Starting /dee2/code/volunteer_pipeline.sh SRR14639593 current disk space = 3059100512256 free memory = 1574117988 SRR14639593 SRAfilesize 3ab35db067cb39cae04fbf2730928d16 SRR14639593.sra SRR14639593.sra file validated SRR14639593 is paired end SRR14639593 is conventional basespace SRR14639593 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639593_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.67 32.0 32.0 32.0 32.0 32.0 2 31.54875 32.0 32.0 32.0 32.0 32.0 3 35.37375 37.0 37.0 37.0 32.0 37.0 4 36.195 37.0 37.0 37.0 37.0 37.0 5 36.44125 37.0 37.0 37.0 37.0 37.0 6 39.9415 41.0 41.0 41.0 37.0 41.0 7 40.00525 41.0 41.0 41.0 37.0 41.0 8 40.184 41.0 41.0 41.0 37.0 41.0 9 40.332 41.0 41.0 41.0 41.0 41.0 10-14 40.323350000000005 41.0 41.0 41.0 41.0 41.0 15-19 40.29545 41.0 41.0 41.0 41.0 41.0 20-24 40.30785 41.0 41.0 41.0 41.0 41.0 25-29 40.24965 41.0 41.0 41.0 41.0 41.0 30-34 40.219100000000005 41.0 41.0 41.0 41.0 41.0 35-39 40.15965 41.0 41.0 41.0 39.4 41.0 40-44 40.1708 41.0 41.0 41.0 39.4 41.0 45-49 40.14020000000001 41.0 41.0 41.0 38.6 41.0 50-54 40.09325 41.0 41.0 41.0 38.6 41.0 55-59 40.05005 41.0 41.0 41.0 37.0 41.0 60-64 39.964650000000006 41.0 41.0 41.0 37.0 41.0 65-69 39.87335 41.0 41.0 41.0 37.0 41.0 70-74 39.744600000000005 41.0 41.0 41.0 37.0 41.0 75-79 39.36364999999999 41.0 40.2 41.0 36.0 41.0 80-84 39.7453 41.0 41.0 41.0 37.0 41.0 85-89 39.755250000000004 41.0 41.0 41.0 37.0 41.0 90-94 39.743 41.0 41.0 41.0 37.0 41.0 95-99 39.620799999999996 41.0 41.0 41.0 37.0 41.0 100-104 39.53375 41.0 41.0 41.0 37.0 41.0 105-109 39.499500000000005 41.0 41.0 41.0 37.0 41.0 110-114 39.482549999999996 41.0 41.0 41.0 37.0 41.0 115-119 39.4443 41.0 41.0 41.0 37.0 41.0 120-124 39.380700000000004 41.0 41.0 41.0 37.0 41.0 125-129 39.37405 41.0 41.0 41.0 37.0 41.0 130-134 39.26465 41.0 41.0 41.0 37.0 41.0 135-139 38.94295 41.0 41.0 41.0 34.0 41.0 140-144 38.76375 41.0 41.0 41.0 32.0 41.0 145-149 38.5478 41.0 38.6 41.0 32.0 41.0 150 38.45425 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 1.0 25 5.0 26 6.0 27 10.0 28 14.0 29 21.0 30 28.0 31 22.0 32 40.0 33 33.0 34 61.0 35 79.0 36 89.0 37 127.0 38 224.0 39 436.0 40 2801.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.257564391097773 12.828207051762941 7.926981745436359 48.98724681170293 2 13.625000000000002 13.3 44.625 28.449999999999996 3 15.775 16.725 29.5 38.0 4 20.925 25.0 24.675 29.4 5 23.175 32.475 26.174999999999997 18.175 6 17.875 33.324999999999996 28.050000000000004 20.75 7 14.85 26.5 41.525 17.125 8 13.700000000000001 25.074999999999996 36.95 24.275 9 14.924999999999999 24.775 37.075 23.225 10-14 19.0 29.385 28.325 23.29 15-19 19.02 28.499999999999996 28.17 24.310000000000002 20-24 18.855 28.625 28.17 24.349999999999998 25-29 18.985 29.110000000000003 28.405 23.5 30-34 18.995 28.175 28.07 24.759999999999998 35-39 18.990000000000002 28.544999999999998 28.175 24.29 40-44 18.905 28.335 28.34 24.42 45-49 18.815 28.845 28.02 24.32 50-54 19.139999999999997 28.405 28.470000000000002 23.985 55-59 19.27 28.849999999999998 27.615000000000002 24.265 60-64 19.259999999999998 28.325 28.384999999999998 24.03 65-69 19.055 28.23 28.435 24.279999999999998 70-74 18.990000000000002 28.444999999999997 28.249999999999996 24.315 75-79 19.49 28.720000000000002 27.87 23.919999999999998 80-84 19.345000000000002 28.48 27.27 24.905 85-89 19.335 28.34 28.015 24.310000000000002 90-94 19.845 27.779999999999998 27.855 24.52 95-99 19.56 27.935 28.285 24.22 100-104 19.71 27.800000000000004 28.945 23.544999999999998 105-109 19.82099104955248 27.801390069503473 27.996399819990998 24.381219060953047 110-114 19.64 28.349999999999998 28.93 23.080000000000002 115-119 19.855 28.01 28.365000000000002 23.77 120-124 20.34 27.950000000000003 27.62 24.09 125-129 19.53 28.720000000000002 28.144999999999996 23.605 130-134 19.505 27.57 28.62 24.305 135-139 19.465 28.439999999999998 28.235 23.86 140-144 20.217021702170218 28.092809280928094 28.377837783778375 23.312331233123313 145-149 20.16 27.944999999999997 27.884999999999998 24.01 150 19.925 28.1 27.800000000000004 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 1.0 25 3.0 26 4.5 27 5.5 28 7.0 29 11.0 30 18.0 31 22.5 32 37.5 33 48.0 34 53.5 35 69.0 36 102.0 37 125.0 38 132.0 39 176.5 40 209.5 41 238.0 42 267.0 43 291.5 44 300.5 45 281.5 46 265.5 47 232.0 48 208.0 49 192.5 50 166.0 51 128.5 52 89.0 53 72.5 54 70.5 55 55.0 56 37.5 57 25.5 58 14.5 59 8.5 60 5.0 61 6.5 62 5.5 63 1.5 64 0.5 65 1.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.575 #Duplication Level Percentage of deduplicated Percentage of total 1 94.52815226011101 89.4 2 5.233941316415543 9.9 3 0.21147237642083003 0.6 4 0.026434047052603753 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.175 0.0 0.0 0.0 0.0 128-129 0.2625 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.3 0.0 0.0 0.0 0.0 134-135 0.325 0.0 0.0 0.0 0.0 136-137 0.375 0.0 0.0 0.0 0.0 138 0.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGAGA 10 0.0067147487 145.81013 1 CAACTTA 10 0.0069754543 143.9875 4 ACATTGT 10 0.0069754543 143.9875 5 AACTTAG 10 0.0069754543 143.9875 5 >>END_MODULE SRR14639593 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639593_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.22375 32.0 32.0 32.0 32.0 32.0 2 31.1 32.0 32.0 32.0 32.0 32.0 3 34.5225 37.0 32.0 37.0 32.0 37.0 4 35.55125 37.0 37.0 37.0 32.0 37.0 5 35.75 37.0 37.0 37.0 32.0 37.0 6 38.901 41.0 41.0 41.0 37.0 41.0 7 38.93575 41.0 41.0 41.0 37.0 41.0 8 38.842 41.0 41.0 41.0 37.0 41.0 9 39.159 41.0 41.0 41.0 37.0 41.0 10-14 39.158750000000005 41.0 41.0 41.0 37.0 41.0 15-19 38.9825 41.0 41.0 41.0 37.0 41.0 20-24 38.90585 41.0 41.0 41.0 37.0 41.0 25-29 38.64444999999999 41.0 41.0 41.0 33.0 41.0 30-34 38.620000000000005 41.0 41.0 41.0 33.0 41.0 35-39 38.47205 41.0 41.0 41.0 32.0 41.0 40-44 38.423550000000006 41.0 41.0 41.0 32.0 41.0 45-49 38.27815 41.0 41.0 41.0 32.0 41.0 50-54 38.22455 41.0 41.0 41.0 32.0 41.0 55-59 38.1078 41.0 41.0 41.0 32.0 41.0 60-64 38.0354 41.0 39.4 41.0 30.0 41.0 65-69 37.92015 41.0 37.8 41.0 29.0 41.0 70-74 37.74565 41.0 37.0 41.0 28.0 41.0 75-79 36.94465 40.2 36.0 41.0 25.0 41.0 80-84 37.905899999999995 41.0 37.8 41.0 31.0 41.0 85-89 37.9377 41.0 37.0 41.0 29.0 41.0 90-94 37.6064 41.0 37.0 41.0 27.0 41.0 95-99 37.68645 41.0 37.0 41.0 27.0 41.0 100-104 37.425599999999996 41.0 37.0 41.0 27.0 41.0 105-109 37.3523 41.0 37.0 41.0 27.0 41.0 110-114 37.389649999999996 41.0 37.0 41.0 27.0 41.0 115-119 37.12845 41.0 37.0 41.0 26.0 41.0 120-124 37.14534999999999 41.0 37.0 41.0 25.0 41.0 125-129 36.693349999999995 41.0 37.0 41.0 24.0 41.0 130-134 36.7119 41.0 37.0 41.0 22.0 41.0 135-139 36.292449999999995 41.0 37.0 41.0 22.0 41.0 140-144 36.1252 41.0 37.0 41.0 22.0 41.0 145-149 35.9812 41.0 36.0 41.0 20.0 41.0 150 35.662 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 5.0 17 11.0 18 11.0 19 13.0 20 21.0 21 18.0 22 26.0 23 27.0 24 31.0 25 30.0 26 26.0 27 44.0 28 44.0 29 57.0 30 52.0 31 72.0 32 78.0 33 98.0 34 103.0 35 138.0 36 157.0 37 203.0 38 291.0 39 536.0 40 1907.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.932029094557315 26.36067218459995 7.424128417356409 33.28317030348633 2 20.424999999999997 27.224999999999998 38.125 14.224999999999998 3 15.65 27.150000000000002 35.425000000000004 21.775 4 20.349999999999998 34.55 25.05 20.05 5 24.125 37.675 22.725 15.475 6 18.525 39.2 24.775 17.5 7 19.925 22.925 38.425 18.725 8 17.375 25.474999999999998 32.625 24.525 9 20.8 24.9 31.4 22.900000000000002 10-14 22.28 29.165000000000003 26.939999999999998 21.615000000000002 15-19 21.765 29.5 27.57 21.165 20-24 22.66 28.884999999999998 27.634999999999998 20.82 25-29 21.95 28.62 28.185 21.245 30-34 22.095000000000002 28.62 28.18 21.105 35-39 22.264999999999997 28.465 28.205000000000002 21.065 40-44 22.46 28.43 27.860000000000003 21.25 45-49 22.465 28.634999999999998 27.76 21.14 50-54 22.66 28.694999999999997 27.534999999999997 21.11 55-59 22.915 28.065 28.185 20.835 60-64 23.535 27.805000000000003 28.005000000000003 20.655 65-69 22.58 28.535 28.405 20.48 70-74 23.105 29.054999999999996 27.375 20.465 75-79 23.18 28.875 27.27 20.674999999999997 80-84 23.655 28.360000000000003 27.955000000000002 20.03 85-89 23.45 28.335 27.725 20.49 90-94 23.14 27.88 28.349999999999998 20.630000000000003 95-99 23.23 28.07 28.155 20.544999999999998 100-104 23.580000000000002 28.27 27.29 20.86 105-109 23.855 28.465 27.665 20.015 110-114 23.400000000000002 27.865000000000002 27.860000000000003 20.875 115-119 23.905 28.09 27.235 20.77 120-124 23.665 28.315 27.665 20.355 125-129 23.48 28.410000000000004 27.315 20.794999999999998 130-134 23.25 28.335 27.79 20.625 135-139 23.94 27.76 27.605 20.695 140-144 23.685000000000002 27.515 27.884999999999998 20.915 145-149 23.48 28.599999999999998 27.725 20.195 150 23.400000000000002 28.000000000000004 28.4 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 2.5 23 2.0 24 5.0 25 8.0 26 6.5 27 5.5 28 11.0 29 12.0 30 14.5 31 24.5 32 33.0 33 44.5 34 65.0 35 83.5 36 93.0 37 98.5 38 128.0 39 180.5 40 214.5 41 245.5 42 267.5 43 285.5 44 301.0 45 299.5 46 272.0 47 232.5 48 213.5 49 189.0 50 155.5 51 122.0 52 94.5 53 70.0 54 57.5 55 43.5 56 24.0 57 19.0 58 18.0 59 13.5 60 7.5 61 6.5 62 5.5 63 5.0 64 4.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.375 #Duplication Level Percentage of deduplicated Percentage of total 1 95.41284403669725 91.0 2 4.3512450851900395 8.3 3 0.20969855832241152 0.6 4 0.02621231979030144 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.21250000000000002 0.0 0.0 0.0 0.0 124-125 0.225 0.0 0.0 0.0 0.0 126-127 0.225 0.0 0.0 0.0 0.0 128-129 0.32499999999999996 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.375 0.0 0.0 0.0 0.0 134-135 0.4375 0.0 0.0 0.0 0.0 136-137 0.48750000000000004 0.0 0.0 0.0 0.0 138 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179045 spots for SRR14639593.sra Written 1179045 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra Read 1179043 spots for SRR14639593.sra Written 1179043 spots for SRR14639593.sra SRR ids: ['SRR14639593.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vkjlwn1n SRR14639593.sra spots: 23580862 blocks: [[1, 1179043], [1179044, 2358086], [2358087, 3537129], [3537130, 4716172], [4716173, 5895215], [5895216, 7074258], [7074259, 8253301], [8253302, 9432344], [9432345, 10611387], [10611388, 11790430], [11790431, 12969473], [12969474, 14148516], [14148517, 15327559], [15327560, 16506602], [16506603, 17685645], [17685646, 18864688], [18864689, 20043731], [20043732, 21222774], [21222775, 22401817], [22401818, 23580862]] SRR14639593 file size 8729163 SRR14639593 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639593 SRR14639593_1.fastq SRR14639593_2.fastq Input file: SRR14639593_1.fastq Paired file: SRR14639593_2.fastq trimmed: SRR14639593-trimmed-pair1.fastq, SRR14639593-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:43:07 2025 >> started Mon Feb 10 11:43:41 2025 >> done (34.206s) 23580862 read pairs processed; of these: 83 ( 0.00%) short read pairs filtered out after trimming by size control 51 ( 0.00%) empty read pairs filtered out after trimming by size control 23580728 (100.00%) read pairs available; of these: 614839 ( 2.61%) trimmed read pairs available after processing 22965889 (97.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 13 0.00% 20 16 0.00% 21 17 0.00% 22 14 0.00% 23 14 0.00% 24 18 0.00% 25 19 0.00% 26 32 0.00% 27 31 0.00% 28 27 0.00% 29 40 0.00% 30 39 0.00% 31 30 0.00% 32 38 0.00% 33 31 0.00% 34 35 0.00% 35 34 0.00% 36 47 0.00% 37 44 0.00% 38 54 0.00% 39 52 0.00% 40 50 0.00% 41 37 0.00% 42 52 0.00% 43 63 0.00% 44 58 0.00% 45 66 0.00% 46 62 0.00% 47 64 0.00% 48 61 0.00% 49 70 0.00% 50 95 0.00% 51 58 0.00% 52 68 0.00% 53 71 0.00% 54 64 0.00% 55 97 0.00% 56 88 0.00% 57 81 0.00% 58 110 0.00% 59 96 0.00% 60 103 0.00% 61 94 0.00% 62 103 0.00% 63 111 0.00% 64 107 0.00% 65 101 0.00% 66 143 0.00% 67 152 0.00% 68 135 0.00% 69 127 0.00% 70 132 0.00% 71 161 0.00% 72 160 0.00% 73 160 0.00% 74 144 0.00% 75 182 0.00% 76 197 0.00% 77 214 0.00% 78 209 0.00% 79 234 0.00% 80 261 0.00% 81 249 0.00% 82 290 0.00% 83 322 0.00% 84 345 0.00% 85 339 0.00% 86 337 0.00% 87 379 0.00% 88 412 0.00% 89 421 0.00% 90 493 0.00% 91 516 0.00% 92 552 0.00% 93 606 0.00% 94 603 0.00% 95 622 0.00% 96 728 0.00% 97 743 0.00% 98 842 0.00% 99 877 0.00% 100 919 0.00% 101 969 0.00% 102 1086 0.00% 103 1130 0.00% 104 1315 0.01% 105 1348 0.01% 106 1422 0.01% 107 1518 0.01% 108 1685 0.01% 109 1780 0.01% 110 1949 0.01% 111 2097 0.01% 112 2269 0.01% 113 2410 0.01% 114 2594 0.01% 115 2729 0.01% 116 3018 0.01% 117 3268 0.01% 118 3477 0.01% 119 3806 0.02% 120 3950 0.02% 121 4251 0.02% 122 4351 0.02% 123 4829 0.02% 124 5046 0.02% 125 5462 0.02% 126 5902 0.03% 127 6155 0.03% 128 6603 0.03% 129 7291 0.03% 130 7557 0.03% 131 7839 0.03% 132 8433 0.04% 133 8905 0.04% 134 9301 0.04% 135 10062 0.04% 136 10506 0.04% 137 11432 0.05% 138 11858 0.05% 139 12811 0.05% 140 13643 0.06% 141 14408 0.06% 142 14904 0.06% 143 15646 0.07% 144 16717 0.07% 145 17247 0.07% 146 18433 0.08% 147 21128 0.09% 148 32160 0.14% 149 242240 1.03% 150 22965889 97.39% 23580728 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=0.73 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=96.72 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=21.5 sequence=CAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATT criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.98 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=295.51 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=12.5 sequence=TAGGGTTTTAGTAGCCAGACCACATAGTTGAGGATAAACAGGAGATTGTGAAAAAAGAAAGGCAGAAGCAAGTTCAGTAATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR14639593 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:45:01 Started mapping on | Feb 10 11:45:01 Finished on | Feb 10 11:47:15 Mapping speed, Million of reads per hour | 633.51 Number of input reads | 23580728 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 21890285 Uniquely mapped reads % | 92.83% Average mapped length | 289.47 Number of splices: Total | 22878781 Number of splices: Annotated (sjdb) | 22305511 Number of splices: GT/AG | 22461037 Number of splices: GC/AG | 326679 Number of splices: AT/AC | 16711 Number of splices: Non-canonical | 74354 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.02% Deletion average length | 3.11 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 482966 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 28545 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.94% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1207478 1207478 1207478 N_multimapping 482966 482966 482966 N_noFeature 753677 21583814 814082 N_ambiguous 392555 1130 146086 UnstrandedReadsAssigned:20744053 PositiveStrandReadsAssigned:305341 NegativeStrandReadsAssigned:20930117 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639593 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639593-trimmed-pair1.fastq SRR14639593-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,580,728 reads, 21,333,072 reads pseudoaligned [quant] estimated average fragment length: 310.988 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR14639593.ke.tsv 34699 SRR14639593.se.tsv 87100 total ==> SRR14639593.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1708.01 1375 29.4441 Potri.005G024800.1.v4.1 1035 725.012 436 21.9952 Potri.004G059700.1.v4.1 961 651.384 130 7.29949 Potri.007G009000.2.v4.1 1416 1106.01 0 0 Potri.003G141000.2.v4.1 2943 2633.01 1800.05 25.0045 Potri.016G087400.1.v4.1 270 64.5423 2182 1236.51 Potri.015G069301.1.v4.1 564 277.848 0 0 Potri.010G195200.1.v4.1 1773 1463.01 211.957 5.29892 Potri.012G127500.1.v4.1 977 667.193 92 5.04339 ==> SRR14639593.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 190 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 342 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 124 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 10 SRR14639593 completed mapping pipeline successfully