Starting /dee2/code/volunteer_pipeline.sh SRR14639596 current disk space = 3059232276480 free memory = 1186353184 SRR14639596 SRAfilesize e7c84935885adca6824b20fb4fa01a92 SRR14639596.sra SRR14639596.sra file validated SRR14639596 is paired end SRR14639596 is conventional basespace SRR14639596 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639596_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.725 32.0 32.0 32.0 32.0 32.0 2 31.575 32.0 32.0 32.0 32.0 32.0 3 35.22 37.0 32.0 37.0 32.0 37.0 4 36.0625 37.0 37.0 37.0 32.0 37.0 5 36.2575 37.0 37.0 37.0 37.0 37.0 6 39.74125 41.0 41.0 41.0 37.0 41.0 7 39.776 41.0 41.0 41.0 37.0 41.0 8 40.15775 41.0 41.0 41.0 37.0 41.0 9 40.1465 41.0 41.0 41.0 37.0 41.0 10-14 40.22965000000001 41.0 41.0 41.0 37.8 41.0 15-19 40.220549999999996 41.0 41.0 41.0 38.6 41.0 20-24 40.21425000000001 41.0 41.0 41.0 39.4 41.0 25-29 40.1742 41.0 41.0 41.0 37.8 41.0 30-34 40.0869 41.0 41.0 41.0 37.0 41.0 35-39 40.0351 41.0 41.0 41.0 37.0 41.0 40-44 39.96635 41.0 41.0 41.0 37.0 41.0 45-49 39.906949999999995 41.0 41.0 41.0 37.0 41.0 50-54 39.8408 41.0 41.0 41.0 37.0 41.0 55-59 39.7647 41.0 41.0 41.0 37.0 41.0 60-64 39.73895 41.0 41.0 41.0 37.0 41.0 65-69 39.63099999999999 41.0 41.0 41.0 37.0 41.0 70-74 39.42375 41.0 41.0 41.0 37.0 41.0 75-79 38.9507 41.0 40.2 41.0 35.0 41.0 80-84 39.46115000000001 41.0 41.0 41.0 37.0 41.0 85-89 39.37135 41.0 41.0 41.0 37.0 41.0 90-94 39.3879 41.0 41.0 41.0 37.0 41.0 95-99 39.273450000000004 41.0 41.0 41.0 37.0 41.0 100-104 39.17505 41.0 41.0 41.0 37.0 41.0 105-109 39.11065 41.0 41.0 41.0 37.0 41.0 110-114 39.1178 41.0 41.0 41.0 37.0 41.0 115-119 39.05315 41.0 41.0 41.0 36.0 41.0 120-124 38.9759 41.0 41.0 41.0 36.0 41.0 125-129 38.92935 41.0 41.0 41.0 33.0 41.0 130-134 38.6423 41.0 41.0 41.0 32.0 41.0 135-139 38.34505 41.0 39.4 41.0 32.0 41.0 140-144 38.10425 41.0 37.0 41.0 32.0 41.0 145-149 37.88365 41.0 37.0 41.0 32.0 41.0 150 37.702 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 3.0 22 3.0 23 6.0 24 3.0 25 5.0 26 5.0 27 16.0 28 11.0 29 27.0 30 26.0 31 25.0 32 42.0 33 59.0 34 73.0 35 81.0 36 118.0 37 182.0 38 260.0 39 558.0 40 2494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.21030257564391 13.703425856464117 10.102525631407852 34.98374593648413 2 17.875 11.700000000000001 40.9 29.525000000000002 3 18.3 18.4 27.825 35.475 4 22.95 24.6 25.650000000000002 26.8 5 22.650000000000002 32.85 25.05 19.45 6 18.65 33.75 26.25 21.349999999999998 7 14.7 27.35 40.725 17.224999999999998 8 14.374999999999998 23.325000000000003 37.824999999999996 24.474999999999998 9 16.400000000000002 24.775 34.949999999999996 23.875 10-14 20.015 28.52 28.865000000000002 22.6 15-19 20.02 28.16 28.01 23.810000000000002 20-24 20.22 28.599999999999998 27.250000000000004 23.93 25-29 20.165 27.834999999999997 28.105000000000004 23.895 30-34 20.025000000000002 27.925 28.405 23.645 35-39 20.015 27.975 28.32 23.69 40-44 19.835 28.244999999999997 28.110000000000003 23.810000000000002 45-49 20.47 28.425 27.41 23.695 50-54 19.67 28.044999999999998 28.22 24.065 55-59 20.465 28.349999999999998 27.405 23.78 60-64 20.044999999999998 28.265 28.08 23.61 65-69 19.955000000000002 28.499999999999996 28.01 23.535 70-74 20.724999999999998 28.17 27.36 23.745 75-79 20.44 27.96 27.6 24.0 80-84 20.305 28.325 27.51 23.86 85-89 20.27 28.349999999999998 27.310000000000002 24.07 90-94 20.455000000000002 27.68 27.845 24.02 95-99 19.82 28.07 27.67 24.44 100-104 20.73 27.74 27.500000000000004 24.03 105-109 20.557055705570555 27.787778777877786 27.747774777477748 23.907390739073907 110-114 20.580000000000002 28.34 27.295 23.785 115-119 20.560000000000002 27.88 27.54 24.02 120-124 20.655 28.1 28.125 23.119999999999997 125-129 20.45 27.474999999999998 28.54 23.535 130-134 20.595 27.49 28.025 23.89 135-139 20.695 27.27 28.37 23.665 140-144 21.080270067516878 26.9567391847962 28.542135533883474 23.420855213803453 145-149 21.315 27.49 27.55 23.645 150 21.2 27.650000000000002 27.1 24.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 1.0 16 2.0 17 1.5 18 1.0 19 1.0 20 0.5 21 3.0 22 4.5 23 4.0 24 3.0 25 4.5 26 6.0 27 6.0 28 9.5 29 18.0 30 27.5 31 32.0 32 43.0 33 50.0 34 51.5 35 69.5 36 93.0 37 112.5 38 125.0 39 143.5 40 174.5 41 211.0 42 249.0 43 252.5 44 252.5 45 254.5 46 243.0 47 226.5 48 206.5 49 205.5 50 175.5 51 126.5 52 106.5 53 102.5 54 90.5 55 62.0 56 44.0 57 36.5 58 27.0 59 23.5 60 22.5 61 19.5 62 13.5 63 10.0 64 11.5 65 9.0 66 6.0 67 6.0 68 4.0 69 2.5 70 1.0 71 1.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.16933578367025 90.625 2 4.673142557101602 8.9 3 0.13126804935678654 0.375 4 0.026253609871357313 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.0625 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.2 0.0 0.0 0.0 0.0 136-137 0.2375 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATCAG 10 0.006973645 144.0 4 GGGATCA 10 0.006973645 144.0 3 GATCAGG 10 0.006973645 144.0 5 TCACTCT 10 0.006973645 144.0 8 TTTGCTG 10 0.006973645 144.0 5 >>END_MODULE SRR14639596 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639596_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.715 32.0 32.0 32.0 32.0 32.0 2 30.90375 32.0 32.0 32.0 32.0 32.0 3 33.54625 37.0 32.0 37.0 27.0 37.0 4 34.82875 37.0 37.0 37.0 32.0 37.0 5 35.06 37.0 37.0 37.0 32.0 37.0 6 38.03425 41.0 37.0 41.0 32.0 41.0 7 37.89575 41.0 37.0 41.0 32.0 41.0 8 38.03925 41.0 37.0 41.0 32.0 41.0 9 38.17125 41.0 37.0 41.0 32.0 41.0 10-14 38.2949 41.0 41.0 41.0 32.0 41.0 15-19 38.0404 41.0 37.8 41.0 29.0 41.0 20-24 37.9014 41.0 37.8 41.0 28.0 41.0 25-29 37.49195 41.0 37.0 41.0 27.0 41.0 30-34 37.441449999999996 41.0 37.0 41.0 27.0 41.0 35-39 37.20435 41.0 37.0 41.0 27.0 41.0 40-44 37.097950000000004 41.0 37.0 41.0 27.0 41.0 45-49 36.933350000000004 41.0 37.0 41.0 27.0 41.0 50-54 36.798249999999996 41.0 37.0 41.0 26.0 41.0 55-59 36.7868 41.0 37.0 41.0 26.0 41.0 60-64 36.786950000000004 41.0 37.0 41.0 26.0 41.0 65-69 36.437200000000004 41.0 37.0 41.0 22.0 41.0 70-74 36.295 41.0 37.0 41.0 22.0 41.0 75-79 35.32505 40.2 34.0 41.0 22.0 41.0 80-84 36.51055 41.0 37.0 41.0 22.0 41.0 85-89 36.4499 41.0 37.0 41.0 22.0 41.0 90-94 36.151199999999996 41.0 37.0 41.0 22.0 41.0 95-99 36.257400000000004 41.0 37.0 41.0 22.0 41.0 100-104 35.990750000000006 41.0 35.0 41.0 20.0 41.0 105-109 35.972500000000004 41.0 36.0 41.0 22.0 41.0 110-114 35.92535 41.0 37.0 41.0 22.0 41.0 115-119 35.46015 41.0 33.0 41.0 20.0 41.0 120-124 35.65455000000001 41.0 34.0 41.0 22.0 41.0 125-129 34.954750000000004 41.0 32.0 41.0 18.0 41.0 130-134 35.101299999999995 41.0 32.0 41.0 20.0 41.0 135-139 34.563550000000006 39.4 31.0 41.0 18.0 41.0 140-144 34.3981 41.0 32.0 41.0 14.0 41.0 145-149 34.0792 39.4 31.0 41.0 12.0 41.0 150 33.9115 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 3.0 16 7.0 17 23.0 18 21.0 19 24.0 20 32.0 21 31.0 22 34.0 23 37.0 24 46.0 25 67.0 26 54.0 27 61.0 28 61.0 29 79.0 30 77.0 31 90.0 32 133.0 33 94.0 34 160.0 35 166.0 36 202.0 37 250.0 38 365.0 39 624.0 40 1256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.769423558897245 26.54135338345865 8.796992481203008 26.8922305764411 2 19.900000000000002 27.500000000000004 35.925000000000004 16.675 3 18.575 25.15 35.099999999999994 21.175 4 23.425 32.0 23.0 21.575 5 24.474999999999998 37.375 21.075 17.075000000000003 6 18.85 35.675000000000004 24.474999999999998 21.0 7 20.349999999999998 22.575 36.449999999999996 20.625 8 15.875 24.025 33.875 26.224999999999998 9 20.65 25.25 30.0 24.099999999999998 10-14 22.475 28.655 26.685 22.185 15-19 22.384999999999998 27.944999999999997 27.505000000000003 22.165000000000003 20-24 22.13 28.139999999999997 28.08 21.65 25-29 22.32 27.584999999999997 28.125 21.97 30-34 22.855 27.855 27.595 21.695 35-39 22.189999999999998 27.52 28.095 22.195 40-44 22.85 27.82 27.279999999999998 22.05 45-49 22.545 27.405 28.005000000000003 22.045 50-54 23.0 26.97 28.07 21.959999999999997 55-59 22.935 27.455000000000002 27.639999999999997 21.97 60-64 22.42 27.284999999999997 27.91 22.384999999999998 65-69 22.98 27.584999999999997 27.700000000000003 21.735 70-74 23.435 27.705000000000002 27.22 21.64 75-79 22.67 27.625 27.529999999999998 22.175 80-84 23.62 27.685 26.815 21.88 85-89 23.3 27.43 27.584999999999997 21.685 90-94 23.28 27.224999999999998 27.73 21.765 95-99 22.775000000000002 27.625 27.925 21.675 100-104 23.974999999999998 27.095000000000002 27.41 21.52 105-109 23.599999999999998 27.205000000000002 27.76 21.435000000000002 110-114 23.535 27.715 27.02 21.73 115-119 23.119999999999997 28.249999999999996 26.46 22.17 120-124 22.925 27.894999999999996 27.310000000000002 21.87 125-129 23.27 27.765 27.250000000000004 21.715 130-134 23.830000000000002 26.865 27.715 21.59 135-139 23.03 27.73 27.08 22.16 140-144 23.405 27.089999999999996 27.889999999999997 21.615000000000002 145-149 23.695 27.810000000000002 26.38 22.115000000000002 150 23.375 28.825 26.474999999999998 21.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.5 21 1.5 22 0.5 23 3.5 24 3.5 25 1.0 26 4.0 27 4.5 28 7.5 29 15.0 30 16.0 31 18.0 32 26.0 33 36.5 34 54.5 35 72.5 36 93.0 37 107.5 38 121.5 39 149.5 40 197.5 41 234.0 42 249.5 43 236.0 44 235.0 45 244.5 46 236.0 47 229.5 48 217.5 49 198.0 50 168.5 51 158.0 52 137.0 53 100.5 54 77.0 55 69.5 56 58.5 57 44.0 58 35.5 59 31.0 60 25.0 61 17.0 62 13.0 63 10.0 64 8.5 65 6.0 66 3.5 67 3.0 68 3.5 69 3.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.025 #Duplication Level Percentage of deduplicated Percentage of total 1 95.96459255402239 92.15 2 3.9312678989846397 7.55 3 0.1041395469929706 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.2 0.0 0.0 0.0 0.0 136-137 0.2375 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991482 spots for SRR14639596.sra Written 991482 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra Read 991480 spots for SRR14639596.sra Written 991480 spots for SRR14639596.sra SRR ids: ['SRR14639596.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ktmipujq SRR14639596.sra spots: 19829602 blocks: [[1, 991480], [991481, 1982960], [1982961, 2974440], [2974441, 3965920], [3965921, 4957400], [4957401, 5948880], [5948881, 6940360], [6940361, 7931840], [7931841, 8923320], [8923321, 9914800], [9914801, 10906280], [10906281, 11897760], [11897761, 12889240], [12889241, 13880720], [13880721, 14872200], [14872201, 15863680], [15863681, 16855160], [16855161, 17846640], [17846641, 18838120], [18838121, 19829602]] SRR14639596 file size 7338757 SRR14639596 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639596 SRR14639596_1.fastq SRR14639596_2.fastq Input file: SRR14639596_1.fastq Paired file: SRR14639596_2.fastq trimmed: SRR14639596-trimmed-pair1.fastq, SRR14639596-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 10:39:05 2025 >> started Mon Feb 10 10:39:27 2025 >> done (22.325s) 19829602 read pairs processed; of these: 138 ( 0.00%) short read pairs filtered out after trimming by size control 51 ( 0.00%) empty read pairs filtered out after trimming by size control 19829413 (100.00%) read pairs available; of these: 445554 ( 2.25%) trimmed read pairs available after processing 19383859 (97.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 29 0.00% 20 27 0.00% 21 20 0.00% 22 27 0.00% 23 43 0.00% 24 54 0.00% 25 36 0.00% 26 42 0.00% 27 44 0.00% 28 37 0.00% 29 42 0.00% 30 73 0.00% 31 56 0.00% 32 78 0.00% 33 79 0.00% 34 75 0.00% 35 63 0.00% 36 88 0.00% 37 70 0.00% 38 97 0.00% 39 73 0.00% 40 90 0.00% 41 88 0.00% 42 106 0.00% 43 87 0.00% 44 83 0.00% 45 90 0.00% 46 120 0.00% 47 106 0.00% 48 109 0.00% 49 105 0.00% 50 107 0.00% 51 122 0.00% 52 105 0.00% 53 131 0.00% 54 99 0.00% 55 141 0.00% 56 130 0.00% 57 137 0.00% 58 157 0.00% 59 151 0.00% 60 144 0.00% 61 152 0.00% 62 159 0.00% 63 177 0.00% 64 157 0.00% 65 163 0.00% 66 170 0.00% 67 178 0.00% 68 150 0.00% 69 194 0.00% 70 173 0.00% 71 222 0.00% 72 222 0.00% 73 218 0.00% 74 207 0.00% 75 228 0.00% 76 221 0.00% 77 221 0.00% 78 282 0.00% 79 242 0.00% 80 266 0.00% 81 283 0.00% 82 299 0.00% 83 308 0.00% 84 321 0.00% 85 325 0.00% 86 321 0.00% 87 307 0.00% 88 371 0.00% 89 359 0.00% 90 374 0.00% 91 400 0.00% 92 423 0.00% 93 449 0.00% 94 467 0.00% 95 498 0.00% 96 491 0.00% 97 542 0.00% 98 612 0.00% 99 611 0.00% 100 636 0.00% 101 650 0.00% 102 681 0.00% 103 710 0.00% 104 717 0.00% 105 785 0.00% 106 852 0.00% 107 912 0.00% 108 967 0.00% 109 946 0.00% 110 946 0.00% 111 1050 0.01% 112 1087 0.01% 113 1133 0.01% 114 1163 0.01% 115 1271 0.01% 116 1304 0.01% 117 1360 0.01% 118 1391 0.01% 119 1446 0.01% 120 1572 0.01% 121 1635 0.01% 122 1691 0.01% 123 1814 0.01% 124 1814 0.01% 125 1900 0.01% 126 2024 0.01% 127 2065 0.01% 128 2200 0.01% 129 2238 0.01% 130 2273 0.01% 131 2487 0.01% 132 2436 0.01% 133 2575 0.01% 134 2552 0.01% 135 2787 0.01% 136 2897 0.01% 137 2978 0.02% 138 3152 0.02% 139 3223 0.02% 140 3294 0.02% 141 3478 0.02% 142 3589 0.02% 143 3674 0.02% 144 3891 0.02% 145 4238 0.02% 146 4823 0.02% 147 7473 0.04% 148 23242 0.12% 149 306190 1.54% 150 19383859 97.75% 19829413 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=24 prefix-density=0.32 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=21.13 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=7.2 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=14 prefix-density=0.44 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=51.87 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=11.4 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGGAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR14639596 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 10:40:32 Started mapping on | Feb 10 10:40:32 Finished on | Feb 10 10:48:07 Mapping speed, Million of reads per hour | 156.89 Number of input reads | 19829413 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15345137 Uniquely mapped reads % | 77.39% Average mapped length | 297.33 Number of splices: Total | 13025933 Number of splices: Annotated (sjdb) | 12749065 Number of splices: GT/AG | 12809405 Number of splices: GC/AG | 162919 Number of splices: AT/AC | 11151 Number of splices: Non-canonical | 42458 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442397 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 47816 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.94% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4041879 4041879 4041879 N_multimapping 442397 442397 442397 N_noFeature 489842 15211655 546432 N_ambiguous 188910 978 111559 UnstrandedReadsAssigned:14666385 PositiveStrandReadsAssigned:132504 NegativeStrandReadsAssigned:14687146 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639596 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639596-trimmed-pair1.fastq SRR14639596-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,829,413 reads, 15,278,763 reads pseudoaligned [quant] estimated average fragment length: 366.756 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR14639596.ke.tsv 34699 SRR14639596.se.tsv 87100 total ==> SRR14639596.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1652.24 2535 87.3991 Potri.005G024800.1.v4.1 1035 669.244 639 54.3901 Potri.004G059700.1.v4.1 961 595.847 124 11.8547 Potri.007G009000.2.v4.1 1416 1050.24 0 0 Potri.003G141000.2.v4.1 2943 2577.24 881.244 19.478 Potri.016G087400.1.v4.1 270 47.977 844 1002.1 Potri.015G069301.1.v4.1 564 229.163 0 0 Potri.010G195200.1.v4.1 1773 1407.24 37 1.49774 Potri.012G127500.1.v4.1 977 611.512 1608 149.79 ==> SRR14639596.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 72 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 295 SRR14639596 completed mapping pipeline successfully