Starting /dee2/code/volunteer_pipeline.sh SRR14639590 current disk space = 3059057586176 free memory = 1486028592 SRR14639590 SRAfilesize 8038cec16b9971e194923499f2190f11 SRR14639590.sra SRR14639590.sra file validated SRR14639590 is paired end SRR14639590 is conventional basespace SRR14639590 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639590_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65375 32.0 32.0 32.0 32.0 32.0 2 31.50375 32.0 32.0 32.0 32.0 32.0 3 35.20875 37.0 32.0 37.0 32.0 37.0 4 36.20625 37.0 37.0 37.0 37.0 37.0 5 36.24625 37.0 37.0 37.0 37.0 37.0 6 39.939 41.0 41.0 41.0 37.0 41.0 7 39.97975 41.0 41.0 41.0 37.0 41.0 8 40.08475 41.0 41.0 41.0 37.0 41.0 9 40.1175 41.0 41.0 41.0 37.0 41.0 10-14 40.22855 41.0 41.0 41.0 37.8 41.0 15-19 40.22125 41.0 41.0 41.0 38.6 41.0 20-24 40.21065 41.0 41.0 41.0 39.4 41.0 25-29 40.2391 41.0 41.0 41.0 40.2 41.0 30-34 40.22745 41.0 41.0 41.0 40.2 41.0 35-39 40.16 41.0 41.0 41.0 39.4 41.0 40-44 40.0783 41.0 41.0 41.0 37.0 41.0 45-49 40.096199999999996 41.0 41.0 41.0 37.0 41.0 50-54 40.0297 41.0 41.0 41.0 37.0 41.0 55-59 39.962450000000004 41.0 41.0 41.0 37.0 41.0 60-64 39.91325 41.0 41.0 41.0 37.0 41.0 65-69 39.85675 41.0 41.0 41.0 37.0 41.0 70-74 39.68365 41.0 41.0 41.0 37.0 41.0 75-79 39.2168 41.0 40.2 41.0 36.0 41.0 80-84 39.6503 41.0 41.0 41.0 37.0 41.0 85-89 39.677749999999996 41.0 41.0 41.0 37.0 41.0 90-94 39.6379 41.0 41.0 41.0 37.0 41.0 95-99 39.61365 41.0 41.0 41.0 37.0 41.0 100-104 39.51425 41.0 41.0 41.0 37.0 41.0 105-109 39.41324999999999 41.0 41.0 41.0 37.0 41.0 110-114 39.44455 41.0 41.0 41.0 37.0 41.0 115-119 39.38925 41.0 41.0 41.0 37.0 41.0 120-124 39.3434 41.0 41.0 41.0 37.0 41.0 125-129 39.3935 41.0 41.0 41.0 37.0 41.0 130-134 39.12095 41.0 41.0 41.0 36.0 41.0 135-139 38.9272 41.0 41.0 41.0 33.0 41.0 140-144 38.64125 41.0 41.0 41.0 32.0 41.0 145-149 38.4775 41.0 37.0 41.0 32.0 41.0 150 38.45925 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 4.0 26 4.0 27 8.0 28 8.0 29 16.0 30 20.0 31 39.0 32 48.0 33 61.0 34 61.0 35 75.0 36 99.0 37 139.0 38 223.0 39 487.0 40 2705.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.883220805201304 13.628407101775444 10.152538134533634 43.33583395848962 2 13.200000000000001 12.3 45.2 29.299999999999997 3 14.424999999999999 17.05 31.1 37.425000000000004 4 19.875 26.05 25.2 28.875 5 21.775 32.5 26.700000000000003 19.025 6 18.099999999999998 33.875 27.650000000000002 20.375 7 13.575000000000001 27.950000000000003 40.975 17.5 8 14.475 25.35 36.625 23.549999999999997 9 15.925 24.2 36.975 22.900000000000002 10-14 18.525 28.935 29.14 23.400000000000002 15-19 18.72 28.1 28.67 24.51 20-24 18.685 28.48 28.33 24.505 25-29 18.785 28.585 28.835 23.794999999999998 30-34 18.584999999999997 28.915000000000003 28.499999999999996 24.0 35-39 19.77 27.99 27.925 24.315 40-44 18.87 29.175 28.505000000000003 23.45 45-49 18.8 28.78 27.685 24.735 50-54 19.064999999999998 27.900000000000002 28.835 24.2 55-59 18.68 28.67 28.26 24.39 60-64 19.49 28.08 28.555000000000003 23.875 65-69 18.745 28.74 28.360000000000003 24.154999999999998 70-74 18.7 28.77 28.435 24.095 75-79 18.790000000000003 28.754999999999995 28.084999999999997 24.37 80-84 19.31 28.325 28.185 24.18 85-89 18.935 28.775000000000002 28.38 23.91 90-94 18.995 28.599999999999998 28.249999999999996 24.154999999999998 95-99 18.965 28.865000000000002 27.884999999999998 24.285 100-104 19.475 28.799999999999997 27.615000000000002 24.11 105-109 19.496949694969498 28.542854285428543 28.28782878287829 23.672367236723673 110-114 19.735 27.83 28.560000000000002 23.875 115-119 19.39 28.294999999999998 28.470000000000002 23.845 120-124 19.86 27.975 28.165000000000003 24.0 125-129 19.605 27.775 28.544999999999998 24.075 130-134 19.965 28.449999999999996 27.544999999999998 24.04 135-139 19.88 27.48 28.23 24.41 140-144 19.918983796759353 27.500500100020002 28.370674134826967 24.20984196839368 145-149 20.39 28.18 27.794999999999998 23.635 150 20.150000000000002 26.55 28.775000000000002 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.5 20 2.0 21 0.5 22 0.5 23 1.5 24 3.0 25 6.0 26 5.5 27 3.5 28 8.0 29 18.0 30 27.5 31 31.0 32 34.0 33 48.5 34 61.5 35 77.5 36 102.5 37 119.0 38 145.5 39 177.0 40 206.5 41 248.5 42 269.5 43 273.0 44 305.0 45 311.0 46 277.0 47 233.5 48 192.5 49 175.0 50 154.5 51 131.0 52 96.0 53 68.0 54 53.0 55 40.0 56 35.0 57 22.5 58 13.0 59 7.5 60 3.5 61 2.0 62 1.5 63 2.0 64 1.5 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.51219512195121 89.125 2 4.957582184517497 9.35 3 0.503711558854719 1.425 4 0.02651113467656416 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.025 0.0 0.0 0.025 0.0 96-97 0.025 0.0 0.0 0.025 0.0 98-99 0.025 0.0 0.0 0.025 0.0 100-101 0.025 0.0 0.0 0.025 0.0 102-103 0.025 0.0 0.0 0.025 0.0 104-105 0.025 0.0 0.0 0.025 0.0 106-107 0.037500000000000006 0.0 0.0 0.025 0.0 108-109 0.05 0.0 0.0 0.025 0.0 110-111 0.05 0.0 0.0 0.025 0.0 112-113 0.05 0.0 0.0 0.025 0.0 114-115 0.05 0.0 0.0 0.025 0.0 116-117 0.05 0.0 0.0 0.025 0.0 118-119 0.1 0.0 0.0 0.025 0.0 120-121 0.1 0.0 0.0 0.025 0.0 122-123 0.125 0.0 0.0 0.025 0.0 124-125 0.125 0.0 0.0 0.025 0.0 126-127 0.125 0.0 0.0 0.025 0.0 128-129 0.125 0.0 0.0 0.025 0.0 130-131 0.125 0.0 0.0 0.025 0.0 132-133 0.15 0.0 0.0 0.025 0.0 134-135 0.15 0.0 0.0 0.025 0.0 136-137 0.225 0.0 0.0 0.025 0.0 138 0.25 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCTCT 10 0.006973645 144.0 4 >>END_MODULE SRR14639590 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639590_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.02125 32.0 32.0 32.0 32.0 32.0 2 30.9525 32.0 32.0 32.0 32.0 32.0 3 34.25 37.0 32.0 37.0 32.0 37.0 4 35.3625 37.0 37.0 37.0 32.0 37.0 5 35.5375 37.0 37.0 37.0 32.0 37.0 6 38.86725 41.0 41.0 41.0 37.0 41.0 7 38.57325 41.0 41.0 41.0 32.0 41.0 8 38.7345 41.0 41.0 41.0 37.0 41.0 9 38.9755 41.0 41.0 41.0 37.0 41.0 10-14 38.94670000000001 41.0 41.0 41.0 37.0 41.0 15-19 38.7836 41.0 41.0 41.0 34.0 41.0 20-24 38.67855000000001 41.0 41.0 41.0 33.0 41.0 25-29 38.311400000000006 41.0 41.0 41.0 31.0 41.0 30-34 38.3588 41.0 41.0 41.0 32.0 41.0 35-39 38.2494 41.0 40.2 41.0 32.0 41.0 40-44 38.1046 41.0 39.4 41.0 30.0 41.0 45-49 37.915800000000004 41.0 37.0 41.0 29.0 41.0 50-54 37.717699999999994 41.0 37.0 41.0 27.0 41.0 55-59 37.832 41.0 37.0 41.0 28.0 41.0 60-64 37.77945 41.0 37.0 41.0 28.0 41.0 65-69 37.5825 41.0 37.0 41.0 27.0 41.0 70-74 37.45185 41.0 37.0 41.0 27.0 41.0 75-79 36.572799999999994 40.2 36.0 41.0 24.0 41.0 80-84 37.499 41.0 37.0 41.0 27.0 41.0 85-89 37.646699999999996 41.0 37.0 41.0 27.0 41.0 90-94 37.30045 41.0 37.0 41.0 26.0 41.0 95-99 37.2381 41.0 37.0 41.0 27.0 41.0 100-104 36.9962 41.0 37.0 41.0 24.0 41.0 105-109 37.0661 41.0 37.0 41.0 26.0 41.0 110-114 37.0942 41.0 37.0 41.0 26.0 41.0 115-119 36.827099999999994 41.0 37.0 41.0 23.0 41.0 120-124 36.94265 41.0 37.0 41.0 24.0 41.0 125-129 36.335550000000005 41.0 37.0 41.0 22.0 41.0 130-134 36.35365 41.0 37.0 41.0 22.0 41.0 135-139 35.87845 41.0 36.0 41.0 20.0 41.0 140-144 35.712500000000006 41.0 37.0 41.0 20.0 41.0 145-149 35.47180000000001 41.0 36.0 41.0 18.0 41.0 150 35.083 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 4.0 17 9.0 18 17.0 19 23.0 20 16.0 21 19.0 22 22.0 23 22.0 24 39.0 25 40.0 26 38.0 27 61.0 28 66.0 29 49.0 30 66.0 31 68.0 32 74.0 33 97.0 34 108.0 35 146.0 36 147.0 37 239.0 38 323.0 39 573.0 40 1730.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.612490594431904 26.33559066967645 8.703285678454979 30.34863305743667 2 18.85 27.400000000000002 37.724999999999994 16.025 3 16.55 27.650000000000002 35.625 20.175 4 20.825 35.699999999999996 23.025000000000002 20.45 5 22.05 37.525 24.625 15.8 6 19.425 36.625 25.650000000000002 18.3 7 20.075000000000003 22.675 38.074999999999996 19.175 8 17.675 24.474999999999998 34.475 23.375 9 21.375 24.0 31.974999999999998 22.650000000000002 10-14 22.455 28.33 27.755000000000003 21.46 15-19 22.245 28.325 28.24 21.19 20-24 22.155 28.925 27.76 21.16 25-29 22.55 28.22 27.99 21.240000000000002 30-34 22.225 27.310000000000002 28.675 21.790000000000003 35-39 22.134999999999998 27.965 28.93 20.97 40-44 22.16 28.1 28.83 20.91 45-49 21.685 28.395 28.32 21.6 50-54 22.23 28.16 28.1 21.51 55-59 23.095 28.144999999999996 27.794999999999998 20.965 60-64 22.775000000000002 27.865000000000002 27.87 21.490000000000002 65-69 22.720000000000002 28.07 28.549999999999997 20.66 70-74 22.85 27.85 28.015 21.285 75-79 22.61 27.944999999999997 28.01 21.435000000000002 80-84 22.93 28.18 28.035 20.855 85-89 23.195 27.860000000000003 27.91 21.035 90-94 22.99 28.17 27.985 20.855 95-99 23.565 28.015 27.839999999999996 20.580000000000002 100-104 23.3 27.98 28.17 20.549999999999997 105-109 23.32 28.01 28.225 20.445 110-114 23.549999999999997 28.110000000000003 27.765 20.575 115-119 23.236161808090404 27.796389819490976 28.181409070453523 20.786039301965097 120-124 23.275000000000002 27.77 28.02 20.935000000000002 125-129 23.65 27.529999999999998 28.294999999999998 20.525 130-134 23.395 28.255000000000003 27.91 20.44 135-139 22.835 27.845 28.865000000000002 20.455000000000002 140-144 23.29 28.565 27.48 20.665 145-149 23.169999999999998 27.955000000000002 28.725 20.150000000000002 150 23.200000000000003 29.099999999999998 27.425 20.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 0.5 21 1.5 22 2.0 23 2.5 24 4.5 25 4.5 26 7.0 27 7.5 28 6.0 29 9.0 30 17.5 31 25.5 32 33.0 33 45.0 34 54.0 35 75.0 36 102.0 37 119.5 38 152.0 39 182.5 40 197.0 41 232.0 42 274.0 43 283.0 44 281.5 45 275.5 46 250.0 47 228.0 48 223.0 49 195.5 50 150.5 51 114.0 52 88.0 53 85.5 54 73.0 55 51.0 56 38.5 57 23.5 58 16.0 59 18.5 60 13.0 61 6.0 62 8.0 63 7.0 64 2.0 65 2.0 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.52356020942409 91.225 2 4.2408376963350785 8.1 3 0.2356020942408377 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.15 0.0 0.0 0.0 0.0 136-137 0.1875 0.0 0.0 0.0 0.0 138 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAATC 10 0.0069754543 143.9875 3 ATCAGAG 10 0.0069754543 143.9875 8 CGAATCT 10 0.0069754543 143.9875 4 >>END_MODULE Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136441 spots for SRR14639590.sra Written 1136441 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra Read 1136434 spots for SRR14639590.sra Written 1136434 spots for SRR14639590.sra SRR ids: ['SRR14639590.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7f0ofdec SRR14639590.sra spots: 22728687 blocks: [[1, 1136434], [1136435, 2272868], [2272869, 3409302], [3409303, 4545736], [4545737, 5682170], [5682171, 6818604], [6818605, 7955038], [7955039, 9091472], [9091473, 10227906], [10227907, 11364340], [11364341, 12500774], [12500775, 13637208], [13637209, 14773642], [14773643, 15910076], [15910077, 17046510], [17046511, 18182944], [18182945, 19319378], [19319379, 20455812], [20455813, 21592246], [21592247, 22728687]] SRR14639590 file size 8413307 SRR14639590 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639590 SRR14639590_1.fastq SRR14639590_2.fastq Input file: SRR14639590_1.fastq Paired file: SRR14639590_2.fastq trimmed: SRR14639590-trimmed-pair1.fastq, SRR14639590-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:53:30 2025 >> started Mon Feb 10 10:53:56 2025 >> done (25.998s) 22728687 read pairs processed; of these: 110 ( 0.00%) short read pairs filtered out after trimming by size control 37 ( 0.00%) empty read pairs filtered out after trimming by size control 22728540 (100.00%) read pairs available; of these: 448358 ( 1.97%) trimmed read pairs available after processing 22280182 (98.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 22 0.00% 20 22 0.00% 21 11 0.00% 22 25 0.00% 23 26 0.00% 24 24 0.00% 25 25 0.00% 26 27 0.00% 27 35 0.00% 28 38 0.00% 29 36 0.00% 30 34 0.00% 31 33 0.00% 32 51 0.00% 33 42 0.00% 34 36 0.00% 35 43 0.00% 36 43 0.00% 37 52 0.00% 38 40 0.00% 39 52 0.00% 40 61 0.00% 41 58 0.00% 42 61 0.00% 43 49 0.00% 44 61 0.00% 45 70 0.00% 46 61 0.00% 47 78 0.00% 48 54 0.00% 49 65 0.00% 50 87 0.00% 51 80 0.00% 52 63 0.00% 53 78 0.00% 54 68 0.00% 55 92 0.00% 56 76 0.00% 57 91 0.00% 58 103 0.00% 59 123 0.00% 60 99 0.00% 61 111 0.00% 62 105 0.00% 63 112 0.00% 64 109 0.00% 65 125 0.00% 66 148 0.00% 67 131 0.00% 68 139 0.00% 69 160 0.00% 70 147 0.00% 71 150 0.00% 72 138 0.00% 73 162 0.00% 74 160 0.00% 75 170 0.00% 76 193 0.00% 77 194 0.00% 78 202 0.00% 79 227 0.00% 80 239 0.00% 81 203 0.00% 82 243 0.00% 83 269 0.00% 84 301 0.00% 85 296 0.00% 86 308 0.00% 87 328 0.00% 88 328 0.00% 89 345 0.00% 90 383 0.00% 91 369 0.00% 92 416 0.00% 93 461 0.00% 94 466 0.00% 95 514 0.00% 96 497 0.00% 97 557 0.00% 98 563 0.00% 99 620 0.00% 100 617 0.00% 101 642 0.00% 102 711 0.00% 103 774 0.00% 104 874 0.00% 105 878 0.00% 106 873 0.00% 107 991 0.00% 108 1044 0.00% 109 1047 0.00% 110 1169 0.01% 111 1269 0.01% 112 1338 0.01% 113 1439 0.01% 114 1553 0.01% 115 1594 0.01% 116 1810 0.01% 117 1753 0.01% 118 1957 0.01% 119 1960 0.01% 120 2213 0.01% 121 2348 0.01% 122 2389 0.01% 123 2640 0.01% 124 2753 0.01% 125 3041 0.01% 126 3041 0.01% 127 3265 0.01% 128 3566 0.02% 129 3692 0.02% 130 3858 0.02% 131 4018 0.02% 132 4213 0.02% 133 4377 0.02% 134 4626 0.02% 135 4937 0.02% 136 5152 0.02% 137 5467 0.02% 138 5962 0.03% 139 6298 0.03% 140 6398 0.03% 141 6824 0.03% 142 7108 0.03% 143 7553 0.03% 144 7991 0.04% 145 8430 0.04% 146 9209 0.04% 147 11389 0.05% 148 22927 0.10% 149 245480 1.08% 150 22280182 98.03% 22728540 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=34 prefix-density=0.57 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=75.00 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=15.3 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=35 prefix-density=0.73 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=103.72 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=12.2 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR14639590 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:54:44 Started mapping on | Feb 10 10:54:45 Finished on | Feb 10 10:57:15 Mapping speed, Million of reads per hour | 545.48 Number of input reads | 22728540 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21243188 Uniquely mapped reads % | 93.46% Average mapped length | 297.57 Number of splices: Total | 22370268 Number of splices: Annotated (sjdb) | 21828405 Number of splices: GT/AG | 21960464 Number of splices: GC/AG | 328149 Number of splices: AT/AC | 16215 Number of splices: Non-canonical | 65440 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.02% Deletion average length | 3.15 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461876 % of reads mapped to multiple loci | 2.03% Number of reads mapped to too many loci | 21826 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1023476 1023476 1023476 N_multimapping 461876 461876 461876 N_noFeature 692574 20976968 744997 N_ambiguous 340323 1103 126152 UnstrandedReadsAssigned:20210291 PositiveStrandReadsAssigned:265117 NegativeStrandReadsAssigned:20372039 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639590 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639590-trimmed-pair1.fastq SRR14639590-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,728,540 reads, 20,540,963 reads pseudoaligned [quant] estimated average fragment length: 335.243 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR14639590.ke.tsv 34699 SRR14639590.se.tsv 87100 total ==> SRR14639590.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1683.76 1081 26.0797 Potri.005G024800.1.v4.1 1035 700.757 370 21.4482 Potri.004G059700.1.v4.1 961 627.13 79 5.11713 Potri.007G009000.2.v4.1 1416 1081.76 0 0 Potri.003G141000.2.v4.1 2943 2608.76 1797 27.9815 Potri.016G087400.1.v4.1 270 52.2565 1533 1191.68 Potri.015G069301.1.v4.1 564 254.911 0 0 Potri.010G195200.1.v4.1 1773 1438.76 147 4.15037 Potri.012G127500.1.v4.1 977 642.969 58 3.66433 ==> SRR14639590.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 325 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 54 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 18 SRR14639590 completed mapping pipeline successfully