Starting /dee2/code/volunteer_pipeline.sh SRR14639589 current disk space = 3059087200256 free memory = 1474651340 SRR14639589 SRAfilesize 9a76a62af12fb4dbfc0c0a8e8a6d9f9c SRR14639589.sra SRR14639589.sra file validated SRR14639589 is paired end SRR14639589 is conventional basespace SRR14639589 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639589_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.60125 32.0 32.0 32.0 32.0 32.0 2 31.57875 32.0 32.0 32.0 32.0 32.0 3 35.2975 37.0 32.0 37.0 32.0 37.0 4 36.22625 37.0 37.0 37.0 37.0 37.0 5 36.285 37.0 37.0 37.0 37.0 37.0 6 39.8005 41.0 41.0 41.0 37.0 41.0 7 39.84875 41.0 41.0 41.0 37.0 41.0 8 40.0445 41.0 41.0 41.0 37.0 41.0 9 40.159 41.0 41.0 41.0 37.0 41.0 10-14 40.20245 41.0 41.0 41.0 38.6 41.0 15-19 40.2474 41.0 41.0 41.0 39.4 41.0 20-24 40.253949999999996 41.0 41.0 41.0 39.4 41.0 25-29 40.2142 41.0 41.0 41.0 41.0 41.0 30-34 40.167950000000005 41.0 41.0 41.0 38.6 41.0 35-39 40.134699999999995 41.0 41.0 41.0 37.8 41.0 40-44 40.053399999999996 41.0 41.0 41.0 37.0 41.0 45-49 40.0119 41.0 41.0 41.0 37.0 41.0 50-54 39.9644 41.0 41.0 41.0 37.0 41.0 55-59 39.908699999999996 41.0 41.0 41.0 37.0 41.0 60-64 39.856649999999995 41.0 41.0 41.0 37.0 41.0 65-69 39.76655 41.0 41.0 41.0 37.0 41.0 70-74 39.619800000000005 41.0 41.0 41.0 37.0 41.0 75-79 39.150099999999995 41.0 40.2 41.0 36.0 41.0 80-84 39.6765 41.0 41.0 41.0 37.0 41.0 85-89 39.57520000000001 41.0 41.0 41.0 37.0 41.0 90-94 39.51625 41.0 41.0 41.0 37.0 41.0 95-99 39.458600000000004 41.0 41.0 41.0 37.0 41.0 100-104 39.377300000000005 41.0 41.0 41.0 37.0 41.0 105-109 39.32495 41.0 41.0 41.0 37.0 41.0 110-114 39.31465 41.0 41.0 41.0 37.0 41.0 115-119 39.2174 41.0 41.0 41.0 36.0 41.0 120-124 39.12165 41.0 41.0 41.0 37.0 41.0 125-129 39.1342 41.0 41.0 41.0 37.0 41.0 130-134 38.9397 41.0 41.0 41.0 34.0 41.0 135-139 38.67229999999999 41.0 41.0 41.0 32.0 41.0 140-144 38.39285 41.0 40.2 41.0 32.0 41.0 145-149 38.1785 41.0 37.0 41.0 32.0 41.0 150 38.09675 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 4.0 24 2.0 25 3.0 26 9.0 27 16.0 28 12.0 29 25.0 30 17.0 31 37.0 32 31.0 33 49.0 34 60.0 35 82.0 36 104.0 37 160.0 38 254.0 39 518.0 40 2615.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.874999999999996 12.85 9.4 45.875 2 14.075 11.625 44.85 29.45 3 14.499999999999998 16.425 31.15 37.925 4 20.125 25.275 25.8 28.799999999999997 5 21.349999999999998 33.45 26.974999999999998 18.224999999999998 6 16.525000000000002 32.975 29.25 21.25 7 13.350000000000001 28.050000000000004 40.849999999999994 17.75 8 13.375 24.5 38.824999999999996 23.3 9 15.475 25.2 36.025 23.3 10-14 18.59 29.134999999999998 29.220000000000002 23.055 15-19 18.68 28.139999999999997 28.970000000000002 24.21 20-24 19.2 28.000000000000004 28.665000000000003 24.135 25-29 18.745 29.205 28.03 24.02 30-34 18.11 29.049999999999997 27.865000000000002 24.975 35-39 18.815 29.235 28.015 23.935000000000002 40-44 19.295 28.965000000000003 28.265 23.474999999999998 45-49 18.345 29.685 27.915 24.055 50-54 19.16 28.42 28.355000000000004 24.065 55-59 19.32 28.965000000000003 28.005000000000003 23.71 60-64 18.64 29.21 28.549999999999997 23.599999999999998 65-69 19.09 28.444999999999997 28.585 23.880000000000003 70-74 19.24 29.185 27.500000000000004 24.075 75-79 19.175 28.68 28.475 23.669999999999998 80-84 19.2 29.09 28.275 23.435 85-89 18.509999999999998 28.910000000000004 27.775 24.805 90-94 19.53 29.275000000000002 27.495000000000005 23.7 95-99 18.925 28.84 28.105000000000004 24.13 100-104 19.625 28.335 28.13 23.91 105-109 19.64 28.205000000000002 28.26 23.895 110-114 19.265 28.335 28.799999999999997 23.599999999999998 115-119 19.48 28.305000000000003 28.28 23.935000000000002 120-124 19.21 28.705000000000002 28.675 23.41 125-129 19.400000000000002 27.97 28.875 23.755000000000003 130-134 19.84 28.215 28.244999999999997 23.7 135-139 19.655 28.185 27.565 24.595 140-144 19.966996699669966 27.802780278027804 28.577857785778576 23.652365236523654 145-149 19.715 28.765 27.68 23.84 150 19.1 28.775000000000002 28.249999999999996 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 2.0 24 4.0 25 5.0 26 6.0 27 6.0 28 9.0 29 15.5 30 19.0 31 20.0 32 35.0 33 50.5 34 68.0 35 90.0 36 100.0 37 120.0 38 162.5 39 200.5 40 218.0 41 232.5 42 260.0 43 296.5 44 308.5 45 279.0 46 267.0 47 250.5 48 217.0 49 181.5 50 138.5 51 103.0 52 73.5 53 64.5 54 54.0 55 43.0 56 31.0 57 20.0 58 12.5 59 7.0 60 4.0 61 4.0 62 5.0 63 3.0 64 1.5 65 0.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12858660998937 88.575 2 5.499468650371945 10.35 3 0.34537725823591925 0.975 4 0.026567481402763018 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.037500000000000006 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.075 0.0 0.0 0.0 0.0 122-123 0.075 0.0 0.0 0.0 0.0 124-125 0.075 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.16249999999999998 0.0 0.0 0.0 0.0 130-131 0.175 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.2 0.0 0.0 0.0 0.0 136-137 0.21250000000000002 0.0 0.0 0.0 0.0 138 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCACA 10 0.006973645 144.0 7 CCACAAC 10 0.006973645 144.0 9 GAATCCA 10 0.006973645 144.0 9 TGAATCC 10 0.006973645 144.0 8 >>END_MODULE SRR14639589 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639589_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8275 32.0 32.0 32.0 32.0 32.0 2 30.70875 32.0 32.0 32.0 32.0 32.0 3 33.9575 37.0 32.0 37.0 32.0 37.0 4 35.06625 37.0 37.0 37.0 32.0 37.0 5 35.305 37.0 37.0 37.0 32.0 37.0 6 38.487 41.0 37.0 41.0 32.0 41.0 7 38.25575 41.0 41.0 41.0 32.0 41.0 8 38.21375 41.0 41.0 41.0 32.0 41.0 9 38.49225 41.0 41.0 41.0 32.0 41.0 10-14 38.69814999999999 41.0 41.0 41.0 33.0 41.0 15-19 38.43385 41.0 41.0 41.0 32.0 41.0 20-24 38.29895 41.0 41.0 41.0 32.0 41.0 25-29 37.87855 41.0 37.8 41.0 29.0 41.0 30-34 37.867200000000004 41.0 37.0 41.0 27.0 41.0 35-39 37.77835 41.0 37.0 41.0 27.0 41.0 40-44 37.534150000000004 41.0 37.0 41.0 27.0 41.0 45-49 37.469100000000005 41.0 37.0 41.0 27.0 41.0 50-54 37.36704999999999 41.0 37.0 41.0 27.0 41.0 55-59 37.22165 41.0 37.0 41.0 27.0 41.0 60-64 37.272 41.0 37.0 41.0 27.0 41.0 65-69 37.06655000000001 41.0 37.0 41.0 27.0 41.0 70-74 36.8248 41.0 37.0 41.0 25.0 41.0 75-79 35.885650000000005 40.2 35.0 41.0 22.0 41.0 80-84 36.885149999999996 41.0 37.0 41.0 24.0 41.0 85-89 36.967949999999995 41.0 37.0 41.0 24.0 41.0 90-94 36.523700000000005 41.0 37.0 41.0 22.0 41.0 95-99 36.61409999999999 41.0 37.0 41.0 22.0 41.0 100-104 36.4139 41.0 37.0 41.0 23.0 41.0 105-109 36.38695 41.0 37.0 41.0 22.0 41.0 110-114 36.457049999999995 41.0 37.0 41.0 22.0 41.0 115-119 36.0598 41.0 36.0 41.0 20.0 41.0 120-124 36.21095 41.0 37.0 41.0 22.0 41.0 125-129 35.566250000000004 41.0 34.0 41.0 18.0 41.0 130-134 35.53805 41.0 33.0 41.0 22.0 41.0 135-139 35.1633 41.0 33.0 41.0 18.0 41.0 140-144 34.842499999999994 41.0 32.0 41.0 16.0 41.0 145-149 34.7431 40.2 32.0 41.0 12.0 41.0 150 34.34375 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 5.0 17 13.0 18 24.0 19 22.0 20 22.0 21 22.0 22 40.0 23 23.0 24 37.0 25 53.0 26 63.0 27 63.0 28 55.0 29 67.0 30 69.0 31 87.0 32 85.0 33 115.0 34 144.0 35 148.0 36 213.0 37 250.0 38 346.0 39 563.0 40 1469.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.856425702811244 27.434738955823295 8.358433734939759 31.350401606425706 2 19.575 27.025 38.925 14.475 3 16.650000000000002 26.924999999999997 34.925 21.5 4 21.7 34.75 23.625 19.925 5 22.275 39.775 22.675 15.275 6 18.075 38.375 25.775 17.775 7 19.15 23.200000000000003 37.125 20.525 8 16.575 24.525 33.95 24.95 9 19.5 24.224999999999998 33.15 23.125 10-14 22.21 28.76 27.235 21.795 15-19 21.95 28.775000000000002 28.025 21.25 20-24 22.155 28.349999999999998 28.815 20.68 25-29 22.21 28.105000000000004 28.685 21.0 30-34 22.21 28.310000000000002 28.655 20.825 35-39 22.335 28.155 28.449999999999996 21.060000000000002 40-44 22.009999999999998 28.675 28.21 21.105 45-49 21.59 28.275 28.754999999999995 21.38 50-54 21.98 29.005 27.92 21.095 55-59 22.830000000000002 28.355000000000004 27.98 20.835 60-64 22.74 28.310000000000002 28.15 20.8 65-69 22.675 28.23 27.74 21.355 70-74 22.62 28.455000000000002 28.015 20.91 75-79 22.875 27.865000000000002 28.544999999999998 20.715 80-84 23.56 28.105000000000004 27.615000000000002 20.72 85-89 23.06 27.955000000000002 28.505000000000003 20.48 90-94 22.814999999999998 27.915 28.335 20.935000000000002 95-99 22.59 28.365000000000002 28.360000000000003 20.685000000000002 100-104 22.99 28.000000000000004 27.625 21.385 105-109 22.615 27.99 28.575 20.82 110-114 22.97 28.555000000000003 28.035 20.44 115-119 23.455000000000002 27.944999999999997 27.605 20.995 120-124 23.445 28.525 27.555000000000003 20.474999999999998 125-129 22.705000000000002 27.71 28.835 20.75 130-134 23.565 28.494999999999997 27.779999999999998 20.16 135-139 23.165 28.105000000000004 27.42 21.310000000000002 140-144 22.55 27.85 28.48 21.12 145-149 23.14 27.860000000000003 28.01 20.990000000000002 150 22.900000000000002 28.199999999999996 28.275 20.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.0 19 2.0 20 1.0 21 4.0 22 6.0 23 2.5 24 2.5 25 4.0 26 7.0 27 9.0 28 11.0 29 14.0 30 17.5 31 28.0 32 43.5 33 51.0 34 56.5 35 66.0 36 88.5 37 125.0 38 160.5 39 198.0 40 235.0 41 256.0 42 250.5 43 262.5 44 285.5 45 279.0 46 249.0 47 226.5 48 214.0 49 171.0 50 130.0 51 112.5 52 105.0 53 86.5 54 61.5 55 46.5 56 30.5 57 22.5 58 19.0 59 17.0 60 11.5 61 4.5 62 5.5 63 5.0 64 3.0 65 3.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.29813501444707 90.7 2 4.386656159705805 8.35 3 0.2626740215392698 0.75 4 0.052534804307853955 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.275 0.0 0.0 0.0 0.0 128-129 0.3125 0.0 0.0 0.0 0.0 130-131 0.325 0.0 0.0 0.0 0.0 132-133 0.325 0.0 0.0 0.0 0.0 134-135 0.325 0.0 0.0 0.0 0.0 136-137 0.325 0.0 0.0 0.0 0.0 138 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAAAT 10 0.0067147487 145.81013 1 ATAGAGC 10 0.0069754543 143.9875 7 CTTTCTC 10 0.0069754543 143.9875 8 >>END_MODULE Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra Read 1221404 spots for SRR14639589.sra Written 1221404 spots for SRR14639589.sra Read 1221401 spots for SRR14639589.sra Written 1221401 spots for SRR14639589.sra SRR ids: ['SRR14639589.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7c5n_732 SRR14639589.sra spots: 24428023 blocks: [[1, 1221401], [1221402, 2442802], [2442803, 3664203], [3664204, 4885604], [4885605, 6107005], [6107006, 7328406], [7328407, 8549807], [8549808, 9771208], [9771209, 10992609], [10992610, 12214010], [12214011, 13435411], [13435412, 14656812], [14656813, 15878213], [15878214, 17099614], [17099615, 18321015], [18321016, 19542416], [19542417, 20763817], [20763818, 21985218], [21985219, 23206619], [23206620, 24428023]] SRR14639589 file size 9043120 SRR14639589 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639589 SRR14639589_1.fastq SRR14639589_2.fastq Input file: SRR14639589_1.fastq Paired file: SRR14639589_2.fastq trimmed: SRR14639589-trimmed-pair1.fastq, SRR14639589-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:49:15 2025 >> started Mon Feb 10 10:49:41 2025 >> done (25.780s) 24428023 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 41 ( 0.00%) empty read pairs filtered out after trimming by size control 24427875 (100.00%) read pairs available; of these: 416760 ( 1.71%) trimmed read pairs available after processing 24011115 (98.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 26 0.00% 20 16 0.00% 21 29 0.00% 22 23 0.00% 23 28 0.00% 24 27 0.00% 25 22 0.00% 26 24 0.00% 27 39 0.00% 28 31 0.00% 29 47 0.00% 30 39 0.00% 31 39 0.00% 32 52 0.00% 33 47 0.00% 34 44 0.00% 35 51 0.00% 36 67 0.00% 37 59 0.00% 38 61 0.00% 39 60 0.00% 40 66 0.00% 41 44 0.00% 42 71 0.00% 43 67 0.00% 44 69 0.00% 45 75 0.00% 46 87 0.00% 47 80 0.00% 48 79 0.00% 49 68 0.00% 50 94 0.00% 51 84 0.00% 52 70 0.00% 53 79 0.00% 54 91 0.00% 55 105 0.00% 56 103 0.00% 57 87 0.00% 58 114 0.00% 59 108 0.00% 60 116 0.00% 61 104 0.00% 62 118 0.00% 63 122 0.00% 64 108 0.00% 65 115 0.00% 66 115 0.00% 67 158 0.00% 68 130 0.00% 69 155 0.00% 70 125 0.00% 71 164 0.00% 72 157 0.00% 73 164 0.00% 74 168 0.00% 75 153 0.00% 76 160 0.00% 77 175 0.00% 78 194 0.00% 79 201 0.00% 80 182 0.00% 81 178 0.00% 82 196 0.00% 83 213 0.00% 84 181 0.00% 85 246 0.00% 86 232 0.00% 87 215 0.00% 88 259 0.00% 89 286 0.00% 90 272 0.00% 91 292 0.00% 92 314 0.00% 93 348 0.00% 94 326 0.00% 95 328 0.00% 96 352 0.00% 97 391 0.00% 98 386 0.00% 99 412 0.00% 100 446 0.00% 101 468 0.00% 102 453 0.00% 103 495 0.00% 104 509 0.00% 105 559 0.00% 106 565 0.00% 107 617 0.00% 108 636 0.00% 109 659 0.00% 110 667 0.00% 111 724 0.00% 112 710 0.00% 113 792 0.00% 114 830 0.00% 115 939 0.00% 116 901 0.00% 117 1016 0.00% 118 1066 0.00% 119 1088 0.00% 120 1090 0.00% 121 1191 0.00% 122 1240 0.01% 123 1232 0.01% 124 1371 0.01% 125 1443 0.01% 126 1545 0.01% 127 1543 0.01% 128 1649 0.01% 129 1717 0.01% 130 1781 0.01% 131 1846 0.01% 132 1899 0.01% 133 1967 0.01% 134 2118 0.01% 135 2173 0.01% 136 2203 0.01% 137 2333 0.01% 138 2475 0.01% 139 2595 0.01% 140 2668 0.01% 141 2743 0.01% 142 3046 0.01% 143 2948 0.01% 144 3295 0.01% 145 3372 0.01% 146 4008 0.02% 147 6336 0.03% 148 20920 0.09% 149 306860 1.26% 150 24011115 98.29% 24427875 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=32 prefix-density=0.36 prefix-fanout=1.9 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=91.65 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.4 sequence=CCATCTTCTTCATCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.47 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=291.26 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=28.7 sequence=AGAAGAAGAAGAG SRR14639589 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:50:44 Started mapping on | Feb 10 10:50:44 Finished on | Feb 10 10:53:34 Mapping speed, Million of reads per hour | 517.30 Number of input reads | 24427875 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22777482 Uniquely mapped reads % | 93.24% Average mapped length | 297.26 Number of splices: Total | 22897263 Number of splices: Annotated (sjdb) | 22341436 Number of splices: GT/AG | 22476350 Number of splices: GC/AG | 335740 Number of splices: AT/AC | 17522 Number of splices: Non-canonical | 67651 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.03% Deletion average length | 3.15 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 583923 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 26621 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.19% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1066470 1066470 1066470 N_multimapping 583923 583923 583923 N_noFeature 778468 22527889 835763 N_ambiguous 359975 1253 167297 UnstrandedReadsAssigned:21639039 PositiveStrandReadsAssigned:248340 NegativeStrandReadsAssigned:21774422 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639589 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639589-trimmed-pair1.fastq SRR14639589-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,427,875 reads, 22,035,916 reads pseudoaligned [quant] estimated average fragment length: 381.813 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR14639589.ke.tsv 34699 SRR14639589.se.tsv 87100 total ==> SRR14639589.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1637.19 2873 71.7077 Potri.005G024800.1.v4.1 1035 654.187 893 55.78 Potri.004G059700.1.v4.1 961 580.785 82 5.76935 Potri.007G009000.2.v4.1 1416 1035.19 0 0 Potri.003G141000.2.v4.1 2943 2562.19 2208.5 35.222 Potri.016G087400.1.v4.1 270 44.2774 1681 1551.36 Potri.015G069301.1.v4.1 564 219.064 0 0 Potri.010G195200.1.v4.1 1773 1392.19 406 11.9167 Potri.012G127500.1.v4.1 977 596.52 42 2.87709 ==> SRR14639589.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 251 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 334 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR14639589 completed mapping pipeline successfully