Starting /dee2/code/volunteer_pipeline.sh SRR14639591 current disk space = 3058980487168 free memory = 1578737264 SRR14639591 SRAfilesize cc81cdc3b38540ee494fa829a37095e8 SRR14639591.sra SRR14639591.sra file validated SRR14639591 is paired end SRR14639591 is conventional basespace SRR14639591 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639591_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65 32.0 32.0 32.0 32.0 32.0 2 31.5775 32.0 32.0 32.0 32.0 32.0 3 35.315 37.0 37.0 37.0 32.0 37.0 4 36.18875 37.0 37.0 37.0 37.0 37.0 5 36.3375 37.0 37.0 37.0 37.0 37.0 6 39.8975 41.0 41.0 41.0 37.0 41.0 7 40.04325 41.0 41.0 41.0 37.0 41.0 8 40.19175 41.0 41.0 41.0 37.0 41.0 9 40.321 41.0 41.0 41.0 41.0 41.0 10-14 40.29525 41.0 41.0 41.0 40.2 41.0 15-19 40.3483 41.0 41.0 41.0 41.0 41.0 20-24 40.278800000000004 41.0 41.0 41.0 40.2 41.0 25-29 40.286 41.0 41.0 41.0 41.0 41.0 30-34 40.2483 41.0 41.0 41.0 41.0 41.0 35-39 40.1995 41.0 41.0 41.0 39.4 41.0 40-44 40.156150000000004 41.0 41.0 41.0 37.8 41.0 45-49 40.090149999999994 41.0 41.0 41.0 37.8 41.0 50-54 40.0509 41.0 41.0 41.0 37.0 41.0 55-59 39.98479999999999 41.0 41.0 41.0 37.0 41.0 60-64 39.9619 41.0 41.0 41.0 37.0 41.0 65-69 39.875299999999996 41.0 41.0 41.0 37.0 41.0 70-74 39.6833 41.0 41.0 41.0 37.0 41.0 75-79 39.32225 41.0 40.2 41.0 36.0 41.0 80-84 39.7418 41.0 41.0 41.0 37.0 41.0 85-89 39.675349999999995 41.0 41.0 41.0 37.0 41.0 90-94 39.687 41.0 41.0 41.0 37.0 41.0 95-99 39.63685 41.0 41.0 41.0 37.0 41.0 100-104 39.459700000000005 41.0 41.0 41.0 37.0 41.0 105-109 39.388999999999996 41.0 41.0 41.0 37.0 41.0 110-114 39.37195 41.0 41.0 41.0 37.0 41.0 115-119 39.4179 41.0 41.0 41.0 37.0 41.0 120-124 39.39635 41.0 41.0 41.0 37.0 41.0 125-129 39.404999999999994 41.0 41.0 41.0 37.0 41.0 130-134 39.1572 41.0 41.0 41.0 36.0 41.0 135-139 38.8345 41.0 41.0 41.0 32.0 41.0 140-144 38.7166 41.0 41.0 41.0 32.0 41.0 145-149 38.4569 41.0 37.8 41.0 32.0 41.0 150 38.236 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 5.0 24 2.0 25 5.0 26 4.0 27 9.0 28 13.0 29 16.0 30 30.0 31 24.0 32 40.0 33 53.0 34 60.0 35 74.0 36 102.0 37 123.0 38 235.0 39 445.0 40 2760.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.10827706926732 13.903475868967242 10.352588147036759 42.63565891472868 2 15.299999999999999 12.3 41.375 31.025000000000002 3 15.45 17.849999999999998 29.849999999999998 36.85 4 19.375 25.124999999999996 25.525 29.975 5 21.7 31.574999999999996 27.35 19.375 6 17.2 33.25 28.199999999999996 21.349999999999998 7 13.775 27.0 40.075 19.15 8 14.6 26.325 36.475 22.6 9 15.174999999999999 25.15 35.375 24.3 10-14 18.42 28.52 28.689999999999998 24.37 15-19 18.725 28.395 28.335 24.545 20-24 19.189999999999998 28.575 28.315 23.919999999999998 25-29 19.285 29.080000000000002 28.189999999999998 23.445 30-34 19.32 28.194999999999997 27.875 24.610000000000003 35-39 18.935 28.360000000000003 28.465 24.240000000000002 40-44 19.25 28.884999999999998 27.845 24.02 45-49 18.975 28.884999999999998 28.249999999999996 23.89 50-54 19.465 28.095 28.465 23.974999999999998 55-59 18.98 28.939999999999998 27.700000000000003 24.38 60-64 18.9 28.615000000000002 28.415000000000003 24.07 65-69 18.834999999999997 28.485 28.425 24.255 70-74 18.845 28.285 28.715000000000003 24.154999999999998 75-79 19.11 28.615000000000002 28.405 23.87 80-84 19.634999999999998 28.425 27.939999999999998 24.0 85-89 19.68 27.83 28.13 24.36 90-94 19.535 28.04 28.285 24.14 95-99 19.470000000000002 27.685 28.605000000000004 24.240000000000002 100-104 20.14 28.155 28.060000000000002 23.645 105-109 19.625981299064954 28.281414070703537 28.511425571278565 23.581179058952948 110-114 20.13 28.000000000000004 28.125 23.745 115-119 19.79 27.889999999999997 28.244999999999997 24.075 120-124 19.61 27.815 28.18 24.395 125-129 19.545 27.855 28.455000000000002 24.145 130-134 19.98 27.584999999999997 28.275 24.16 135-139 19.91 27.785 28.375 23.93 140-144 19.911969189216226 27.619666883409195 28.615015255339372 23.853348672035214 145-149 20.155 27.334999999999997 28.305000000000003 24.205 150 19.125 28.775000000000002 27.224999999999998 24.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 5.0 26 5.5 27 4.0 28 10.0 29 16.5 30 16.5 31 29.5 32 41.5 33 50.0 34 66.5 35 74.5 36 93.0 37 130.0 38 159.5 39 171.5 40 187.5 41 235.5 42 262.0 43 261.0 44 275.5 45 291.5 46 291.0 47 244.5 48 208.5 49 187.5 50 152.5 51 117.0 52 90.0 53 82.0 54 63.0 55 44.0 56 35.0 57 24.5 58 16.5 59 14.5 60 11.0 61 9.0 62 8.0 63 4.0 64 2.0 65 1.0 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.034999999999999996 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.35066981875492 90.75 2 4.25531914893617 8.1 3 0.36774363015497763 1.05 4 0.026267402153926978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.325 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.325 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.4375 0.0 0.0 0.0 0.0 134-135 0.5625 0.0 0.0 0.0 0.0 136-137 0.7375 0.0 0.0 0.0 0.0 138 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639591 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639591_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.22125 32.0 32.0 32.0 32.0 32.0 2 31.16 32.0 32.0 32.0 32.0 32.0 3 34.47 37.0 32.0 37.0 32.0 37.0 4 35.5625 37.0 37.0 37.0 32.0 37.0 5 35.74125 37.0 37.0 37.0 32.0 37.0 6 39.09325 41.0 41.0 41.0 37.0 41.0 7 39.0285 41.0 41.0 41.0 37.0 41.0 8 38.965 41.0 41.0 41.0 37.0 41.0 9 39.1585 41.0 41.0 41.0 37.0 41.0 10-14 39.25505 41.0 41.0 41.0 37.0 41.0 15-19 39.0077 41.0 41.0 41.0 37.0 41.0 20-24 38.96169999999999 41.0 41.0 41.0 37.0 41.0 25-29 38.6853 41.0 41.0 41.0 34.0 41.0 30-34 38.6452 41.0 41.0 41.0 32.0 41.0 35-39 38.483399999999996 41.0 41.0 41.0 32.0 41.0 40-44 38.4184 41.0 41.0 41.0 32.0 41.0 45-49 38.3184 41.0 41.0 41.0 32.0 41.0 50-54 38.240449999999996 41.0 41.0 41.0 32.0 41.0 55-59 38.225 41.0 41.0 41.0 32.0 41.0 60-64 38.1409 41.0 39.4 41.0 31.0 41.0 65-69 37.85195 41.0 37.0 41.0 30.0 41.0 70-74 37.79655 41.0 37.0 41.0 27.0 41.0 75-79 36.918899999999994 40.2 36.0 41.0 26.0 41.0 80-84 37.77515000000001 41.0 37.0 41.0 27.0 41.0 85-89 37.8343 41.0 37.0 41.0 28.0 41.0 90-94 37.622299999999996 41.0 37.0 41.0 27.0 41.0 95-99 37.71605000000001 41.0 37.0 41.0 27.0 41.0 100-104 37.48795 41.0 37.0 41.0 26.0 41.0 105-109 37.511849999999995 41.0 37.0 41.0 27.0 41.0 110-114 37.49465 41.0 37.0 41.0 27.0 41.0 115-119 37.204899999999995 41.0 37.0 41.0 26.0 41.0 120-124 37.3262 41.0 37.0 41.0 26.0 41.0 125-129 36.804050000000004 41.0 37.0 41.0 24.0 41.0 130-134 36.843650000000004 41.0 37.0 41.0 22.0 41.0 135-139 36.3478 41.0 37.0 41.0 22.0 41.0 140-144 36.16665 41.0 37.0 41.0 22.0 41.0 145-149 36.11475 41.0 37.0 41.0 20.0 41.0 150 35.78075 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 4.0 17 6.0 18 10.0 19 18.0 20 20.0 21 19.0 22 12.0 23 28.0 24 27.0 25 32.0 26 26.0 27 46.0 28 54.0 29 52.0 30 59.0 31 71.0 32 75.0 33 84.0 34 114.0 35 120.0 36 161.0 37 209.0 38 318.0 39 537.0 40 1895.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.242803504380475 26.783479349186486 9.662077596996244 29.311639549436798 2 19.925 27.950000000000003 35.625 16.5 3 17.724999999999998 28.825 33.800000000000004 19.650000000000002 4 22.625 33.975 23.200000000000003 20.200000000000003 5 22.175 37.775 24.55 15.5 6 18.7 37.65 25.525 18.125 7 20.9 23.825 35.275 20.0 8 17.65 25.85 31.900000000000002 24.6 9 19.225 25.650000000000002 31.624999999999996 23.5 10-14 22.689999999999998 29.485 26.76 21.065 15-19 22.395 28.475 28.03 21.099999999999998 20-24 22.36 28.08 28.349999999999998 21.21 25-29 22.505 28.17 28.360000000000003 20.965 30-34 22.5 28.444999999999997 28.43 20.625 35-39 22.770000000000003 28.455000000000002 27.474999999999998 21.3 40-44 23.26 28.549999999999997 27.779999999999998 20.41 45-49 22.765 27.85 28.04 21.345 50-54 22.85 28.355000000000004 27.97 20.825 55-59 23.015 28.735 27.025 21.224999999999998 60-64 23.22 28.050000000000004 27.845 20.885 65-69 22.965 28.389999999999997 27.355 21.29 70-74 23.185 28.455000000000002 27.005000000000003 21.355 75-79 23.325000000000003 28.694999999999997 26.900000000000002 21.08 80-84 23.815 27.91 27.245 21.029999999999998 85-89 23.95 28.199999999999996 27.295 20.555 90-94 23.96 27.71 27.900000000000002 20.43 95-99 23.830000000000002 27.855 27.544999999999998 20.77 100-104 23.645 28.305000000000003 26.935 21.115000000000002 105-109 23.935000000000002 28.139999999999997 27.445000000000004 20.48 110-114 23.265 29.09 27.284999999999997 20.36 115-119 23.826191309565477 28.006400320016 27.336366818340917 20.831041552077604 120-124 23.605 28.04 27.700000000000003 20.655 125-129 23.494999999999997 28.075 27.405 21.025 130-134 23.74 28.515 27.415 20.330000000000002 135-139 23.615 27.96 27.279999999999998 21.145 140-144 23.885 27.85 27.49 20.775 145-149 23.68 28.335 27.855 20.13 150 23.7 27.950000000000003 26.85 21.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.5 22 2.5 23 2.5 24 3.0 25 3.0 26 4.0 27 5.5 28 5.5 29 9.0 30 18.5 31 22.0 32 23.5 33 35.0 34 51.0 35 71.5 36 97.5 37 117.5 38 146.0 39 193.5 40 216.5 41 231.5 42 250.5 43 269.5 44 269.0 45 265.0 46 276.5 47 258.0 48 228.0 49 183.0 50 139.5 51 112.5 52 93.5 53 85.5 54 73.0 55 59.5 56 49.5 57 36.5 58 22.0 59 15.0 60 12.0 61 10.5 62 8.5 63 5.5 64 4.0 65 2.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 95.87682672233821 91.85 2 3.8622129436325676 7.3999999999999995 3 0.2609603340292276 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.21250000000000002 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.275 0.0 0.0 0.0 0.0 128-129 0.275 0.0 0.0 0.0 0.0 130-131 0.3 0.0 0.0 0.0 0.0 132-133 0.36250000000000004 0.0 0.0 0.0 0.0 134-135 0.44999999999999996 0.0 0.0 0.0 0.0 136-137 0.5875 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATCTC 15 1.1734418E-4 143.9875 4 AAAAAAA 135 9.236299E-4 9.599167 25-29 >>END_MODULE Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134980 spots for SRR14639591.sra Written 1134980 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra Read 1134966 spots for SRR14639591.sra Written 1134966 spots for SRR14639591.sra SRR ids: ['SRR14639591.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_okg5k9cl SRR14639591.sra spots: 22699334 blocks: [[1, 1134966], [1134967, 2269932], [2269933, 3404898], [3404899, 4539864], [4539865, 5674830], [5674831, 6809796], [6809797, 7944762], [7944763, 9079728], [9079729, 10214694], [10214695, 11349660], [11349661, 12484626], [12484627, 13619592], [13619593, 14754558], [14754559, 15889524], [15889525, 17024490], [17024491, 18159456], [18159457, 19294422], [19294423, 20429388], [20429389, 21564354], [21564355, 22699334]] SRR14639591 file size 8402424 SRR14639591 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639591 SRR14639591_1.fastq SRR14639591_2.fastq Input file: SRR14639591_1.fastq Paired file: SRR14639591_2.fastq trimmed: SRR14639591-trimmed-pair1.fastq, SRR14639591-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:46:13 2025 >> started Mon Feb 10 11:46:40 2025 >> done (27.329s) 22699334 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 20 ( 0.00%) empty read pairs filtered out after trimming by size control 22699234 (100.00%) read pairs available; of these: 730442 ( 3.22%) trimmed read pairs available after processing 21968792 (96.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 15 0.00% 20 23 0.00% 21 24 0.00% 22 26 0.00% 23 23 0.00% 24 12 0.00% 25 20 0.00% 26 17 0.00% 27 36 0.00% 28 36 0.00% 29 33 0.00% 30 30 0.00% 31 37 0.00% 32 25 0.00% 33 27 0.00% 34 37 0.00% 35 37 0.00% 36 41 0.00% 37 48 0.00% 38 54 0.00% 39 43 0.00% 40 51 0.00% 41 38 0.00% 42 45 0.00% 43 62 0.00% 44 40 0.00% 45 55 0.00% 46 57 0.00% 47 83 0.00% 48 70 0.00% 49 57 0.00% 50 68 0.00% 51 74 0.00% 52 52 0.00% 53 71 0.00% 54 50 0.00% 55 85 0.00% 56 91 0.00% 57 57 0.00% 58 75 0.00% 59 73 0.00% 60 112 0.00% 61 99 0.00% 62 103 0.00% 63 91 0.00% 64 97 0.00% 65 100 0.00% 66 117 0.00% 67 128 0.00% 68 111 0.00% 69 153 0.00% 70 155 0.00% 71 148 0.00% 72 149 0.00% 73 185 0.00% 74 173 0.00% 75 230 0.00% 76 229 0.00% 77 216 0.00% 78 231 0.00% 79 259 0.00% 80 244 0.00% 81 275 0.00% 82 299 0.00% 83 339 0.00% 84 372 0.00% 85 396 0.00% 86 417 0.00% 87 462 0.00% 88 489 0.00% 89 495 0.00% 90 545 0.00% 91 611 0.00% 92 645 0.00% 93 725 0.00% 94 801 0.00% 95 843 0.00% 96 881 0.00% 97 925 0.00% 98 994 0.00% 99 1138 0.01% 100 1207 0.01% 101 1356 0.01% 102 1411 0.01% 103 1567 0.01% 104 1637 0.01% 105 1777 0.01% 106 2067 0.01% 107 2148 0.01% 108 2324 0.01% 109 2379 0.01% 110 2701 0.01% 111 2873 0.01% 112 3135 0.01% 113 3306 0.01% 114 3550 0.02% 115 3868 0.02% 116 4159 0.02% 117 4561 0.02% 118 4813 0.02% 119 5321 0.02% 120 5626 0.02% 121 6006 0.03% 122 6394 0.03% 123 6854 0.03% 124 7213 0.03% 125 7730 0.03% 126 8477 0.04% 127 9014 0.04% 128 9452 0.04% 129 10183 0.04% 130 10799 0.05% 131 11100 0.05% 132 11624 0.05% 133 12139 0.05% 134 13137 0.06% 135 13839 0.06% 136 14527 0.06% 137 15530 0.07% 138 16185 0.07% 139 17385 0.08% 140 18156 0.08% 141 19016 0.08% 142 19846 0.09% 143 20844 0.09% 144 21828 0.10% 145 22867 0.10% 146 24180 0.11% 147 26977 0.12% 148 37579 0.17% 149 232877 1.03% 150 21968792 96.78% 22699234 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=33 prefix-density=0.85 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=21.44 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.2 sequence=TTGTCCTTGCAATACTCCTCCAAAGGGTCAGACCCTTTCTTCTTGTCCTTGGCATGGCTAGCAGCAGCACTCAACTCCTCCACCTCATCCCATGCGGCTGCGCATTCTCCACTTGCTGCATCATCGGAGCACGCCGCCTCTGCATCTTTTATGCTCTTTTCAACCTTCTCTGATATGCTATCAGGGGCAGCCCTCACGGGTCGGATTTGCATGCGCCCACCGGACCCCAGGTGGTATGTCCTCCTCCATGGCTGGTTTAACTT criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=37 prefix-density=1.12 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=191.40 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.7 sequence=TAGGGTTTTAGTAGCCAGACCACATAGTTGAGGATAAACAGGAGATTGTGAAAAAAGAAAGGCAGAAGCAAGTTCAGTAATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR14639591 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:47:28 Started mapping on | Feb 10 11:47:29 Finished on | Feb 10 11:50:27 Mapping speed, Million of reads per hour | 459.09 Number of input reads | 22699234 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21263950 Uniquely mapped reads % | 93.68% Average mapped length | 297.37 Number of splices: Total | 22901803 Number of splices: Annotated (sjdb) | 22388078 Number of splices: GT/AG | 22495046 Number of splices: GC/AG | 325072 Number of splices: AT/AC | 16687 Number of splices: Non-canonical | 64998 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 3.13 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446524 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 41739 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 988760 988760 988760 N_multimapping 446524 446524 446524 N_noFeature 587474 20931894 649900 N_ambiguous 383997 1214 113851 UnstrandedReadsAssigned:20292479 PositiveStrandReadsAssigned:330842 NegativeStrandReadsAssigned:20500199 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639591 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639591-trimmed-pair1.fastq SRR14639591-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,699,234 reads, 20,620,339 reads pseudoaligned [quant] estimated average fragment length: 311.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR14639591.ke.tsv 34699 SRR14639591.se.tsv 87100 total ==> SRR14639591.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1707.72 1045 20.7411 Potri.005G024800.1.v4.1 1035 724.72 470 21.9816 Potri.004G059700.1.v4.1 961 650.993 108 5.62315 Potri.007G009000.2.v4.1 1416 1105.72 0 0 Potri.003G141000.2.v4.1 2943 2632.72 1499.5 19.3051 Potri.016G087400.1.v4.1 270 63.1592 1985.74 1065.66 Potri.015G069301.1.v4.1 564 275.705 0 0 Potri.010G195200.1.v4.1 1773 1462.72 143 3.31365 Potri.012G127500.1.v4.1 977 666.851 46 2.33809 ==> SRR14639591.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 321 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 370 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 24 SRR14639591 completed mapping pipeline successfully