Starting /dee2/code/volunteer_pipeline.sh SRR14639588 current disk space = 3059245580288 free memory = 1402997300 SRR14639588 SRAfilesize 2214f6d4b4af84184992423c72f9cbc2 SRR14639588.sra SRR14639588.sra file validated SRR14639588 is paired end SRR14639588 is conventional basespace SRR14639588 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639588_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66875 32.0 32.0 32.0 32.0 32.0 2 31.57125 32.0 32.0 32.0 32.0 32.0 3 35.28375 37.0 32.0 37.0 32.0 37.0 4 36.16375 37.0 37.0 37.0 37.0 37.0 5 36.30625 37.0 37.0 37.0 37.0 37.0 6 39.85075 41.0 41.0 41.0 37.0 41.0 7 39.7815 41.0 41.0 41.0 37.0 41.0 8 40.19225 41.0 41.0 41.0 37.0 41.0 9 40.18975 41.0 41.0 41.0 37.0 41.0 10-14 40.26685 41.0 41.0 41.0 40.2 41.0 15-19 40.258 41.0 41.0 41.0 39.4 41.0 20-24 40.26995 41.0 41.0 41.0 41.0 41.0 25-29 40.228950000000005 41.0 41.0 41.0 41.0 41.0 30-34 40.2462 41.0 41.0 41.0 41.0 41.0 35-39 40.148900000000005 41.0 41.0 41.0 38.6 41.0 40-44 40.09265 41.0 41.0 41.0 37.0 41.0 45-49 40.05985 41.0 41.0 41.0 37.0 41.0 50-54 40.01035 41.0 41.0 41.0 37.0 41.0 55-59 39.938649999999996 41.0 41.0 41.0 37.0 41.0 60-64 39.912699999999994 41.0 41.0 41.0 37.0 41.0 65-69 39.82619999999999 41.0 41.0 41.0 37.0 41.0 70-74 39.61105 41.0 41.0 41.0 37.0 41.0 75-79 39.1996 41.0 40.2 41.0 36.0 41.0 80-84 39.68415 41.0 41.0 41.0 37.0 41.0 85-89 39.645450000000004 41.0 41.0 41.0 37.0 41.0 90-94 39.600049999999996 41.0 41.0 41.0 37.0 41.0 95-99 39.572050000000004 41.0 41.0 41.0 37.0 41.0 100-104 39.42864999999999 41.0 41.0 41.0 37.0 41.0 105-109 39.3362 41.0 41.0 41.0 37.0 41.0 110-114 39.30525 41.0 41.0 41.0 37.0 41.0 115-119 39.36025 41.0 41.0 41.0 37.0 41.0 120-124 39.299850000000006 41.0 41.0 41.0 37.0 41.0 125-129 39.31255 41.0 41.0 41.0 37.0 41.0 130-134 38.9791 41.0 41.0 41.0 34.0 41.0 135-139 38.710950000000004 41.0 41.0 41.0 32.0 41.0 140-144 38.47885 41.0 40.2 41.0 32.0 41.0 145-149 38.3227 41.0 37.0 41.0 32.0 41.0 150 38.10075 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 0.0 24 1.0 25 6.0 26 5.0 27 9.0 28 17.0 29 20.0 30 28.0 31 25.0 32 38.0 33 54.0 34 58.0 35 70.0 36 103.0 37 174.0 38 216.0 39 493.0 40 2679.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.26763381690846 13.431715857928964 11.405702851425712 39.89494747373687 2 14.075 13.600000000000001 42.675000000000004 29.65 3 15.0 18.675 29.975 36.35 4 19.425 26.275 26.974999999999998 27.325 5 20.75 33.775 27.975 17.5 6 16.575 32.324999999999996 29.95 21.15 7 13.575000000000001 27.3 41.725 17.4 8 13.55 25.05 37.625 23.775 9 14.249999999999998 24.95 35.025 25.775 10-14 18.55 28.449999999999996 29.205 23.794999999999998 15-19 18.529999999999998 28.665000000000003 28.105000000000004 24.7 20-24 18.59 29.01 28.305000000000003 24.095 25-29 18.55 28.54 28.76 24.15 30-34 18.33 28.915000000000003 28.904999999999998 23.849999999999998 35-39 18.73 28.65 28.49 24.13 40-44 18.895 29.885 27.415 23.805 45-49 19.595000000000002 28.71 27.894999999999996 23.799999999999997 50-54 19.195 29.04 27.694999999999997 24.07 55-59 19.38 28.799999999999997 28.565 23.255 60-64 19.005 28.910000000000004 28.050000000000004 24.035 65-69 19.064999999999998 28.660000000000004 28.24 24.035 70-74 19.59 28.38 28.28 23.75 75-79 19.175 28.515 28.38 23.93 80-84 18.915000000000003 28.7 28.22 24.165 85-89 19.64 28.76 27.985 23.615 90-94 19.52 28.29 28.34 23.849999999999998 95-99 19.53 28.349999999999998 27.785 24.335 100-104 19.425 28.21 28.355000000000004 24.01 105-109 19.99599979999 28.471423571178562 27.966398319915996 23.566178308915443 110-114 19.605 29.220000000000002 27.63 23.544999999999998 115-119 19.74 28.599999999999998 27.77 23.89 120-124 19.900000000000002 28.62 28.050000000000004 23.43 125-129 19.794999999999998 28.405 28.165000000000003 23.635 130-134 19.705000000000002 28.27 28.15 23.875 135-139 19.82 28.575 27.950000000000003 23.655 140-144 19.802970445566835 28.244236635495323 28.144221633244985 23.808571285692853 145-149 20.305 28.044999999999998 27.884999999999998 23.765 150 18.275 27.150000000000002 28.375 26.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 3.5 25 4.0 26 9.5 27 11.5 28 9.0 29 17.0 30 25.0 31 34.0 32 46.0 33 58.0 34 71.0 35 88.0 36 108.0 37 122.5 38 143.0 39 186.0 40 215.5 41 230.0 42 260.0 43 264.5 44 282.0 45 277.5 46 246.0 47 242.5 48 206.0 49 178.0 50 145.0 51 111.0 52 110.0 53 84.5 54 55.5 55 40.0 56 29.5 57 23.5 58 15.5 59 9.0 60 7.5 61 5.5 62 3.5 63 2.5 64 2.5 65 2.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 1.5 72 1.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.20366923690507 88.575 2 5.2911459718160065 9.950000000000001 3 0.47859611805370916 1.35 4 0.0 0.0 5 0.026588673225206066 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.0875 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.125 0.0 0.0 0.0 0.0 134-135 0.1375 0.0 0.0 0.0 0.0 136-137 0.15 0.0 0.0 0.0 0.0 138 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGAT 15 1.1730364E-4 144.0 1 >>END_MODULE SRR14639588 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639588_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.81625 32.0 32.0 32.0 32.0 32.0 2 30.7725 32.0 32.0 32.0 32.0 32.0 3 33.9275 37.0 32.0 37.0 32.0 37.0 4 34.9925 37.0 37.0 37.0 32.0 37.0 5 35.2675 37.0 37.0 37.0 32.0 37.0 6 38.5785 41.0 41.0 41.0 32.0 41.0 7 38.36 41.0 37.0 41.0 32.0 41.0 8 38.3595 41.0 41.0 41.0 32.0 41.0 9 38.53225 41.0 41.0 41.0 32.0 41.0 10-14 38.704699999999995 41.0 41.0 41.0 34.0 41.0 15-19 38.54915 41.0 41.0 41.0 32.0 41.0 20-24 38.374750000000006 41.0 41.0 41.0 32.0 41.0 25-29 37.941250000000004 41.0 38.6 41.0 29.0 41.0 30-34 37.89415 41.0 37.0 41.0 28.0 41.0 35-39 37.80335 41.0 37.0 41.0 28.0 41.0 40-44 37.65105 41.0 37.0 41.0 27.0 41.0 45-49 37.56425 41.0 37.0 41.0 27.0 41.0 50-54 37.44415 41.0 37.0 41.0 27.0 41.0 55-59 37.31785 41.0 37.0 41.0 27.0 41.0 60-64 37.29165 41.0 37.0 41.0 27.0 41.0 65-69 37.0086 41.0 37.0 41.0 27.0 41.0 70-74 36.83265 41.0 37.0 41.0 25.0 41.0 75-79 35.9973 40.2 35.0 41.0 23.0 41.0 80-84 36.9264 41.0 37.0 41.0 22.0 41.0 85-89 37.0458 41.0 37.0 41.0 25.0 41.0 90-94 36.7114 41.0 37.0 41.0 22.0 41.0 95-99 36.82505 41.0 37.0 41.0 23.0 41.0 100-104 36.4919 41.0 37.0 41.0 22.0 41.0 105-109 36.543600000000005 41.0 37.0 41.0 22.0 41.0 110-114 36.54174999999999 41.0 37.0 41.0 22.0 41.0 115-119 36.17375 41.0 36.0 41.0 22.0 41.0 120-124 36.232150000000004 41.0 37.0 41.0 22.0 41.0 125-129 35.714600000000004 41.0 35.0 41.0 20.0 41.0 130-134 35.7494 41.0 37.0 41.0 22.0 41.0 135-139 35.293099999999995 41.0 34.0 41.0 20.0 41.0 140-144 35.03475 41.0 32.0 41.0 18.0 41.0 145-149 34.879149999999996 41.0 32.0 41.0 14.0 41.0 150 34.57075 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 7.0 17 17.0 18 21.0 19 20.0 20 28.0 21 31.0 22 38.0 23 32.0 24 36.0 25 33.0 26 47.0 27 45.0 28 55.0 29 63.0 30 80.0 31 92.0 32 97.0 33 105.0 34 118.0 35 172.0 36 176.0 37 242.0 38 349.0 39 552.0 40 1541.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.22389558232932 27.00803212851406 8.860441767068274 26.907630522088354 2 19.7 27.0 37.0 16.3 3 16.075 27.800000000000004 35.6 20.525 4 21.975 34.375 24.5 19.15 5 21.6 39.7 22.725 15.975 6 17.75 36.875 26.625 18.75 7 20.849999999999998 23.175 36.4 19.575 8 17.299999999999997 25.75 31.7 25.25 9 17.5 27.05 32.275 23.175 10-14 22.189999999999998 28.860000000000003 27.61 21.34 15-19 21.67 28.599999999999998 28.095 21.634999999999998 20-24 22.175 28.575 28.355000000000004 20.895 25-29 22.34 28.18 28.044999999999998 21.435000000000002 30-34 22.07 29.03 28.025 20.875 35-39 22.075 28.060000000000002 28.07 21.795 40-44 22.225 28.03 28.17 21.575 45-49 22.035 28.76 27.800000000000004 21.404999999999998 50-54 22.23 28.77 27.735 21.265 55-59 22.5 27.905 28.435 21.16 60-64 21.805 27.950000000000003 28.68 21.565 65-69 22.259999999999998 28.065 28.144999999999996 21.529999999999998 70-74 23.555 27.71 27.54 21.195 75-79 23.405 27.495000000000005 27.72 21.38 80-84 22.93 27.855 28.075 21.14 85-89 23.189999999999998 28.000000000000004 27.46 21.349999999999998 90-94 22.89 28.050000000000004 27.339999999999996 21.72 95-99 22.8 27.565 28.525 21.11 100-104 23.65 27.700000000000003 27.785 20.865000000000002 105-109 23.115 28.389999999999997 27.794999999999998 20.7 110-114 22.835 28.395 27.575 21.195 115-119 23.66 27.839999999999996 27.26 21.240000000000002 120-124 23.025000000000002 27.88 28.134999999999998 20.96 125-129 22.770000000000003 27.689999999999998 28.285 21.255 130-134 24.44 27.474999999999998 27.6 20.485 135-139 23.05 27.339999999999996 28.24 21.37 140-144 23.200000000000003 27.77 27.85 21.18 145-149 23.5 28.294999999999998 27.6 20.605 150 21.875 28.449999999999996 29.175 20.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 1.0 23 2.0 24 3.0 25 5.0 26 5.5 27 3.5 28 6.5 29 14.0 30 19.5 31 26.0 32 33.5 33 46.5 34 63.0 35 82.0 36 108.0 37 128.0 38 155.0 39 185.0 40 206.5 41 230.0 42 254.0 43 282.0 44 275.5 45 248.0 46 248.0 47 223.5 48 203.5 49 182.0 50 159.0 51 139.5 52 103.0 53 77.0 54 60.5 55 48.0 56 33.5 57 34.5 58 31.5 59 20.5 60 11.0 61 8.0 62 7.0 63 6.0 64 4.0 65 1.5 66 1.5 67 1.0 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.12901527119536 90.325 2 4.44971037388099 8.450000000000001 3 0.3949447077409162 1.125 4 0.02632964718272775 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.1375 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.175 0.0 0.0 0.0 0.0 128-129 0.175 0.0 0.0 0.0 0.0 130-131 0.175 0.0 0.0 0.0 0.0 132-133 0.175 0.0 0.0 0.0 0.0 134-135 0.1875 0.0 0.0 0.0 0.0 136-137 0.2 0.0 0.0 0.0 0.0 138 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACAG 10 0.006973645 144.0 4 >>END_MODULE Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra Read 1058024 spots for SRR14639588.sra Written 1058024 spots for SRR14639588.sra Read 1058009 spots for SRR14639588.sra Written 1058009 spots for SRR14639588.sra SRR ids: ['SRR14639588.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ujuve0ly SRR14639588.sra spots: 21160195 blocks: [[1, 1058009], [1058010, 2116018], [2116019, 3174027], [3174028, 4232036], [4232037, 5290045], [5290046, 6348054], [6348055, 7406063], [7406064, 8464072], [8464073, 9522081], [9522082, 10580090], [10580091, 11638099], [11638100, 12696108], [12696109, 13754117], [13754118, 14812126], [14812127, 15870135], [15870136, 16928144], [16928145, 17986153], [17986154, 19044162], [19044163, 20102171], [20102172, 21160195]] SRR14639588 file size 7831942 SRR14639588 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639588 SRR14639588_1.fastq SRR14639588_2.fastq Input file: SRR14639588_1.fastq Paired file: SRR14639588_2.fastq trimmed: SRR14639588-trimmed-pair1.fastq, SRR14639588-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:41:13 2025 >> started Mon Feb 10 10:41:43 2025 >> done (29.921s) 21160195 read pairs processed; of these: 103 ( 0.00%) short read pairs filtered out after trimming by size control 25 ( 0.00%) empty read pairs filtered out after trimming by size control 21160067 (100.00%) read pairs available; of these: 409623 ( 1.94%) trimmed read pairs available after processing 20750444 (98.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 24 0.00% 20 22 0.00% 21 20 0.00% 22 22 0.00% 23 20 0.00% 24 36 0.00% 25 32 0.00% 26 36 0.00% 27 35 0.00% 28 26 0.00% 29 32 0.00% 30 44 0.00% 31 46 0.00% 32 57 0.00% 33 47 0.00% 34 50 0.00% 35 55 0.00% 36 45 0.00% 37 48 0.00% 38 54 0.00% 39 53 0.00% 40 55 0.00% 41 43 0.00% 42 54 0.00% 43 62 0.00% 44 72 0.00% 45 56 0.00% 46 79 0.00% 47 72 0.00% 48 74 0.00% 49 79 0.00% 50 77 0.00% 51 71 0.00% 52 89 0.00% 53 58 0.00% 54 91 0.00% 55 101 0.00% 56 119 0.00% 57 70 0.00% 58 108 0.00% 59 91 0.00% 60 91 0.00% 61 100 0.00% 62 119 0.00% 63 134 0.00% 64 124 0.00% 65 91 0.00% 66 124 0.00% 67 132 0.00% 68 97 0.00% 69 118 0.00% 70 143 0.00% 71 144 0.00% 72 145 0.00% 73 171 0.00% 74 167 0.00% 75 162 0.00% 76 160 0.00% 77 163 0.00% 78 185 0.00% 79 201 0.00% 80 204 0.00% 81 198 0.00% 82 237 0.00% 83 235 0.00% 84 257 0.00% 85 270 0.00% 86 247 0.00% 87 271 0.00% 88 295 0.00% 89 308 0.00% 90 303 0.00% 91 358 0.00% 92 358 0.00% 93 369 0.00% 94 386 0.00% 95 452 0.00% 96 423 0.00% 97 496 0.00% 98 463 0.00% 99 481 0.00% 100 530 0.00% 101 576 0.00% 102 581 0.00% 103 612 0.00% 104 700 0.00% 105 731 0.00% 106 700 0.00% 107 766 0.00% 108 814 0.00% 109 885 0.00% 110 911 0.00% 111 998 0.00% 112 1024 0.00% 113 1145 0.01% 114 1109 0.01% 115 1190 0.01% 116 1276 0.01% 117 1443 0.01% 118 1422 0.01% 119 1405 0.01% 120 1561 0.01% 121 1669 0.01% 122 1644 0.01% 123 1934 0.01% 124 1942 0.01% 125 2092 0.01% 126 2193 0.01% 127 2272 0.01% 128 2394 0.01% 129 2484 0.01% 130 2579 0.01% 131 2684 0.01% 132 2914 0.01% 133 2931 0.01% 134 3065 0.01% 135 3206 0.02% 136 3412 0.02% 137 3448 0.02% 138 3613 0.02% 139 3917 0.02% 140 4164 0.02% 141 4269 0.02% 142 4391 0.02% 143 4713 0.02% 144 4878 0.02% 145 5222 0.02% 146 5569 0.03% 147 7920 0.04% 148 21073 0.10% 149 264932 1.25% 150 20750444 98.06% 21160067 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=34 prefix-density=0.49 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=147.09 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=24.4 sequence=TCATCTTCTTCT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=37 prefix-density=0.64 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=106.14 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.8 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639588 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:42:49 Started mapping on | Feb 10 10:42:50 Finished on | Feb 10 10:45:22 Mapping speed, Million of reads per hour | 501.16 Number of input reads | 21160067 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19631675 Uniquely mapped reads % | 92.78% Average mapped length | 297.31 Number of splices: Total | 20432334 Number of splices: Annotated (sjdb) | 19949853 Number of splices: GT/AG | 20056407 Number of splices: GC/AG | 300797 Number of splices: AT/AC | 15101 Number of splices: Non-canonical | 60029 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.03% Deletion average length | 3.15 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435597 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 18098 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1092795 1092795 1092795 N_multimapping 435597 435597 435597 N_noFeature 666676 19390201 716676 N_ambiguous 309497 1022 117664 UnstrandedReadsAssigned:18655502 PositiveStrandReadsAssigned:240452 NegativeStrandReadsAssigned:18797335 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639588 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639588-trimmed-pair1.fastq SRR14639588-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,160,067 reads, 19,050,561 reads pseudoaligned [quant] estimated average fragment length: 359.242 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52401 SRR14639588.ke.tsv 34699 SRR14639588.se.tsv 87100 total ==> SRR14639588.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1659.76 1041 28.3533 Potri.005G024800.1.v4.1 1035 676.758 402 26.8528 Potri.004G059700.1.v4.1 961 603.285 52 3.89653 Potri.007G009000.2.v4.1 1416 1057.76 0 0 Potri.003G141000.2.v4.1 2943 2584.76 1728 30.2218 Potri.016G087400.1.v4.1 270 48.6432 1376 1278.77 Potri.015G069301.1.v4.1 564 238.322 0 0 Potri.010G195200.1.v4.1 1773 1414.76 105 3.35509 Potri.012G127500.1.v4.1 977 619.035 45 3.28621 ==> SRR14639588.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 45 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR14639588 completed mapping pipeline successfully