23865917 (100.00%) read pairs available; of these: 410891 ( 1.72%) trimmed read pairs available after processing 23455026 (98.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 14 0.00% 21 18 0.00% 22 19 0.00% 23 28 0.00% 24 37 0.00% 25 26 0.00% 26 35 0.00% 27 37 0.00% 28 43 0.00% 29 29 0.00% 30 37 0.00% 31 34 0.00% 32 38 0.00% 33 46 0.00% 34 38 0.00% 35 53 0.00% 36 45 0.00% 37 54 0.00% 38 78 0.00% 39 57 0.00% 40 73 0.00% 41 53 0.00% 42 70 0.00% 43 59 0.00% 44 63 0.00% 45 73 0.00% 46 70 0.00% 47 75 0.00% 48 73 0.00% 49 73 0.00% 50 87 0.00% 51 97 0.00% 52 89 0.00% 53 103 0.00% 54 68 0.00% 55 92 0.00% 56 109 0.00% 57 115 0.00% 58 102 0.00% 59 108 0.00% 60 126 0.00% 61 123 0.00% 62 114 0.00% 63 134 0.00% 64 118 0.00% 65 123 0.00% 66 143 0.00% 67 137 0.00% 68 127 0.00% 69 155 0.00% 70 146 0.00% 71 146 0.00% 72 172 0.00% 73 186 0.00% 74 172 0.00% 75 158 0.00% 76 203 0.00% 77 201 0.00% 78 231 0.00% 79 212 0.00% 80 212 0.00% 81 216 0.00% 82 231 0.00% 83 241 0.00% 84 271 0.00% 85 281 0.00% 86 324 0.00% 87 314 0.00% 88 340 0.00% 89 334 0.00% 90 311 0.00% 91 381 0.00% 92 393 0.00% 93 404 0.00% 94 412 0.00% 95 448 0.00% 96 470 0.00% 97 460 0.00% 98 459 0.00% 99 466 0.00% 100 537 0.00% 101 534 0.00% 102 614 0.00% 103 584 0.00% 104 674 0.00% 105 700 0.00% 106 716 0.00% 107 754 0.00% 108 719 0.00% 109 875 0.00% 110 830 0.00% 111 909 0.00% 112 946 0.00% 113 975 0.00% 114 1114 0.00% 115 1116 0.00% 116 1161 0.00% 117 1275 0.01% 118 1354 0.01% 119 1310 0.01% 120 1399 0.01% 121 1456 0.01% 122 1618 0.01% 123 1572 0.01% 124 1668 0.01% 125 1766 0.01% 126 1879 0.01% 127 1911 0.01% 128 1898 0.01% 129 2151 0.01% 130 2304 0.01% 131 2297 0.01% 132 2299 0.01% 133 2491 0.01% 134 2489 0.01% 135 2582 0.01% 136 2823 0.01% 137 2846 0.01% 138 3019 0.01% 139 3086 0.01% 140 3249 0.01% 141 3364 0.01% 142 3489 0.01% 143 3638 0.02% 144 4011 0.02% 145 4103 0.02% 146 4602 0.02% 147 6636 0.03% 148 19778 0.08% 149 284233 1.19% 150 23455026 98.28% 23865917 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=151.44 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=26.0 sequence=TCATCTTCTTCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.55 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=103.99 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=18.6 sequence=CTCTCTCTTTCAAACCCTA SRR14639587 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:37:40 Started mapping on | Feb 10 10:37:40 Finished on | Feb 10 10:40:26 Mapping speed, Million of reads per hour | 517.57 Number of input reads | 23865917 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22226222 Uniquely mapped reads % | 93.13% Average mapped length | 297.37 Number of splices: Total | 22632482 Number of splices: Annotated (sjdb) | 22075823 Number of splices: GT/AG | 22216804 Number of splices: GC/AG | 328706 Number of splices: AT/AC | 17455 Number of splices: Non-canonical | 69517 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.03% Deletion average length | 3.14 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 573500 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 38015 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1066195 1066195 1066195 N_multimapping 573500 573500 573500 N_noFeature 734548 21961351 791184 N_ambiguous 371347 1249 162733 UnstrandedReadsAssigned:21120327 PositiveStrandReadsAssigned:263622 NegativeStrandReadsAssigned:21272305 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639587 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639587-trimmed-pair1.fastq SRR14639587-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,865,917 reads, 21,505,471 reads pseudoaligned [quant] estimated average fragment length: 368.383 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR14639587.ke.tsv 34699 SRR14639587.se.tsv 87100 total ==> SRR14639587.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1650.62 2736 65.6017 Potri.005G024800.1.v4.1 1035 667.617 930 55.1317 Potri.004G059700.1.v4.1 961 594.074 125 8.32751 Potri.007G009000.2.v4.1 1416 1048.62 0 0 Potri.003G141000.2.v4.1 2943 2575.62 2024 31.101 Potri.016G087400.1.v4.1 270 44.3425 2093 1868.07 Potri.015G069301.1.v4.1 564 225.272 0 0 Potri.010G195200.1.v4.1 1773 1405.62 405 11.4034 Potri.012G127500.1.v4.1 977 609.81 34 2.20663 ==> SRR14639587.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 192 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 311 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR14639587 completed mapping pipeline successfully