Starting /dee2/code/volunteer_pipeline.sh SRR14639597 current disk space = 3058901463040 free memory = 1451212788 SRR14639597 SRAfilesize 1617a042d9b70f97158f2722864f399a SRR14639597.sra SRR14639597.sra file validated SRR14639597 is paired end SRR14639597 is conventional basespace SRR14639597 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639597_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61625 32.0 32.0 32.0 32.0 32.0 2 31.48125 32.0 32.0 32.0 32.0 32.0 3 35.20125 37.0 32.0 37.0 32.0 37.0 4 36.12125 37.0 37.0 37.0 32.0 37.0 5 36.25625 37.0 37.0 37.0 37.0 37.0 6 39.72475 41.0 41.0 41.0 37.0 41.0 7 39.662 41.0 41.0 41.0 37.0 41.0 8 39.9185 41.0 41.0 41.0 37.0 41.0 9 40.0465 41.0 41.0 41.0 37.0 41.0 10-14 40.11495000000001 41.0 41.0 41.0 37.0 41.0 15-19 40.081500000000005 41.0 41.0 41.0 37.0 41.0 20-24 40.094049999999996 41.0 41.0 41.0 37.0 41.0 25-29 40.12965 41.0 41.0 41.0 37.0 41.0 30-34 40.0852 41.0 41.0 41.0 37.0 41.0 35-39 39.95895 41.0 41.0 41.0 37.0 41.0 40-44 39.950649999999996 41.0 41.0 41.0 37.0 41.0 45-49 39.832800000000006 41.0 41.0 41.0 37.0 41.0 50-54 39.84305 41.0 41.0 41.0 37.0 41.0 55-59 39.77225 41.0 41.0 41.0 37.0 41.0 60-64 39.701499999999996 41.0 41.0 41.0 37.0 41.0 65-69 39.5283 41.0 41.0 41.0 37.0 41.0 70-74 39.348 41.0 41.0 41.0 37.0 41.0 75-79 38.907300000000006 41.0 39.4 41.0 35.0 41.0 80-84 39.3887 41.0 41.0 41.0 37.0 41.0 85-89 39.40665 41.0 41.0 41.0 37.0 41.0 90-94 39.26225 41.0 41.0 41.0 37.0 41.0 95-99 39.15984999999999 41.0 41.0 41.0 37.0 41.0 100-104 39.10655 41.0 41.0 41.0 37.0 41.0 105-109 38.9851 41.0 41.0 41.0 36.0 41.0 110-114 38.924699999999994 41.0 41.0 41.0 33.0 41.0 115-119 38.9563 41.0 41.0 41.0 35.0 41.0 120-124 38.8452 41.0 41.0 41.0 34.0 41.0 125-129 38.87015 41.0 41.0 41.0 32.0 41.0 130-134 38.49825 41.0 41.0 41.0 32.0 41.0 135-139 38.254450000000006 41.0 38.6 41.0 32.0 41.0 140-144 38.0224 41.0 37.0 41.0 32.0 41.0 145-149 37.6906 41.0 37.0 41.0 31.0 41.0 150 37.4335 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 3.0 24 3.0 25 7.0 26 16.0 27 13.0 28 17.0 29 17.0 30 30.0 31 43.0 32 53.0 33 54.0 34 70.0 35 99.0 36 124.0 37 170.0 38 296.0 39 564.0 40 2417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.359589897474365 12.478119529882472 9.602400600150037 39.559889972493124 2 16.025 11.025 43.575 29.375 3 17.25 17.65 29.575000000000003 35.525 4 22.975 23.775 25.4 27.85 5 24.0 32.175 26.700000000000003 17.125 6 17.349999999999998 34.425 27.800000000000004 20.424999999999997 7 15.675 26.575 40.325 17.424999999999997 8 14.499999999999998 24.3 38.375 22.825 9 16.7 23.150000000000002 36.475 23.674999999999997 10-14 19.68 28.555000000000003 28.189999999999998 23.575 15-19 19.62 28.065 27.994999999999997 24.32 20-24 19.985 27.675 28.17 24.169999999999998 25-29 20.315 27.62 27.71 24.355 30-34 20.195 27.965 27.48 24.36 35-39 19.950000000000003 28.27 27.38 24.4 40-44 20.365 27.815 27.765 24.055 45-49 20.035 28.435 27.589999999999996 23.94 50-54 20.14 28.294999999999998 27.37 24.195 55-59 20.615 28.415000000000003 27.060000000000002 23.91 60-64 20.4 29.049999999999997 27.21 23.34 65-69 20.97 27.425 27.47 24.135 70-74 20.45 27.744999999999997 28.310000000000002 23.494999999999997 75-79 21.11 28.02 26.974999999999998 23.895 80-84 20.515 27.955000000000002 27.125 24.404999999999998 85-89 21.525 27.855 27.11 23.51 90-94 21.04 28.244999999999997 27.37 23.345 95-99 21.27 27.375 27.544999999999998 23.810000000000002 100-104 20.865000000000002 28.055000000000003 27.13 23.95 105-109 20.55911182236447 27.615523104620927 27.465493098619724 24.359871974394878 110-114 20.54 27.250000000000004 27.87 24.34 115-119 20.825 27.46 27.544999999999998 24.169999999999998 120-124 20.605 27.944999999999997 27.13 24.32 125-129 21.23 26.83 27.810000000000002 24.13 130-134 21.21 26.955000000000002 27.51 24.325 135-139 21.08 27.255000000000003 27.52 24.145 140-144 20.482168759065672 27.38458460461161 27.719701895663484 24.413544740659233 145-149 21.495 27.42 27.485 23.599999999999998 150 21.15 26.950000000000003 28.075 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.5 21 1.5 22 1.5 23 1.0 24 1.5 25 2.5 26 5.0 27 7.0 28 9.5 29 14.0 30 24.5 31 30.5 32 34.5 33 44.0 34 51.0 35 63.5 36 96.0 37 110.0 38 131.5 39 163.0 40 185.0 41 212.5 42 228.0 43 247.0 44 253.0 45 248.0 46 252.5 47 225.0 48 192.0 49 186.5 50 154.5 51 128.0 52 115.5 53 106.5 54 95.5 55 70.5 56 57.0 57 51.0 58 44.0 59 34.0 60 27.0 61 21.0 62 12.0 63 11.5 64 10.5 65 7.0 66 7.5 67 7.0 68 5.0 69 2.5 70 0.5 71 0.0 72 1.5 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.034999999999999996 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.21556256572029 90.55 2 4.468980021030494 8.5 3 0.26288117770767616 0.75 4 0.052576235541535225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.0625 0.0 0.0 0.0 0.0 128-129 0.075 0.0 0.0 0.0 0.0 130-131 0.075 0.0 0.0 0.0 0.0 132-133 0.075 0.0 0.0 0.0 0.0 134-135 0.15 0.0 0.0 0.0 0.0 136-137 0.2 0.0 0.0 0.0 0.0 138 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639597 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639597_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.67125 32.0 32.0 32.0 32.0 32.0 2 30.64625 32.0 32.0 32.0 32.0 32.0 3 33.57875 37.0 32.0 37.0 27.0 37.0 4 34.62875 37.0 37.0 37.0 32.0 37.0 5 34.86 37.0 37.0 37.0 32.0 37.0 6 37.93175 41.0 37.0 41.0 32.0 41.0 7 37.85325 41.0 37.0 41.0 32.0 41.0 8 37.9105 41.0 37.0 41.0 27.0 41.0 9 38.0105 41.0 37.0 41.0 27.0 41.0 10-14 38.21855 41.0 40.2 41.0 32.0 41.0 15-19 38.017149999999994 41.0 37.8 41.0 28.0 41.0 20-24 37.81675 41.0 37.0 41.0 28.0 41.0 25-29 37.3599 41.0 37.0 41.0 26.0 41.0 30-34 37.36365 41.0 37.0 41.0 27.0 41.0 35-39 37.13155 41.0 37.0 41.0 27.0 41.0 40-44 36.9777 41.0 37.0 41.0 27.0 41.0 45-49 36.92305 41.0 37.0 41.0 27.0 41.0 50-54 36.75045 41.0 37.0 41.0 25.0 41.0 55-59 36.741049999999994 41.0 37.0 41.0 24.0 41.0 60-64 36.71755 41.0 37.0 41.0 25.0 41.0 65-69 36.39275 41.0 37.0 41.0 22.0 41.0 70-74 36.122699999999995 41.0 37.0 41.0 22.0 41.0 75-79 35.199 40.2 34.0 41.0 22.0 41.0 80-84 36.38445 41.0 37.0 41.0 22.0 41.0 85-89 36.3999 41.0 37.0 41.0 22.0 41.0 90-94 36.097300000000004 41.0 37.0 41.0 22.0 41.0 95-99 36.19005 41.0 37.0 41.0 22.0 41.0 100-104 35.89104999999999 41.0 36.0 41.0 20.0 41.0 105-109 35.79765 41.0 34.0 41.0 22.0 41.0 110-114 35.866949999999996 41.0 35.0 41.0 22.0 41.0 115-119 35.419200000000004 41.0 33.0 41.0 20.0 41.0 120-124 35.5189 41.0 32.0 41.0 22.0 41.0 125-129 34.9864 41.0 32.0 41.0 18.0 41.0 130-134 34.93535 41.0 32.0 41.0 18.0 41.0 135-139 34.60105 40.2 31.0 41.0 16.0 41.0 140-144 34.15845 39.4 32.0 41.0 12.0 41.0 145-149 34.043150000000004 40.2 31.0 41.0 12.0 41.0 150 33.6325 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 4.0 16 8.0 17 17.0 18 29.0 19 20.0 20 36.0 21 44.0 22 45.0 23 48.0 24 49.0 25 45.0 26 58.0 27 58.0 28 72.0 29 70.0 30 94.0 31 84.0 32 113.0 33 116.0 34 132.0 35 175.0 36 186.0 37 252.0 38 348.0 39 563.0 40 1331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.714285714285715 26.49122807017544 8.471177944862156 29.32330827067669 2 18.85 25.474999999999998 38.574999999999996 17.1 3 17.625 25.55 35.075 21.75 4 22.650000000000002 31.6 23.175 22.575 5 23.0 37.925 21.85 17.224999999999998 6 18.7 36.95 23.724999999999998 20.625 7 20.1 22.35 37.7 19.85 8 17.4 23.3 31.324999999999996 27.975 9 19.55 23.925 30.375000000000004 26.150000000000002 10-14 22.345000000000002 28.065 26.51 23.080000000000002 15-19 22.145 27.91 27.955000000000002 21.990000000000002 20-24 22.830000000000002 27.58 27.11 22.48 25-29 22.5 27.325 27.750000000000004 22.425 30-34 22.68 27.685 27.18 22.455 35-39 22.134999999999998 27.694999999999997 27.22 22.95 40-44 22.625 27.935 27.115000000000002 22.325 45-49 22.775000000000002 28.065 26.640000000000004 22.52 50-54 22.24 27.250000000000004 27.785 22.725 55-59 22.535 27.700000000000003 27.295 22.470000000000002 60-64 22.965 27.67 27.255000000000003 22.11 65-69 23.26 27.99 26.875 21.875 70-74 22.595000000000002 28.645 26.424999999999997 22.335 75-79 23.21 28.025 26.950000000000003 21.815 80-84 23.575 27.400000000000002 26.979999999999997 22.045 85-89 24.104999999999997 28.04 26.515 21.34 90-94 22.88 27.834999999999997 26.965 22.32 95-99 23.22 27.465 26.900000000000002 22.415 100-104 23.905 26.985 27.325 21.785 105-109 23.285 27.3 27.47 21.945 110-114 23.165 27.860000000000003 27.065 21.91 115-119 23.52617630881544 27.236361818090906 26.756337816890845 22.481124056202813 120-124 23.035 27.52 26.97 22.475 125-129 22.755 27.634999999999998 26.83 22.78 130-134 24.195 27.634999999999998 26.435 21.735 135-139 23.28 27.05 26.619999999999997 23.05 140-144 23.65 27.27 27.015 22.065 145-149 23.595 27.21 26.97 22.225 150 23.05 28.050000000000004 27.075 21.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 1.5 24 3.5 25 6.0 26 6.5 27 7.0 28 9.5 29 12.0 30 16.5 31 22.5 32 34.5 33 35.0 34 36.5 35 59.5 36 76.5 37 97.0 38 121.0 39 145.5 40 189.5 41 222.0 42 231.0 43 238.5 44 230.0 45 231.0 46 256.0 47 251.0 48 219.0 49 198.0 50 168.5 51 145.0 52 136.5 53 105.0 54 78.5 55 74.5 56 65.5 57 56.5 58 46.5 59 34.0 60 25.0 61 21.5 62 21.0 63 12.5 64 10.0 65 10.5 66 6.5 67 4.5 68 4.0 69 3.0 70 1.0 71 0.0 72 1.0 73 1.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 95.87575045679979 91.825 2 3.8893239363090575 7.449999999999999 3 0.18271991647089533 0.525 4 0.05220569042025581 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.15 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.175 0.0 0.0 0.0 0.0 134-135 0.25 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTGC 10 0.006973645 144.0 8 TCTTGCA 10 0.006973645 144.0 9 AAGCCAA 10 0.006973645 144.0 5 >>END_MODULE Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra Read 1270078 spots for SRR14639597.sra Written 1270078 spots for SRR14639597.sra Read 1270072 spots for SRR14639597.sra Written 1270072 spots for SRR14639597.sra SRR ids: ['SRR14639597.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ui9yz8g SRR14639597.sra spots: 25401446 blocks: [[1, 1270072], [1270073, 2540144], [2540145, 3810216], [3810217, 5080288], [5080289, 6350360], [6350361, 7620432], [7620433, 8890504], [8890505, 10160576], [10160577, 11430648], [11430649, 12700720], [12700721, 13970792], [13970793, 15240864], [15240865, 16510936], [16510937, 17781008], [17781009, 19051080], [19051081, 20321152], [20321153, 21591224], [21591225, 22861296], [22861297, 24131368], [24131369, 25401446]] SRR14639597 file size 9403900 SRR14639597 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639597 SRR14639597_1.fastq SRR14639597_2.fastq Input file: SRR14639597_1.fastq Paired file: SRR14639597_2.fastq trimmed: SRR14639597-trimmed-pair1.fastq, SRR14639597-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:26:19 2025 >> started Mon Feb 10 11:26:49 2025 >> done (30.367s) 25401446 read pairs processed; of these: 144 ( 0.00%) short read pairs filtered out after trimming by size control 79 ( 0.00%) empty read pairs filtered out after trimming by size control 25401223 (100.00%) read pairs available; of these: 592666 ( 2.33%) trimmed read pairs available after processing 24808557 (97.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 25 0.00% 20 28 0.00% 21 39 0.00% 22 45 0.00% 23 43 0.00% 24 44 0.00% 25 39 0.00% 26 38 0.00% 27 63 0.00% 28 73 0.00% 29 59 0.00% 30 80 0.00% 31 66 0.00% 32 79 0.00% 33 89 0.00% 34 71 0.00% 35 98 0.00% 36 83 0.00% 37 121 0.00% 38 118 0.00% 39 102 0.00% 40 91 0.00% 41 113 0.00% 42 96 0.00% 43 114 0.00% 44 110 0.00% 45 132 0.00% 46 118 0.00% 47 115 0.00% 48 120 0.00% 49 143 0.00% 50 135 0.00% 51 132 0.00% 52 112 0.00% 53 138 0.00% 54 137 0.00% 55 144 0.00% 56 146 0.00% 57 155 0.00% 58 153 0.00% 59 142 0.00% 60 134 0.00% 61 176 0.00% 62 186 0.00% 63 178 0.00% 64 161 0.00% 65 197 0.00% 66 197 0.00% 67 213 0.00% 68 223 0.00% 69 230 0.00% 70 210 0.00% 71 206 0.00% 72 236 0.00% 73 239 0.00% 74 202 0.00% 75 255 0.00% 76 259 0.00% 77 263 0.00% 78 306 0.00% 79 305 0.00% 80 285 0.00% 81 306 0.00% 82 319 0.00% 83 321 0.00% 84 374 0.00% 85 372 0.00% 86 381 0.00% 87 389 0.00% 88 386 0.00% 89 413 0.00% 90 449 0.00% 91 433 0.00% 92 428 0.00% 93 473 0.00% 94 486 0.00% 95 508 0.00% 96 511 0.00% 97 599 0.00% 98 559 0.00% 99 674 0.00% 100 688 0.00% 101 639 0.00% 102 696 0.00% 103 775 0.00% 104 749 0.00% 105 847 0.00% 106 901 0.00% 107 932 0.00% 108 930 0.00% 109 972 0.00% 110 976 0.00% 111 1031 0.00% 112 1153 0.00% 113 1191 0.00% 114 1203 0.00% 115 1304 0.01% 116 1452 0.01% 117 1433 0.01% 118 1621 0.01% 119 1605 0.01% 120 1679 0.01% 121 1705 0.01% 122 1851 0.01% 123 1892 0.01% 124 2043 0.01% 125 2138 0.01% 126 2254 0.01% 127 2362 0.01% 128 2449 0.01% 129 2578 0.01% 130 2687 0.01% 131 2838 0.01% 132 2744 0.01% 133 3036 0.01% 134 2920 0.01% 135 3334 0.01% 136 3383 0.01% 137 3449 0.01% 138 3626 0.01% 139 3784 0.01% 140 3884 0.02% 141 4197 0.02% 142 4405 0.02% 143 4562 0.02% 144 4765 0.02% 145 5055 0.02% 146 6111 0.02% 147 9684 0.04% 148 32259 0.13% 149 426878 1.68% 150 24808557 97.67% 25401223 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=14 prefix-density=0.26 prefix-fanout=3.1 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=19.19 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=6.5 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=13 prefix-density=0.37 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=59.42 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=12.2 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGGAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR14639597 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:28:00 Started mapping on | Feb 10 11:28:00 Finished on | Feb 10 11:39:48 Mapping speed, Million of reads per hour | 129.16 Number of input reads | 25401223 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18577393 Uniquely mapped reads % | 73.14% Average mapped length | 297.25 Number of splices: Total | 15906213 Number of splices: Annotated (sjdb) | 15556722 Number of splices: GT/AG | 15638621 Number of splices: GC/AG | 201582 Number of splices: AT/AC | 14225 Number of splices: Non-canonical | 51785 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 550039 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 56244 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 24.28% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6273791 6273791 6273791 N_multimapping 550039 550039 550039 N_noFeature 628192 18421097 691538 N_ambiguous 236487 1265 142957 UnstrandedReadsAssigned:17712714 PositiveStrandReadsAssigned:155031 NegativeStrandReadsAssigned:17742898 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639597 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639597-trimmed-pair1.fastq SRR14639597-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,401,223 reads, 18,574,322 reads pseudoaligned [quant] estimated average fragment length: 369.887 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR14639597.ke.tsv 34699 SRR14639597.se.tsv 87100 total ==> SRR14639597.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1649.11 3387 97.2708 Potri.005G024800.1.v4.1 1035 666.113 596 42.3756 Potri.004G059700.1.v4.1 961 592.634 123 9.82961 Potri.007G009000.2.v4.1 1416 1047.11 0 0 Potri.003G141000.2.v4.1 2943 2574.11 937.21 17.2436 Potri.016G087400.1.v4.1 270 47.1022 1067 1072.85 Potri.015G069301.1.v4.1 564 227.006 0 0 Potri.010G195200.1.v4.1 1773 1404.11 77 2.59721 Potri.012G127500.1.v4.1 977 608.437 2081 161.985 ==> SRR14639597.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 115 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 272 SRR14639597 completed mapping pipeline successfully