Starting /dee2/code/volunteer_pipeline.sh SRR14639594 current disk space = 3059125317632 free memory = 1525883740 SRR14639594 SRAfilesize 226263ca04f551a2ce40f262c7e93a02 SRR14639594.sra SRR14639594.sra file validated SRR14639594 is paired end SRR14639594 is conventional basespace SRR14639594 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639594_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61375 32.0 32.0 32.0 32.0 32.0 2 31.48 32.0 32.0 32.0 32.0 32.0 3 35.25625 37.0 32.0 37.0 32.0 37.0 4 36.10625 37.0 37.0 37.0 32.0 37.0 5 36.2375 37.0 37.0 37.0 37.0 37.0 6 39.75175 41.0 41.0 41.0 37.0 41.0 7 39.9045 41.0 41.0 41.0 37.0 41.0 8 40.19125 41.0 41.0 41.0 37.0 41.0 9 40.2025 41.0 41.0 41.0 37.0 41.0 10-14 40.2248 41.0 41.0 41.0 39.4 41.0 15-19 40.22840000000001 41.0 41.0 41.0 40.2 41.0 20-24 40.180949999999996 41.0 41.0 41.0 38.6 41.0 25-29 40.126400000000004 41.0 41.0 41.0 37.0 41.0 30-34 40.10595 41.0 41.0 41.0 37.8 41.0 35-39 40.021699999999996 41.0 41.0 41.0 37.8 41.0 40-44 39.94035 41.0 41.0 41.0 37.0 41.0 45-49 39.91915 41.0 41.0 41.0 37.0 41.0 50-54 39.872400000000006 41.0 41.0 41.0 37.0 41.0 55-59 39.7333 41.0 41.0 41.0 37.0 41.0 60-64 39.71805 41.0 41.0 41.0 37.0 41.0 65-69 39.6385 41.0 41.0 41.0 37.0 41.0 70-74 39.4653 41.0 41.0 41.0 37.0 41.0 75-79 39.0505 41.0 40.2 41.0 36.0 41.0 80-84 39.484500000000004 41.0 41.0 41.0 37.0 41.0 85-89 39.4417 41.0 41.0 41.0 37.0 41.0 90-94 39.3441 41.0 41.0 41.0 37.0 41.0 95-99 39.29305 41.0 41.0 41.0 37.0 41.0 100-104 39.18285 41.0 41.0 41.0 37.0 41.0 105-109 39.18885 41.0 41.0 41.0 37.0 41.0 110-114 39.11784999999999 41.0 41.0 41.0 37.0 41.0 115-119 39.097 41.0 41.0 41.0 37.0 41.0 120-124 38.99995 41.0 41.0 41.0 36.0 41.0 125-129 39.0646 41.0 41.0 41.0 37.0 41.0 130-134 38.8394 41.0 41.0 41.0 33.0 41.0 135-139 38.5587 41.0 41.0 41.0 32.0 41.0 140-144 38.266000000000005 41.0 38.6 41.0 32.0 41.0 145-149 38.07795 41.0 37.0 41.0 32.0 41.0 150 37.8435 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 4.0 22 1.0 23 5.0 24 4.0 25 6.0 26 8.0 27 17.0 28 22.0 29 15.0 30 24.0 31 38.0 32 48.0 33 54.0 34 61.0 35 87.0 36 108.0 37 158.0 38 231.0 39 554.0 40 2553.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.03450862715679 13.50337584396099 11.552888222055515 36.90922730682671 2 16.400000000000002 13.100000000000001 41.175 29.325000000000003 3 17.849999999999998 18.625 28.575 34.949999999999996 4 22.325 25.5 24.525 27.650000000000002 5 23.175 31.15 27.55 18.125 6 17.549999999999997 34.55 26.700000000000003 21.2 7 15.174999999999999 26.75 41.449999999999996 16.625 8 14.099999999999998 24.925 37.0 23.974999999999998 9 15.9 24.9 35.25 23.95 10-14 19.68 29.535 28.335 22.45 15-19 19.950000000000003 27.76 28.189999999999998 24.099999999999998 20-24 19.52 28.310000000000002 28.449999999999996 23.72 25-29 19.925 28.405 28.244999999999997 23.425 30-34 19.55 28.694999999999997 27.54 24.215 35-39 19.53 28.625 27.97 23.875 40-44 19.97 28.765 28.165000000000003 23.1 45-49 19.775000000000002 28.615000000000002 27.935 23.674999999999997 50-54 20.22 27.555000000000003 28.549999999999997 23.674999999999997 55-59 19.73 27.935 28.33 24.005000000000003 60-64 20.59 28.03 27.98 23.400000000000002 65-69 19.744999999999997 28.410000000000004 28.544999999999998 23.3 70-74 20.02 28.605000000000004 27.91 23.465 75-79 20.19 28.355000000000004 27.534999999999997 23.919999999999998 80-84 20.575 28.07 27.725 23.630000000000003 85-89 20.025000000000002 27.77 28.355000000000004 23.849999999999998 90-94 20.16 28.044999999999998 27.779999999999998 24.015 95-99 20.025000000000002 27.985 28.194999999999997 23.794999999999998 100-104 20.45 28.18 27.834999999999997 23.535 105-109 20.255000000000003 27.88 28.185 23.68 110-114 20.724999999999998 27.66 27.810000000000002 23.805 115-119 20.585 28.075 27.900000000000002 23.44 120-124 20.125 28.249999999999996 28.16 23.465 125-129 19.97 27.49 28.375 24.165 130-134 20.06 27.915 28.21 23.815 135-139 20.29 27.29 28.105000000000004 24.315 140-144 20.553082962444368 27.544131619742963 27.799169875481322 24.10361554233135 145-149 20.66 28.110000000000003 27.815 23.415 150 19.475 27.875 27.700000000000003 24.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 0.0 7 0.5 8 1.5 9 1.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 6.5 25 8.0 26 8.0 27 12.0 28 14.5 29 15.5 30 18.0 31 26.5 32 33.5 33 39.5 34 53.0 35 71.0 36 86.0 37 116.5 38 148.5 39 154.0 40 197.0 41 249.0 42 257.0 43 266.5 44 263.0 45 256.5 46 247.5 47 223.5 48 212.5 49 191.5 50 162.0 51 141.5 52 111.5 53 77.5 54 62.0 55 53.5 56 49.0 57 42.5 58 27.0 59 19.0 60 16.0 61 12.5 62 8.5 63 5.5 64 4.0 65 3.0 66 4.0 67 4.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.99341238471673 90.125 2 4.63768115942029 8.799999999999999 3 0.3425559947299078 0.975 4 0.026350461133069828 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0125 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0125 0.0 0.0 0.025 0.0 114-115 0.025 0.0 0.0 0.025 0.0 116-117 0.025 0.0 0.0 0.025 0.0 118-119 0.025 0.0 0.0 0.025 0.0 120-121 0.025 0.0 0.0 0.025 0.0 122-123 0.025 0.0 0.0 0.025 0.0 124-125 0.025 0.0 0.0 0.025 0.0 126-127 0.037500000000000006 0.0 0.0 0.025 0.0 128-129 0.05 0.0 0.0 0.025 0.0 130-131 0.05 0.0 0.0 0.025 0.0 132-133 0.05 0.0 0.0 0.025 0.0 134-135 0.05 0.0 0.0 0.025 0.0 136-137 0.05 0.0 0.0 0.025 0.0 138 0.05 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639594 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639594_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8525 32.0 32.0 32.0 32.0 32.0 2 30.81125 32.0 32.0 32.0 32.0 32.0 3 33.84625 37.0 32.0 37.0 32.0 37.0 4 35.05375 37.0 37.0 37.0 32.0 37.0 5 35.2 37.0 37.0 37.0 32.0 37.0 6 38.406 41.0 37.0 41.0 32.0 41.0 7 38.316 41.0 41.0 41.0 32.0 41.0 8 38.3495 41.0 41.0 41.0 32.0 41.0 9 38.5545 41.0 41.0 41.0 32.0 41.0 10-14 38.63440000000001 41.0 41.0 41.0 32.0 41.0 15-19 38.3243 41.0 41.0 41.0 32.0 41.0 20-24 38.164249999999996 41.0 40.2 41.0 31.0 41.0 25-29 37.76905 41.0 37.0 41.0 29.0 41.0 30-34 37.79445 41.0 37.0 41.0 27.0 41.0 35-39 37.57655 41.0 37.0 41.0 27.0 41.0 40-44 37.34695 41.0 37.0 41.0 27.0 41.0 45-49 37.31555 41.0 37.0 41.0 27.0 41.0 50-54 37.208600000000004 41.0 37.0 41.0 27.0 41.0 55-59 37.142849999999996 41.0 37.0 41.0 27.0 41.0 60-64 37.2175 41.0 37.0 41.0 27.0 41.0 65-69 36.956849999999996 41.0 37.0 41.0 27.0 41.0 70-74 36.685 41.0 37.0 41.0 24.0 41.0 75-79 35.927049999999994 40.2 35.0 41.0 22.0 41.0 80-84 36.890750000000004 41.0 37.0 41.0 23.0 41.0 85-89 36.80165 41.0 37.0 41.0 22.0 41.0 90-94 36.61665 41.0 37.0 41.0 22.0 41.0 95-99 36.62949999999999 41.0 37.0 41.0 22.0 41.0 100-104 36.358850000000004 41.0 37.0 41.0 22.0 41.0 105-109 36.4216 41.0 37.0 41.0 22.0 41.0 110-114 36.18325 41.0 37.0 41.0 22.0 41.0 115-119 35.8984 41.0 36.0 41.0 20.0 41.0 120-124 36.02195 41.0 37.0 41.0 22.0 41.0 125-129 35.49805 41.0 34.0 41.0 20.0 41.0 130-134 35.51950000000001 41.0 33.0 41.0 22.0 41.0 135-139 35.026149999999994 41.0 33.0 41.0 18.0 41.0 140-144 34.74745 41.0 32.0 41.0 18.0 41.0 145-149 34.522000000000006 40.2 31.0 41.0 12.0 41.0 150 34.132 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 10.0 17 18.0 18 22.0 19 25.0 20 29.0 21 34.0 22 33.0 23 27.0 24 37.0 25 44.0 26 53.0 27 54.0 28 57.0 29 71.0 30 77.0 31 80.0 32 106.0 33 123.0 34 121.0 35 168.0 36 188.0 37 253.0 38 344.0 39 585.0 40 1439.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.31815907953977 27.288644322161083 10.030015007503753 26.3631815907954 2 19.725 27.675 37.4 15.2 3 18.825 26.924999999999997 34.175 20.075000000000003 4 23.974999999999998 32.275 23.525 20.225 5 22.15 39.925 21.675 16.25 6 18.0 37.125 25.25 19.625 7 19.05 23.275000000000002 37.275000000000006 20.4 8 16.425 24.224999999999998 34.449999999999996 24.9 9 20.65 23.65 31.15 24.55 10-14 22.439999999999998 28.65 27.134999999999998 21.775 15-19 22.07 28.255000000000003 27.97 21.705 20-24 22.215 28.189999999999998 27.67 21.925 25-29 21.755 28.26 27.51 22.475 30-34 21.8 28.18 28.63 21.39 35-39 22.41 28.035 28.575 20.979999999999997 40-44 22.12 27.794999999999998 27.839999999999996 22.245 45-49 22.56 27.625 28.055000000000003 21.759999999999998 50-54 22.37 28.265 27.944999999999997 21.42 55-59 23.11 28.215 27.169999999999998 21.505 60-64 22.31 28.435 27.860000000000003 21.395 65-69 22.45 27.515 28.165000000000003 21.87 70-74 22.57 27.61 28.07 21.75 75-79 22.825 27.61 28.01 21.555 80-84 22.425 28.655 27.750000000000004 21.17 85-89 22.845 28.994999999999997 27.105 21.055 90-94 22.79 28.345 27.73 21.135 95-99 22.78 27.96 27.925 21.335 100-104 22.595000000000002 28.185 27.38 21.84 105-109 23.35 28.27 27.089999999999996 21.29 110-114 22.925 28.005000000000003 27.265 21.805 115-119 23.055 28.13 26.665 22.15 120-124 23.085 27.815 27.305 21.795 125-129 22.925 27.915 27.445000000000004 21.715 130-134 22.855 27.860000000000003 27.615000000000002 21.67 135-139 22.68 27.700000000000003 27.935 21.685 140-144 23.189999999999998 27.505000000000003 27.68 21.625 145-149 23.34 27.71 27.295 21.654999999999998 150 23.400000000000002 27.85 27.150000000000002 21.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 0.5 18 0.0 19 0.5 20 2.0 21 2.0 22 0.5 23 1.0 24 3.5 25 4.5 26 7.5 27 8.5 28 9.0 29 19.0 30 30.0 31 32.0 32 28.5 33 40.0 34 59.0 35 79.0 36 99.0 37 121.5 38 155.0 39 175.0 40 190.0 41 214.0 42 250.0 43 257.5 44 253.0 45 266.5 46 252.0 47 233.0 48 213.0 49 189.0 50 151.5 51 117.0 52 96.0 53 84.5 54 74.0 55 52.5 56 49.0 57 40.0 58 28.5 59 30.5 60 21.5 61 13.0 62 10.5 63 4.0 64 5.0 65 5.0 66 2.0 67 3.5 68 4.0 69 1.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.82136328022982 91.725 2 3.891355445285975 7.449999999999999 3 0.2872812744841995 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.0875 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.16249999999999998 0.0 0.0 0.0 0.0 128-129 0.175 0.0 0.0 0.0 0.0 130-131 0.175 0.0 0.0 0.0 0.0 132-133 0.175 0.0 0.0 0.0 0.0 134-135 0.175 0.0 0.0 0.0 0.0 136-137 0.175 0.0 0.0 0.0 0.0 138 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATTCT 10 0.006973645 144.0 3 ATTCAAA 10 0.006973645 144.0 5 TTTTTTT 30 0.0015031899 23.999998 25-29 >>END_MODULE Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079915 spots for SRR14639594.sra Written 1079915 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra Read 1079898 spots for SRR14639594.sra Written 1079898 spots for SRR14639594.sra SRR ids: ['SRR14639594.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cg3z5v10 SRR14639594.sra spots: 21597977 blocks: [[1, 1079898], [1079899, 2159796], [2159797, 3239694], [3239695, 4319592], [4319593, 5399490], [5399491, 6479388], [6479389, 7559286], [7559287, 8639184], [8639185, 9719082], [9719083, 10798980], [10798981, 11878878], [11878879, 12958776], [12958777, 14038674], [14038675, 15118572], [15118573, 16198470], [16198471, 17278368], [17278369, 18358266], [18358267, 19438164], [19438165, 20518062], [20518063, 21597977]] SRR14639594 file size 7994213 SRR14639594 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639594 SRR14639594_1.fastq SRR14639594_2.fastq Input file: SRR14639594_1.fastq Paired file: SRR14639594_2.fastq trimmed: SRR14639594-trimmed-pair1.fastq, SRR14639594-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:32:05 2025 >> started Mon Feb 10 11:32:34 2025 >> done (29.048s) 21597977 read pairs processed; of these: 157 ( 0.00%) short read pairs filtered out after trimming by size control 124 ( 0.00%) empty read pairs filtered out after trimming by size control 21597696 (100.00%) read pairs available; of these: 458152 ( 2.12%) trimmed read pairs available after processing 21139544 (97.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 44 0.00% 20 26 0.00% 21 37 0.00% 22 34 0.00% 23 49 0.00% 24 43 0.00% 25 45 0.00% 26 57 0.00% 27 59 0.00% 28 63 0.00% 29 56 0.00% 30 77 0.00% 31 74 0.00% 32 89 0.00% 33 104 0.00% 34 82 0.00% 35 101 0.00% 36 91 0.00% 37 72 0.00% 38 97 0.00% 39 82 0.00% 40 96 0.00% 41 97 0.00% 42 115 0.00% 43 116 0.00% 44 109 0.00% 45 95 0.00% 46 122 0.00% 47 113 0.00% 48 97 0.00% 49 129 0.00% 50 149 0.00% 51 132 0.00% 52 111 0.00% 53 115 0.00% 54 154 0.00% 55 143 0.00% 56 172 0.00% 57 177 0.00% 58 166 0.00% 59 189 0.00% 60 184 0.00% 61 190 0.00% 62 180 0.00% 63 205 0.00% 64 196 0.00% 65 166 0.00% 66 202 0.00% 67 190 0.00% 68 204 0.00% 69 225 0.00% 70 262 0.00% 71 236 0.00% 72 263 0.00% 73 262 0.00% 74 268 0.00% 75 296 0.00% 76 264 0.00% 77 299 0.00% 78 300 0.00% 79 325 0.00% 80 347 0.00% 81 356 0.00% 82 373 0.00% 83 345 0.00% 84 367 0.00% 85 383 0.00% 86 426 0.00% 87 425 0.00% 88 441 0.00% 89 456 0.00% 90 513 0.00% 91 483 0.00% 92 464 0.00% 93 508 0.00% 94 508 0.00% 95 607 0.00% 96 570 0.00% 97 600 0.00% 98 667 0.00% 99 624 0.00% 100 719 0.00% 101 703 0.00% 102 724 0.00% 103 785 0.00% 104 834 0.00% 105 925 0.00% 106 981 0.00% 107 912 0.00% 108 952 0.00% 109 1001 0.00% 110 1051 0.00% 111 1073 0.00% 112 1150 0.01% 113 1179 0.01% 114 1308 0.01% 115 1339 0.01% 116 1400 0.01% 117 1397 0.01% 118 1443 0.01% 119 1528 0.01% 120 1550 0.01% 121 1615 0.01% 122 1711 0.01% 123 1785 0.01% 124 1862 0.01% 125 1935 0.01% 126 2024 0.01% 127 2134 0.01% 128 2230 0.01% 129 2341 0.01% 130 2386 0.01% 131 2399 0.01% 132 2401 0.01% 133 2512 0.01% 134 2632 0.01% 135 2717 0.01% 136 3028 0.01% 137 3023 0.01% 138 3114 0.01% 139 3072 0.01% 140 3154 0.01% 141 3411 0.02% 142 3477 0.02% 143 3678 0.02% 144 3911 0.02% 145 4002 0.02% 146 4596 0.02% 147 7209 0.03% 148 22889 0.11% 149 315766 1.46% 150 21139544 97.88% 21597696 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=25 prefix-density=0.31 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=29.48 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.2 sequence=CCACCACCGCCGCTTCCGCGGGATTGTGCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATCTCTCATTGCCTTCTC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.27 fanout-score-rank=14 prefix-density=0.43 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=200.18 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=26.8 sequence=TTCAAGAAAATGG SRR14639594 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:33:43 Started mapping on | Feb 10 11:33:43 Finished on | Feb 10 11:40:46 Mapping speed, Million of reads per hour | 183.81 Number of input reads | 21597696 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17374242 Uniquely mapped reads % | 80.44% Average mapped length | 297.30 Number of splices: Total | 14961861 Number of splices: Annotated (sjdb) | 14626139 Number of splices: GT/AG | 14708650 Number of splices: GC/AG | 189481 Number of splices: AT/AC | 13420 Number of splices: Non-canonical | 50310 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494453 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 66468 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.75% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3729001 3729001 3729001 N_multimapping 494453 494453 494453 N_noFeature 603931 17224354 663735 N_ambiguous 220854 1120 130252 UnstrandedReadsAssigned:16549457 PositiveStrandReadsAssigned:148768 NegativeStrandReadsAssigned:16580255 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639594 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639594-trimmed-pair1.fastq SRR14639594-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,597,696 reads, 17,162,733 reads pseudoaligned [quant] estimated average fragment length: 370.261 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR14639594.ke.tsv 34699 SRR14639594.se.tsv 87100 total ==> SRR14639594.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1648.74 3007 94.9799 Potri.005G024800.1.v4.1 1035 665.739 571 44.6666 Potri.004G059700.1.v4.1 961 592.195 141 12.3995 Potri.007G009000.2.v4.1 1416 1046.74 0 0 Potri.003G141000.2.v4.1 2943 2573.74 996 20.1533 Potri.016G087400.1.v4.1 270 46.6782 935 1043.15 Potri.015G069301.1.v4.1 564 224.717 0 0 Potri.010G195200.1.v4.1 1773 1403.74 45 1.66946 Potri.012G127500.1.v4.1 977 608.001 1129 96.7029 ==> SRR14639594.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 309 SRR14639594 completed mapping pipeline successfully