Starting /dee2/code/volunteer_pipeline.sh SRR14639595 current disk space = 3058831282176 free memory = 1531093872 SRR14639595 SRAfilesize e74c8173195b6d68cdc0151cd3be6f9d SRR14639595.sra SRR14639595.sra file validated SRR14639595 is paired end SRR14639595 is conventional basespace SRR14639595 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639595_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61375 32.0 32.0 32.0 32.0 32.0 2 31.52375 32.0 32.0 32.0 32.0 32.0 3 35.08875 37.0 32.0 37.0 32.0 37.0 4 36.04 37.0 37.0 37.0 32.0 37.0 5 36.23375 37.0 37.0 37.0 37.0 37.0 6 39.7425 41.0 41.0 41.0 37.0 41.0 7 39.83575 41.0 41.0 41.0 37.0 41.0 8 40.065 41.0 41.0 41.0 37.0 41.0 9 40.19275 41.0 41.0 41.0 37.0 41.0 10-14 40.12814999999999 41.0 41.0 41.0 37.8 41.0 15-19 40.19085 41.0 41.0 41.0 37.0 41.0 20-24 40.17305 41.0 41.0 41.0 37.0 41.0 25-29 40.071600000000004 41.0 41.0 41.0 37.0 41.0 30-34 40.08895 41.0 41.0 41.0 37.0 41.0 35-39 39.98765 41.0 41.0 41.0 37.0 41.0 40-44 39.929050000000004 41.0 41.0 41.0 37.0 41.0 45-49 39.8086 41.0 41.0 41.0 37.0 41.0 50-54 39.7836 41.0 41.0 41.0 37.0 41.0 55-59 39.749249999999996 41.0 41.0 41.0 37.0 41.0 60-64 39.69465 41.0 41.0 41.0 37.0 41.0 65-69 39.54715 41.0 41.0 41.0 37.0 41.0 70-74 39.36615 41.0 41.0 41.0 37.0 41.0 75-79 38.904849999999996 41.0 39.4 41.0 35.0 41.0 80-84 39.38545 41.0 41.0 41.0 37.0 41.0 85-89 39.3631 41.0 41.0 41.0 37.0 41.0 90-94 39.288850000000004 41.0 41.0 41.0 37.0 41.0 95-99 39.23625 41.0 41.0 41.0 37.0 41.0 100-104 39.079699999999995 41.0 41.0 41.0 37.0 41.0 105-109 39.00765 41.0 41.0 41.0 36.0 41.0 110-114 39.0434 41.0 41.0 41.0 36.0 41.0 115-119 38.9349 41.0 41.0 41.0 35.0 41.0 120-124 38.8669 41.0 41.0 41.0 33.0 41.0 125-129 38.91175 41.0 41.0 41.0 36.0 41.0 130-134 38.637950000000004 41.0 41.0 41.0 32.0 41.0 135-139 38.48584999999999 41.0 40.2 41.0 32.0 41.0 140-144 38.22295 41.0 37.8 41.0 32.0 41.0 145-149 37.997249999999994 41.0 37.0 41.0 32.0 41.0 150 37.72 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 4.0 23 1.0 24 7.0 25 11.0 26 7.0 27 10.0 28 16.0 29 25.0 30 25.0 31 35.0 32 52.0 33 58.0 34 73.0 35 89.0 36 121.0 37 153.0 38 256.0 39 565.0 40 2488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.48462115528882 13.603400850212552 10.177544386096523 37.7344336084021 2 17.075000000000003 11.275 41.25 30.4 3 17.575 18.224999999999998 28.275 35.925000000000004 4 22.400000000000002 25.324999999999996 24.3 27.975 5 23.25 31.474999999999998 26.125 19.15 6 17.625 33.5 28.025 20.849999999999998 7 14.000000000000002 25.575 42.175000000000004 18.25 8 14.625 23.974999999999998 37.15 24.25 9 16.25 24.55 35.099999999999994 24.099999999999998 10-14 18.795 29.25 28.744999999999997 23.21 15-19 19.040000000000003 27.735 28.935 24.29 20-24 19.2 28.46 27.99 24.349999999999998 25-29 19.975 27.529999999999998 28.785 23.71 30-34 19.705000000000002 27.889999999999997 28.335 24.07 35-39 19.744999999999997 27.975 28.54 23.74 40-44 20.005 28.315 28.444999999999997 23.235 45-49 19.775000000000002 28.13 28.035 24.060000000000002 50-54 20.46 28.305000000000003 27.37 23.865 55-59 20.23 28.384999999999998 27.73 23.655 60-64 19.605 28.26 28.03 24.104999999999997 65-69 20.075000000000003 28.48 27.279999999999998 24.165 70-74 20.3 28.57 27.639999999999997 23.49 75-79 19.945 27.965 27.57 24.52 80-84 20.625 27.99 27.99 23.395 85-89 20.095 28.075 27.694999999999997 24.135 90-94 20.73 27.275 28.144999999999996 23.849999999999998 95-99 20.375 27.675 28.355000000000004 23.595 100-104 20.655 27.575 27.875 23.895 105-109 20.011000550027504 28.516425821291065 27.811390569528477 23.661183059152957 110-114 20.22 27.405 28.275 24.099999999999998 115-119 20.580000000000002 27.72 27.425 24.275 120-124 20.205000000000002 28.1 27.82 23.875 125-129 20.155 27.965 27.52 24.36 130-134 20.66 27.66 27.644999999999996 24.035 135-139 21.095 28.04 27.02 23.845 140-144 20.838125718857828 26.894034105115765 28.22423363504526 24.04360654098115 145-149 20.150000000000002 27.845 27.544999999999998 24.46 150 21.075 28.525 28.075 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 2.0 19 3.0 20 2.0 21 0.5 22 2.5 23 3.5 24 4.5 25 5.5 26 7.5 27 8.5 28 9.5 29 13.5 30 26.0 31 34.0 32 34.5 33 43.0 34 52.5 35 72.0 36 92.5 37 119.5 38 142.5 39 146.5 40 177.0 41 229.0 42 254.0 43 251.0 44 257.0 45 259.5 46 251.5 47 237.0 48 213.5 49 190.5 50 159.5 51 128.0 52 105.0 53 86.5 54 79.5 55 64.5 56 44.0 57 39.5 58 32.0 59 23.0 60 16.0 61 9.5 62 12.0 63 13.5 64 10.0 65 8.0 66 4.0 67 4.0 68 4.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.42586750788644 90.75 2 4.0746582544689804 7.75 3 0.4206098843322818 1.2 4 0.07886435331230283 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGGCT 10 0.006973645 144.0 1 >>END_MODULE SRR14639595 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639595_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.68625 32.0 32.0 32.0 32.0 32.0 2 30.715 32.0 32.0 32.0 32.0 32.0 3 33.63 37.0 32.0 37.0 27.0 37.0 4 34.68375 37.0 37.0 37.0 32.0 37.0 5 34.905 37.0 37.0 37.0 32.0 37.0 6 37.995 41.0 37.0 41.0 32.0 41.0 7 38.091 41.0 37.0 41.0 32.0 41.0 8 37.822 41.0 37.0 41.0 27.0 41.0 9 38.12575 41.0 41.0 41.0 27.0 41.0 10-14 38.23945 41.0 40.2 41.0 32.0 41.0 15-19 38.066250000000004 41.0 39.4 41.0 31.0 41.0 20-24 37.92335 41.0 37.8 41.0 29.0 41.0 25-29 37.4271 41.0 37.0 41.0 27.0 41.0 30-34 37.4581 41.0 37.0 41.0 27.0 41.0 35-39 37.360600000000005 41.0 37.0 41.0 27.0 41.0 40-44 37.22235 41.0 37.0 41.0 27.0 41.0 45-49 37.023900000000005 41.0 37.0 41.0 27.0 41.0 50-54 36.8829 41.0 37.0 41.0 26.0 41.0 55-59 36.7753 41.0 37.0 41.0 25.0 41.0 60-64 36.8125 41.0 37.0 41.0 26.0 41.0 65-69 36.40945 41.0 37.0 41.0 23.0 41.0 70-74 36.28975 41.0 37.0 41.0 22.0 41.0 75-79 35.3905 40.2 35.0 41.0 22.0 41.0 80-84 36.40689999999999 41.0 37.0 41.0 22.0 41.0 85-89 36.448899999999995 41.0 37.0 41.0 22.0 41.0 90-94 36.16295 41.0 37.0 41.0 22.0 41.0 95-99 36.263400000000004 41.0 37.0 41.0 22.0 41.0 100-104 35.881299999999996 41.0 34.0 41.0 20.0 41.0 105-109 35.8163 41.0 34.0 41.0 22.0 41.0 110-114 35.7527 41.0 35.0 41.0 22.0 41.0 115-119 35.4367 41.0 33.0 41.0 20.0 41.0 120-124 35.4886 41.0 32.0 41.0 22.0 41.0 125-129 35.00509999999999 41.0 32.0 41.0 18.0 41.0 130-134 34.8939 41.0 32.0 41.0 22.0 41.0 135-139 34.42285 39.4 31.0 41.0 18.0 41.0 140-144 34.0121 37.8 32.0 41.0 12.0 41.0 145-149 33.8583 37.0 31.0 41.0 12.0 41.0 150 33.5215 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 8.0 16 10.0 17 17.0 18 20.0 19 38.0 20 24.0 21 23.0 22 38.0 23 36.0 24 39.0 25 50.0 26 45.0 27 64.0 28 70.0 29 80.0 30 89.0 31 93.0 32 118.0 33 132.0 34 154.0 35 190.0 36 191.0 37 295.0 38 332.0 39 612.0 40 1228.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.821026282853566 26.83354192740926 9.712140175219023 26.633291614518146 2 20.5 26.950000000000003 36.05 16.5 3 19.275000000000002 26.075 34.175 20.474999999999998 4 23.025000000000002 32.75 23.200000000000003 21.025 5 23.75 38.074999999999996 21.85 16.325 6 18.55 36.925000000000004 24.425 20.1 7 19.775000000000002 21.3 36.9 22.025 8 16.55 23.674999999999997 33.375 26.400000000000002 9 20.349999999999998 24.55 29.65 25.45 10-14 22.465 28.749999999999996 26.235000000000003 22.55 15-19 22.814999999999998 27.765 27.560000000000002 21.86 20-24 22.465 28.09 27.025 22.42 25-29 22.445 28.33 27.215 22.009999999999998 30-34 22.46 28.07 27.62 21.85 35-39 22.335 27.74 27.495000000000005 22.43 40-44 22.55 27.639999999999997 27.66 22.15 45-49 22.925 26.974999999999998 28.27 21.83 50-54 22.63 27.13 27.92 22.32 55-59 22.759999999999998 27.505000000000003 28.1 21.634999999999998 60-64 23.05 27.35 27.544999999999998 22.055 65-69 22.814999999999998 27.939999999999998 27.544999999999998 21.7 70-74 23.150000000000002 27.355 27.35 22.145 75-79 23.365 26.995 27.375 22.264999999999997 80-84 23.32 27.315 27.525 21.84 85-89 23.185 27.495000000000005 27.825 21.495 90-94 22.759999999999998 27.915 27.694999999999997 21.63 95-99 23.23 27.92 26.91 21.94 100-104 23.69 27.825 27.029999999999998 21.455 105-109 23.49 28.044999999999998 26.71 21.755 110-114 22.82 28.34 26.884999999999998 21.955 115-119 23.691184559227963 28.001400070003502 26.3863193159658 21.921096054802742 120-124 23.765 27.950000000000003 27.18 21.105 125-129 23.515 28.055000000000003 26.105 22.325 130-134 24.044999999999998 27.82 26.6 21.535 135-139 23.455000000000002 27.939999999999998 26.645000000000003 21.959999999999997 140-144 23.41 27.525 27.495000000000005 21.57 145-149 23.47 27.72 26.995 21.815 150 23.75 27.35 27.05 21.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 3.0 21 3.0 22 1.0 23 1.0 24 3.5 25 7.5 26 7.0 27 8.5 28 10.5 29 8.5 30 13.5 31 27.0 32 34.0 33 39.5 34 51.5 35 59.5 36 76.0 37 95.0 38 121.5 39 152.0 40 187.5 41 219.5 42 237.5 43 252.0 44 261.0 45 253.5 46 233.5 47 221.5 48 215.5 49 193.0 50 158.0 51 140.0 52 130.5 53 115.5 54 93.5 55 69.5 56 59.0 57 54.0 58 43.0 59 32.0 60 22.0 61 20.0 62 18.5 63 12.0 64 7.0 65 5.0 66 3.5 67 5.5 68 4.5 69 1.5 70 0.5 71 1.5 72 1.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.27313004951785 92.35 2 3.3359395360959083 6.4 3 0.3388063591347407 0.975 4 0.026062027625749284 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026062027625749284 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.125 0.0 0.0 0.0 0.0 134-135 0.125 0.0 0.0 0.0 0.0 136-137 0.125 0.0 0.0 0.0 0.0 138 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGCT 10 0.006973645 144.0 7 TTCACAT 10 0.006973645 144.0 2 AATGCTA 10 0.006973645 144.0 8 TTTTTTT 55 0.0026350126 15.709091 20-24 >>END_MODULE Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261426 spots for SRR14639595.sra Written 1261426 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra Read 1261420 spots for SRR14639595.sra Written 1261420 spots for SRR14639595.sra SRR ids: ['SRR14639595.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lckg0g6c SRR14639595.sra spots: 25228406 blocks: [[1, 1261420], [1261421, 2522840], [2522841, 3784260], [3784261, 5045680], [5045681, 6307100], [6307101, 7568520], [7568521, 8829940], [8829941, 10091360], [10091361, 11352780], [11352781, 12614200], [12614201, 13875620], [13875621, 15137040], [15137041, 16398460], [16398461, 17659880], [17659881, 18921300], [18921301, 20182720], [20182721, 21444140], [21444141, 22705560], [22705561, 23966980], [23966981, 25228406]] SRR14639595 file size 9339864 SRR14639595 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639595 SRR14639595_1.fastq SRR14639595_2.fastq Input file: SRR14639595_1.fastq Paired file: SRR14639595_2.fastq trimmed: SRR14639595-trimmed-pair1.fastq, SRR14639595-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:23:49 2025 >> started Mon Feb 10 11:24:30 2025 >> done (41.619s) 25228406 read pairs processed; of these: 156 ( 0.00%) short read pairs filtered out after trimming by size control 61 ( 0.00%) empty read pairs filtered out after trimming by size control 25228189 (100.00%) read pairs available; of these: 488138 ( 1.93%) trimmed read pairs available after processing 24740051 (98.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 32 0.00% 20 31 0.00% 21 50 0.00% 22 33 0.00% 23 42 0.00% 24 51 0.00% 25 51 0.00% 26 44 0.00% 27 66 0.00% 28 55 0.00% 29 51 0.00% 30 90 0.00% 31 54 0.00% 32 72 0.00% 33 70 0.00% 34 73 0.00% 35 96 0.00% 36 100 0.00% 37 79 0.00% 38 128 0.00% 39 105 0.00% 40 82 0.00% 41 87 0.00% 42 95 0.00% 43 123 0.00% 44 101 0.00% 45 91 0.00% 46 107 0.00% 47 93 0.00% 48 124 0.00% 49 112 0.00% 50 135 0.00% 51 139 0.00% 52 113 0.00% 53 124 0.00% 54 117 0.00% 55 157 0.00% 56 140 0.00% 57 142 0.00% 58 158 0.00% 59 146 0.00% 60 144 0.00% 61 167 0.00% 62 158 0.00% 63 152 0.00% 64 141 0.00% 65 136 0.00% 66 140 0.00% 67 176 0.00% 68 175 0.00% 69 175 0.00% 70 211 0.00% 71 169 0.00% 72 188 0.00% 73 196 0.00% 74 199 0.00% 75 212 0.00% 76 186 0.00% 77 206 0.00% 78 234 0.00% 79 211 0.00% 80 210 0.00% 81 225 0.00% 82 234 0.00% 83 234 0.00% 84 260 0.00% 85 245 0.00% 86 227 0.00% 87 214 0.00% 88 291 0.00% 89 265 0.00% 90 263 0.00% 91 270 0.00% 92 266 0.00% 93 284 0.00% 94 297 0.00% 95 311 0.00% 96 271 0.00% 97 343 0.00% 98 355 0.00% 99 356 0.00% 100 329 0.00% 101 360 0.00% 102 381 0.00% 103 341 0.00% 104 385 0.00% 105 445 0.00% 106 408 0.00% 107 420 0.00% 108 456 0.00% 109 516 0.00% 110 462 0.00% 111 482 0.00% 112 519 0.00% 113 532 0.00% 114 559 0.00% 115 637 0.00% 116 617 0.00% 117 700 0.00% 118 703 0.00% 119 667 0.00% 120 742 0.00% 121 811 0.00% 122 799 0.00% 123 783 0.00% 124 895 0.00% 125 890 0.00% 126 897 0.00% 127 936 0.00% 128 918 0.00% 129 1051 0.00% 130 976 0.00% 131 1063 0.00% 132 1201 0.00% 133 1141 0.00% 134 1129 0.00% 135 1160 0.00% 136 1217 0.00% 137 1256 0.00% 138 1328 0.01% 139 1434 0.01% 140 1406 0.01% 141 1534 0.01% 142 1579 0.01% 143 1585 0.01% 144 1745 0.01% 145 1943 0.01% 146 2591 0.01% 147 5568 0.02% 148 25671 0.10% 149 401189 1.59% 150 24740051 98.07% 25228189 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=26 prefix-density=0.32 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=21.97 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=2.9 sequence=TTCTCAGCACCGAAGTCCATCTCAGACC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=15 prefix-density=0.44 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=85.51 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=14.4 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGGAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR14639595 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:25:29 Started mapping on | Feb 10 11:25:29 Finished on | Feb 10 11:35:03 Mapping speed, Million of reads per hour | 158.23 Number of input reads | 25228189 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19399248 Uniquely mapped reads % | 76.90% Average mapped length | 297.45 Number of splices: Total | 16766809 Number of splices: Annotated (sjdb) | 16400915 Number of splices: GT/AG | 16484610 Number of splices: GC/AG | 213496 Number of splices: AT/AC | 15055 Number of splices: Non-canonical | 53648 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 546547 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 68354 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.47% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5282394 5282394 5282394 N_multimapping 546547 546547 546547 N_noFeature 611930 19226631 679237 N_ambiguous 249304 1411 143256 UnstrandedReadsAssigned:18538014 PositiveStrandReadsAssigned:171206 NegativeStrandReadsAssigned:18576755 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639595 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639595-trimmed-pair1.fastq SRR14639595-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,228,189 reads, 19,366,669 reads pseudoaligned [quant] estimated average fragment length: 387.86 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR14639595.ke.tsv 34699 SRR14639595.se.tsv 87100 total ==> SRR14639595.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1631.14 3329 90.0995 Potri.005G024800.1.v4.1 1035 648.14 601 40.936 Potri.004G059700.1.v4.1 961 574.503 154 11.8339 Potri.007G009000.2.v4.1 1416 1029.14 0 0 Potri.003G141000.2.v4.1 2943 2556.14 1064.48 18.3845 Potri.016G087400.1.v4.1 270 39.4378 1036.73 1160.52 Potri.015G069301.1.v4.1 564 209.966 0 0 Potri.010G195200.1.v4.1 1773 1386.14 66 2.10202 Potri.012G127500.1.v4.1 977 590.296 1559 116.594 ==> SRR14639595.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 356 SRR14639595 completed mapping pipeline successfully