Starting /dee2/code/volunteer_pipeline.sh SRR14639592 current disk space = 3059087388672 free memory = 1574806744 SRR14639592 SRAfilesize 354795acd09a6638c3c5e53337de87a1 SRR14639592.sra SRR14639592.sra file validated SRR14639592 is paired end SRR14639592 is conventional basespace SRR14639592 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639592_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7475 32.0 32.0 32.0 32.0 32.0 2 31.5825 32.0 32.0 32.0 32.0 32.0 3 35.3525 37.0 32.0 37.0 32.0 37.0 4 36.11 37.0 37.0 37.0 32.0 37.0 5 36.40375 37.0 37.0 37.0 37.0 37.0 6 39.934 41.0 41.0 41.0 37.0 41.0 7 39.9465 41.0 41.0 41.0 37.0 41.0 8 40.23375 41.0 41.0 41.0 37.0 41.0 9 40.19625 41.0 41.0 41.0 37.0 41.0 10-14 40.25075 41.0 41.0 41.0 38.6 41.0 15-19 40.293549999999996 41.0 41.0 41.0 41.0 41.0 20-24 40.23304999999999 41.0 41.0 41.0 38.6 41.0 25-29 40.213800000000006 41.0 41.0 41.0 41.0 41.0 30-34 40.18145 41.0 41.0 41.0 40.2 41.0 35-39 40.08585000000001 41.0 41.0 41.0 37.0 41.0 40-44 40.09055 41.0 41.0 41.0 37.8 41.0 45-49 40.05075000000001 41.0 41.0 41.0 37.0 41.0 50-54 40.0407 41.0 41.0 41.0 37.0 41.0 55-59 39.94125 41.0 41.0 41.0 37.0 41.0 60-64 39.92325 41.0 41.0 41.0 37.0 41.0 65-69 39.87564999999999 41.0 41.0 41.0 37.0 41.0 70-74 39.73625 41.0 41.0 41.0 37.0 41.0 75-79 39.3087 41.0 40.2 41.0 36.0 41.0 80-84 39.69615 41.0 41.0 41.0 37.0 41.0 85-89 39.69605 41.0 41.0 41.0 37.0 41.0 90-94 39.6543 41.0 41.0 41.0 37.0 41.0 95-99 39.55925 41.0 41.0 41.0 37.0 41.0 100-104 39.5 41.0 41.0 41.0 37.0 41.0 105-109 39.39775000000001 41.0 41.0 41.0 37.0 41.0 110-114 39.34995 41.0 41.0 41.0 37.0 41.0 115-119 39.39605 41.0 41.0 41.0 37.0 41.0 120-124 39.295249999999996 41.0 41.0 41.0 37.0 41.0 125-129 39.37115 41.0 41.0 41.0 37.0 41.0 130-134 39.06265 41.0 41.0 41.0 34.0 41.0 135-139 38.81395 41.0 41.0 41.0 33.0 41.0 140-144 38.677800000000005 41.0 41.0 41.0 32.0 41.0 145-149 38.4225 41.0 37.0 41.0 32.0 41.0 150 38.282 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 5.0 25 3.0 26 4.0 27 9.0 28 11.0 29 14.0 30 22.0 31 42.0 32 49.0 33 53.0 34 61.0 35 69.0 36 99.0 37 140.0 38 236.0 39 465.0 40 2717.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.582645661415352 13.553388347086774 10.72768192048012 45.136284071017755 2 13.425 13.200000000000001 43.95 29.425 3 13.375 18.525 29.525000000000002 38.574999999999996 4 20.474999999999998 25.55 24.625 29.349999999999998 5 20.7 32.775 27.325 19.2 6 16.675 33.175 29.275000000000002 20.875 7 13.975000000000001 27.575 40.725 17.724999999999998 8 13.475000000000001 24.975 37.775 23.775 9 15.075 24.625 35.975 24.325 10-14 18.884999999999998 29.13 28.134999999999998 23.849999999999998 15-19 18.845 27.595 28.910000000000004 24.65 20-24 18.89 29.060000000000002 28.22 23.830000000000002 25-29 18.665000000000003 28.48 28.78 24.075 30-34 18.615000000000002 28.84 28.485 24.060000000000002 35-39 19.195 27.889999999999997 28.475 24.44 40-44 18.545 29.21 28.275 23.97 45-49 18.94 28.485 28.1 24.474999999999998 50-54 19.665 28.410000000000004 28.499999999999996 23.425 55-59 19.134999999999998 28.055000000000003 28.7 24.11 60-64 19.805 28.355000000000004 28.000000000000004 23.84 65-69 19.09 28.84 28.139999999999997 23.93 70-74 19.38 28.744999999999997 28.37 23.505000000000003 75-79 19.650000000000002 28.59 28.185 23.575 80-84 19.585 28.810000000000002 28.225 23.380000000000003 85-89 19.42 28.415000000000003 28.415000000000003 23.75 90-94 19.689999999999998 28.255000000000003 28.4 23.655 95-99 19.435 28.645 28.515 23.405 100-104 19.805 28.535 27.955000000000002 23.705000000000002 105-109 19.655 28.73 27.939999999999998 23.674999999999997 110-114 19.73 27.560000000000002 28.595 24.115000000000002 115-119 20.03 28.265 27.83 23.875 120-124 19.485 28.305000000000003 27.72 24.490000000000002 125-129 20.105 28.305000000000003 28.335 23.255 130-134 20.5 28.16 28.055000000000003 23.285 135-139 20.36 28.43 27.650000000000002 23.56 140-144 19.817972695904384 27.844176626493972 28.039205880882136 24.298644796719508 145-149 19.830000000000002 28.155 28.16 23.855 150 20.275000000000002 28.749999999999996 28.349999999999998 22.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 2.5 25 3.5 26 5.0 27 8.5 28 10.5 29 12.0 30 14.5 31 23.0 32 39.5 33 44.5 34 59.0 35 83.0 36 109.5 37 127.5 38 160.0 39 203.0 40 218.0 41 232.0 42 262.0 43 293.0 44 286.5 45 273.0 46 267.5 47 242.5 48 209.5 49 171.0 50 142.5 51 122.0 52 94.5 53 69.0 54 50.5 55 39.5 56 28.0 57 24.0 58 19.5 59 10.0 60 6.5 61 6.5 62 4.0 63 2.0 64 2.5 65 2.5 66 1.0 67 0.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.41043797534749 90.95 2 4.274849200104904 8.15 3 0.3147128245476003 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.025 0.0 0.0 0.025 0.0 96-97 0.025 0.0 0.0 0.025 0.0 98-99 0.025 0.0 0.0 0.025 0.0 100-101 0.025 0.0 0.0 0.025 0.0 102-103 0.025 0.0 0.0 0.025 0.0 104-105 0.037500000000000006 0.0 0.0 0.025 0.0 106-107 0.075 0.0 0.0 0.025 0.0 108-109 0.0875 0.0 0.0 0.025 0.0 110-111 0.1 0.0 0.0 0.025 0.0 112-113 0.125 0.0 0.0 0.025 0.0 114-115 0.16249999999999998 0.0 0.0 0.025 0.0 116-117 0.1875 0.0 0.0 0.025 0.0 118-119 0.225 0.0 0.0 0.025 0.0 120-121 0.2625 0.0 0.0 0.025 0.0 122-123 0.275 0.0 0.0 0.025 0.0 124-125 0.3125 0.0 0.0 0.025 0.0 126-127 0.3875 0.0 0.0 0.025 0.0 128-129 0.475 0.0 0.0 0.025 0.0 130-131 0.5625 0.0 0.0 0.025 0.0 132-133 0.6125 0.0 0.0 0.025 0.0 134-135 0.7875000000000001 0.0 0.0 0.025 0.0 136-137 0.85 0.0 0.0 0.025 0.0 138 0.875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0036813593 20.571428 30-34 >>END_MODULE SRR14639592 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639592_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.15375 32.0 32.0 32.0 32.0 32.0 2 31.06875 32.0 32.0 32.0 32.0 32.0 3 34.5025 37.0 32.0 37.0 32.0 37.0 4 35.3775 37.0 37.0 37.0 32.0 37.0 5 35.645 37.0 37.0 37.0 32.0 37.0 6 39.02825 41.0 41.0 41.0 37.0 41.0 7 38.965 41.0 41.0 41.0 37.0 41.0 8 38.9485 41.0 41.0 41.0 37.0 41.0 9 39.162 41.0 41.0 41.0 37.0 41.0 10-14 39.11135 41.0 41.0 41.0 37.0 41.0 15-19 38.8606 41.0 41.0 41.0 37.0 41.0 20-24 38.8463 41.0 41.0 41.0 37.0 41.0 25-29 38.538 41.0 41.0 41.0 33.0 41.0 30-34 38.507549999999995 41.0 41.0 41.0 32.0 41.0 35-39 38.45845 41.0 41.0 41.0 32.0 41.0 40-44 38.33625 41.0 41.0 41.0 32.0 41.0 45-49 38.27235 41.0 41.0 41.0 32.0 41.0 50-54 38.072649999999996 41.0 37.8 41.0 31.0 41.0 55-59 38.038500000000006 41.0 38.6 41.0 30.0 41.0 60-64 37.98145 41.0 38.6 41.0 29.0 41.0 65-69 37.83855 41.0 37.8 41.0 29.0 41.0 70-74 37.61229999999999 41.0 37.0 41.0 27.0 41.0 75-79 36.9427 40.2 36.0 41.0 25.0 41.0 80-84 37.7919 41.0 37.0 41.0 28.0 41.0 85-89 37.7644 41.0 37.0 41.0 27.0 41.0 90-94 37.4561 41.0 37.0 41.0 26.0 41.0 95-99 37.64065 41.0 37.0 41.0 27.0 41.0 100-104 37.286199999999994 41.0 37.0 41.0 25.0 41.0 105-109 37.368700000000004 41.0 37.0 41.0 27.0 41.0 110-114 37.34335 41.0 37.0 41.0 27.0 41.0 115-119 37.11110000000001 41.0 37.0 41.0 26.0 41.0 120-124 37.048 41.0 37.0 41.0 25.0 41.0 125-129 36.56755 41.0 37.0 41.0 23.0 41.0 130-134 36.61765 41.0 37.0 41.0 22.0 41.0 135-139 36.24159999999999 41.0 37.0 41.0 22.0 41.0 140-144 36.050650000000005 41.0 37.0 41.0 22.0 41.0 145-149 35.8418 41.0 36.0 41.0 20.0 41.0 150 35.444 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 2.0 17 9.0 18 18.0 19 13.0 20 23.0 21 15.0 22 24.0 23 22.0 24 28.0 25 24.0 26 46.0 27 42.0 28 40.0 29 54.0 30 65.0 31 72.0 32 87.0 33 100.0 34 114.0 35 120.0 36 163.0 37 257.0 38 281.0 39 570.0 40 1809.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.988977955911825 26.077154308617235 9.719438877755511 32.21442885771543 2 18.325 27.925 38.550000000000004 15.2 3 16.25 28.1 34.9 20.75 4 21.099999999999998 33.5 25.424999999999997 19.975 5 22.55 38.65 23.3 15.5 6 18.5 37.5 25.575 18.425 7 19.825 22.725 37.0 20.45 8 17.424999999999997 23.825 34.175 24.575 9 19.75 23.974999999999998 31.525 24.75 10-14 22.17 28.32 28.105000000000004 21.404999999999998 15-19 22.095000000000002 28.03 28.65 21.224999999999998 20-24 21.465 28.610000000000003 28.705000000000002 21.22 25-29 22.49 28.46 28.215 20.835 30-34 22.155 27.63 28.96 21.255 35-39 22.285 28.185 27.855 21.675 40-44 21.995 28.299999999999997 29.24 20.465 45-49 22.615 28.595 28.065 20.724999999999998 50-54 22.009999999999998 28.09 28.63 21.27 55-59 22.770000000000003 28.62 27.505000000000003 21.105 60-64 22.439999999999998 28.525 28.155 20.880000000000003 65-69 22.81 27.725 28.275 21.19 70-74 22.675 28.845 27.495000000000005 20.985 75-79 22.939999999999998 27.889999999999997 28.105000000000004 21.065 80-84 22.665 28.000000000000004 28.499999999999996 20.835 85-89 23.115 27.57 28.4 20.915 90-94 22.895 27.975 28.084999999999997 21.044999999999998 95-99 22.735 28.395 28.175 20.695 100-104 23.195 27.650000000000002 27.839999999999996 21.315 105-109 23.11 28.32 27.825 20.745 110-114 23.34 28.12 28.23 20.31 115-119 23.575 28.075 27.55 20.8 120-124 23.535 28.65 27.544999999999998 20.27 125-129 23.044999999999998 27.87 27.685 21.4 130-134 22.905 28.749999999999996 28.03 20.315 135-139 23.23 28.084999999999997 27.950000000000003 20.735 140-144 23.155 28.215 27.805000000000003 20.825 145-149 23.47 28.525 27.47 20.535 150 23.025000000000002 28.799999999999997 27.1 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 2.5 20 2.5 21 2.0 22 3.0 23 3.5 24 2.5 25 4.0 26 6.0 27 5.0 28 15.0 29 22.0 30 21.0 31 28.0 32 36.0 33 42.0 34 60.0 35 87.5 36 101.5 37 118.0 38 152.5 39 185.0 40 203.0 41 231.0 42 255.5 43 278.0 44 290.0 45 281.5 46 269.5 47 232.5 48 204.5 49 186.5 50 151.0 51 114.0 52 89.5 53 73.0 54 55.5 55 43.0 56 29.0 57 24.5 58 24.0 59 16.0 60 12.5 61 11.0 62 8.0 63 4.0 64 2.5 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.95933263816475 92.025 2 3.832116788321168 7.35 3 0.18248175182481752 0.525 4 0.026068821689259645 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.5875 0.0 0.0 0.0 0.0 130-131 0.7124999999999999 0.0 0.0 0.0 0.0 132-133 0.7875000000000001 0.0 0.0 0.0 0.0 134-135 0.9625 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCAAC 10 0.006973645 144.0 6 >>END_MODULE Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra Read 960738 spots for SRR14639592.sra Written 960738 spots for SRR14639592.sra Read 960723 spots for SRR14639592.sra Written 960723 spots for SRR14639592.sra SRR ids: ['SRR14639592.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__z7i0w5t SRR14639592.sra spots: 19214475 blocks: [[1, 960723], [960724, 1921446], [1921447, 2882169], [2882170, 3842892], [3842893, 4803615], [4803616, 5764338], [5764339, 6725061], [6725062, 7685784], [7685785, 8646507], [8646508, 9607230], [9607231, 10567953], [10567954, 11528676], [11528677, 12489399], [12489400, 13450122], [13450123, 14410845], [14410846, 15371568], [15371569, 16332291], [16332292, 17293014], [17293015, 18253737], [18253738, 19214475]] SRR14639592 file size 7110804 SRR14639592 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639592 SRR14639592_1.fastq SRR14639592_2.fastq Input file: SRR14639592_1.fastq Paired file: SRR14639592_2.fastq trimmed: SRR14639592-trimmed-pair1.fastq, SRR14639592-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:40:12 2025 >> started Mon Feb 10 11:40:33 2025 >> done (20.905s) 19214475 read pairs processed; of these: 69 ( 0.00%) short read pairs filtered out after trimming by size control 20 ( 0.00%) empty read pairs filtered out after trimming by size control 19214386 (100.00%) read pairs available; of these: 828515 ( 4.31%) trimmed read pairs available after processing 18385871 (95.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 17 0.00% 20 16 0.00% 21 11 0.00% 22 23 0.00% 23 16 0.00% 24 20 0.00% 25 26 0.00% 26 21 0.00% 27 40 0.00% 28 30 0.00% 29 38 0.00% 30 32 0.00% 31 39 0.00% 32 43 0.00% 33 37 0.00% 34 30 0.00% 35 50 0.00% 36 40 0.00% 37 39 0.00% 38 42 0.00% 39 45 0.00% 40 50 0.00% 41 45 0.00% 42 60 0.00% 43 46 0.00% 44 45 0.00% 45 62 0.00% 46 71 0.00% 47 56 0.00% 48 55 0.00% 49 55 0.00% 50 57 0.00% 51 84 0.00% 52 60 0.00% 53 70 0.00% 54 67 0.00% 55 94 0.00% 56 71 0.00% 57 71 0.00% 58 78 0.00% 59 85 0.00% 60 104 0.00% 61 99 0.00% 62 93 0.00% 63 80 0.00% 64 110 0.00% 65 102 0.00% 66 113 0.00% 67 129 0.00% 68 123 0.00% 69 145 0.00% 70 149 0.00% 71 126 0.00% 72 163 0.00% 73 169 0.00% 74 199 0.00% 75 197 0.00% 76 213 0.00% 77 182 0.00% 78 228 0.00% 79 271 0.00% 80 258 0.00% 81 287 0.00% 82 359 0.00% 83 325 0.00% 84 362 0.00% 85 452 0.00% 86 475 0.00% 87 510 0.00% 88 503 0.00% 89 524 0.00% 90 577 0.00% 91 648 0.00% 92 691 0.00% 93 790 0.00% 94 809 0.00% 95 933 0.00% 96 1002 0.01% 97 1080 0.01% 98 1176 0.01% 99 1320 0.01% 100 1421 0.01% 101 1472 0.01% 102 1695 0.01% 103 1860 0.01% 104 2014 0.01% 105 2232 0.01% 106 2362 0.01% 107 2535 0.01% 108 2750 0.01% 109 3107 0.02% 110 3373 0.02% 111 3515 0.02% 112 3603 0.02% 113 4229 0.02% 114 4516 0.02% 115 4951 0.03% 116 5210 0.03% 117 5807 0.03% 118 6171 0.03% 119 6689 0.03% 120 7284 0.04% 121 7581 0.04% 122 8109 0.04% 123 8742 0.05% 124 9466 0.05% 125 10148 0.05% 126 10734 0.06% 127 11325 0.06% 128 11920 0.06% 129 13135 0.07% 130 13778 0.07% 131 14588 0.08% 132 15240 0.08% 133 15603 0.08% 134 16763 0.09% 135 17732 0.09% 136 18505 0.10% 137 19627 0.10% 138 20501 0.11% 139 21436 0.11% 140 22217 0.12% 141 23531 0.12% 142 24731 0.13% 143 25517 0.13% 144 27061 0.14% 145 27659 0.14% 146 28946 0.15% 147 31928 0.17% 148 41485 0.22% 149 215688 1.12% 150 18385871 95.69% 19214386 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=31 prefix-density=0.54 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=10 fanout-score=26.71 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.4 sequence=CTCATCAAATCTT criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.74 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=77.00 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=15.2 sequence=CTCTCTCTTTCAAACCCTA SRR14639592 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:41:18 Started mapping on | Feb 10 11:41:18 Finished on | Feb 10 11:43:33 Mapping speed, Million of reads per hour | 512.38 Number of input reads | 19214386 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18022931 Uniquely mapped reads % | 93.80% Average mapped length | 296.82 Number of splices: Total | 18750675 Number of splices: Annotated (sjdb) | 18285597 Number of splices: GT/AG | 18399889 Number of splices: GC/AG | 275882 Number of splices: AT/AC | 13455 Number of splices: Non-canonical | 61449 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.03% Deletion average length | 3.12 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391782 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 20056 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.01% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 799673 799673 799673 N_multimapping 391782 391782 391782 N_noFeature 670132 17791039 727857 N_ambiguous 279002 901 104485 UnstrandedReadsAssigned:17073797 PositiveStrandReadsAssigned:230991 NegativeStrandReadsAssigned:17190589 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639592 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639592-trimmed-pair1.fastq SRR14639592-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,214,386 reads, 17,329,229 reads pseudoaligned [quant] estimated average fragment length: 307.394 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR14639592.ke.tsv 34699 SRR14639592.se.tsv 87100 total ==> SRR14639592.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1711.61 937.535 27.6685 Potri.005G024800.1.v4.1 1035 728.606 348 24.1262 Potri.004G059700.1.v4.1 961 655.005 66 5.08981 Potri.007G009000.2.v4.1 1416 1109.61 0 0 Potri.003G141000.2.v4.1 2943 2636.61 1551 29.7145 Potri.016G087400.1.v4.1 270 68.3026 1290 954.015 Potri.015G069301.1.v4.1 564 282.541 0 0 Potri.010G195200.1.v4.1 1773 1466.61 168 5.78626 Potri.012G127500.1.v4.1 977 670.817 50 3.76503 ==> SRR14639592.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 150 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 71 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 11 SRR14639592 completed mapping pipeline successfully