Starting /dee2/code/volunteer_pipeline.sh SRR14639598 current disk space = 3058881265664 free memory = 1456248856 SRR14639598 SRAfilesize 476a963071fd9db8629eff966eff1156 SRR14639598.sra SRR14639598.sra file validated SRR14639598 is paired end SRR14639598 is conventional basespace SRR14639598 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639598_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6475 32.0 32.0 32.0 32.0 32.0 2 31.50875 32.0 32.0 32.0 32.0 32.0 3 35.11625 37.0 32.0 37.0 32.0 37.0 4 36.18125 37.0 37.0 37.0 37.0 37.0 5 36.20375 37.0 37.0 37.0 37.0 37.0 6 39.70525 41.0 41.0 41.0 37.0 41.0 7 39.7645 41.0 41.0 41.0 37.0 41.0 8 39.932 41.0 41.0 41.0 37.0 41.0 9 40.11775 41.0 41.0 41.0 37.0 41.0 10-14 40.084500000000006 41.0 41.0 41.0 37.0 41.0 15-19 40.07395 41.0 41.0 41.0 37.0 41.0 20-24 40.16305 41.0 41.0 41.0 37.0 41.0 25-29 40.138099999999994 41.0 41.0 41.0 37.8 41.0 30-34 40.132799999999996 41.0 41.0 41.0 37.0 41.0 35-39 40.01604999999999 41.0 41.0 41.0 37.0 41.0 40-44 39.9796 41.0 41.0 41.0 37.0 41.0 45-49 39.9767 41.0 41.0 41.0 37.0 41.0 50-54 39.9292 41.0 41.0 41.0 37.0 41.0 55-59 39.84805 41.0 41.0 41.0 37.0 41.0 60-64 39.74975 41.0 41.0 41.0 37.0 41.0 65-69 39.6646 41.0 41.0 41.0 37.0 41.0 70-74 39.472249999999995 41.0 41.0 41.0 37.0 41.0 75-79 39.0101 41.0 40.2 41.0 36.0 41.0 80-84 39.5767 41.0 41.0 41.0 37.0 41.0 85-89 39.4953 41.0 41.0 41.0 37.0 41.0 90-94 39.43145 41.0 41.0 41.0 37.0 41.0 95-99 39.32795 41.0 41.0 41.0 37.0 41.0 100-104 39.1874 41.0 41.0 41.0 37.0 41.0 105-109 39.213649999999994 41.0 41.0 41.0 37.0 41.0 110-114 39.15069999999999 41.0 41.0 41.0 37.0 41.0 115-119 39.12645 41.0 41.0 41.0 36.0 41.0 120-124 39.0584 41.0 41.0 41.0 36.0 41.0 125-129 39.057 41.0 41.0 41.0 36.0 41.0 130-134 38.86255 41.0 41.0 41.0 33.0 41.0 135-139 38.484449999999995 41.0 41.0 41.0 32.0 41.0 140-144 38.298700000000004 41.0 37.8 41.0 32.0 41.0 145-149 38.01805 41.0 37.0 41.0 32.0 41.0 150 37.865 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 3.0 25 1.0 26 4.0 27 12.0 28 13.0 29 30.0 30 25.0 31 32.0 32 40.0 33 73.0 34 81.0 35 78.0 36 122.0 37 177.0 38 245.0 39 511.0 40 2548.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.075 13.425 11.225 39.275 2 14.7 13.05 43.425000000000004 28.825 3 16.275000000000002 18.475 30.9 34.35 4 21.15 26.224999999999998 24.725 27.900000000000002 5 21.425 35.575 25.924999999999997 17.075000000000003 6 17.75 32.5 29.099999999999998 20.65 7 15.925 26.275 39.65 18.15 8 14.025000000000002 24.224999999999998 38.550000000000004 23.200000000000003 9 16.325 24.9 36.275 22.5 10-14 19.335 29.044999999999998 28.02 23.599999999999998 15-19 19.925 27.755000000000003 28.110000000000003 24.21 20-24 19.259999999999998 28.84 28.435 23.465 25-29 19.75 28.645 28.294999999999998 23.31 30-34 19.485 29.054999999999996 27.515 23.945 35-39 19.535 28.23 28.345 23.89 40-44 19.665 28.549999999999997 27.865000000000002 23.919999999999998 45-49 20.16 28.62 27.61 23.61 50-54 19.965 28.67 27.51 23.855 55-59 19.994999999999997 29.145 27.685 23.175 60-64 19.855 28.435 28.21 23.5 65-69 20.11 28.235 27.92 23.735 70-74 20.705000000000002 27.925 27.450000000000003 23.919999999999998 75-79 20.035 28.18 28.43 23.355 80-84 19.945 27.544999999999998 28.51 24.0 85-89 20.575 28.499999999999996 27.694999999999997 23.23 90-94 20.369999999999997 28.025 27.625 23.98 95-99 20.185 28.035 27.860000000000003 23.919999999999998 100-104 19.785 28.425 28.165000000000003 23.625 105-109 20.036001800090006 27.85639281964098 27.861393069653484 24.24621231061553 110-114 20.18 28.255000000000003 27.905 23.66 115-119 20.635 27.595 28.165000000000003 23.605 120-124 20.200000000000003 28.050000000000004 27.950000000000003 23.799999999999997 125-129 20.255000000000003 27.37 28.585 23.79 130-134 20.54 28.299999999999997 27.445000000000004 23.715 135-139 20.485 27.839999999999996 27.755000000000003 23.919999999999998 140-144 20.141007050352517 27.13135656782839 28.641432071603578 24.08620431021551 145-149 20.315 27.845 28.384999999999998 23.455000000000002 150 20.65 26.724999999999998 27.975 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.5 22 2.5 23 6.0 24 8.0 25 5.0 26 4.5 27 8.5 28 14.5 29 15.5 30 18.0 31 29.0 32 39.0 33 44.5 34 60.5 35 80.0 36 90.0 37 106.0 38 136.0 39 164.5 40 202.5 41 241.5 42 253.0 43 259.0 44 263.0 45 260.5 46 261.5 47 248.5 48 218.0 49 189.5 50 161.0 51 128.5 52 102.5 53 85.5 54 67.5 55 51.5 56 37.0 57 24.0 58 20.0 59 21.0 60 17.5 61 10.5 62 7.0 63 6.5 64 4.0 65 4.0 66 5.0 67 5.5 68 4.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.67949725058916 91.35 2 3.927729772191673 7.5 3 0.3665881120712228 1.05 4 0.02618486514794449 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.15 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.15 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.175 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.21250000000000002 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639598 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639598_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.785 32.0 32.0 32.0 32.0 32.0 2 30.91375 32.0 32.0 32.0 32.0 32.0 3 33.91 37.0 32.0 37.0 32.0 37.0 4 34.94 37.0 37.0 37.0 32.0 37.0 5 35.13125 37.0 37.0 37.0 32.0 37.0 6 38.28425 41.0 37.0 41.0 32.0 41.0 7 38.20025 41.0 41.0 41.0 32.0 41.0 8 38.20025 41.0 41.0 41.0 32.0 41.0 9 38.2995 41.0 41.0 41.0 32.0 41.0 10-14 38.53835 41.0 41.0 41.0 32.0 41.0 15-19 38.19835 41.0 40.2 41.0 31.0 41.0 20-24 38.11125 41.0 40.2 41.0 31.0 41.0 25-29 37.695350000000005 41.0 37.8 41.0 27.0 41.0 30-34 37.62875 41.0 37.0 41.0 27.0 41.0 35-39 37.56529999999999 41.0 37.0 41.0 27.0 41.0 40-44 37.372550000000004 41.0 37.0 41.0 27.0 41.0 45-49 37.2524 41.0 37.0 41.0 27.0 41.0 50-54 37.1392 41.0 37.0 41.0 27.0 41.0 55-59 37.0665 41.0 37.0 41.0 27.0 41.0 60-64 36.96085000000001 41.0 37.0 41.0 26.0 41.0 65-69 36.7383 41.0 37.0 41.0 26.0 41.0 70-74 36.49235 41.0 37.0 41.0 22.0 41.0 75-79 35.67864999999999 40.2 35.0 41.0 23.0 41.0 80-84 36.7435 41.0 37.0 41.0 22.0 41.0 85-89 36.765750000000004 41.0 37.0 41.0 22.0 41.0 90-94 36.36845 41.0 37.0 41.0 22.0 41.0 95-99 36.55155 41.0 37.0 41.0 22.0 41.0 100-104 36.1673 41.0 37.0 41.0 22.0 41.0 105-109 36.193799999999996 41.0 37.0 41.0 22.0 41.0 110-114 36.1905 41.0 37.0 41.0 22.0 41.0 115-119 35.82755 41.0 35.0 41.0 20.0 41.0 120-124 35.86665 41.0 36.0 41.0 22.0 41.0 125-129 35.3036 41.0 34.0 41.0 18.0 41.0 130-134 35.44035 41.0 33.0 41.0 22.0 41.0 135-139 34.928700000000006 41.0 32.0 41.0 18.0 41.0 140-144 34.648900000000005 41.0 32.0 41.0 18.0 41.0 145-149 34.51350000000001 40.2 32.0 41.0 12.0 41.0 150 34.09875 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 5.0 16 6.0 17 14.0 18 29.0 19 24.0 20 26.0 21 29.0 22 28.0 23 33.0 24 41.0 25 40.0 26 60.0 27 53.0 28 80.0 29 78.0 30 78.0 31 85.0 32 125.0 33 118.0 34 115.0 35 145.0 36 188.0 37 247.0 38 344.0 39 590.0 40 1416.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.90147906743545 27.325144146402607 9.551265981448985 26.222110804712962 2 18.675 26.85 38.625 15.85 3 16.85 26.400000000000002 36.325 20.424999999999997 4 22.900000000000002 33.050000000000004 24.05 20.0 5 21.525 39.574999999999996 23.0 15.9 6 18.45 36.475 25.575 19.5 7 19.325 24.099999999999998 36.55 20.025000000000002 8 16.825000000000003 23.799999999999997 33.575 25.8 9 18.975 25.124999999999996 31.0 24.9 10-14 22.35 27.605 27.894999999999996 22.15 15-19 22.1 28.035 28.125 21.740000000000002 20-24 21.955 27.474999999999998 28.87 21.7 25-29 21.91 27.935 27.975 22.18 30-34 22.2 27.900000000000002 28.13 21.77 35-39 21.845 28.075 28.335 21.745 40-44 21.985 27.83 27.894999999999996 22.29 45-49 21.945 27.810000000000002 28.48 21.765 50-54 22.205 28.475 27.73 21.59 55-59 22.48 28.405 27.87 21.245 60-64 22.805 27.450000000000003 28.494999999999997 21.25 65-69 22.61 27.785 27.794999999999998 21.81 70-74 22.275 28.08 27.765 21.88 75-79 23.02 28.42 27.465 21.095 80-84 23.06 27.975 27.36 21.605 85-89 22.835 27.565 28.155 21.445 90-94 23.02 28.03 27.875 21.075 95-99 22.495 27.985 28.605000000000004 20.915 100-104 23.03 28.29 27.189999999999998 21.490000000000002 105-109 23.93 27.235 27.54 21.295 110-114 23.445 27.46 28.134999999999998 20.96 115-119 23.474999999999998 27.875 27.389999999999997 21.26 120-124 23.23 27.765 28.04 20.965 125-129 22.93 27.41 27.925 21.735 130-134 22.515 28.060000000000002 28.12 21.305 135-139 22.585 28.015 27.900000000000002 21.5 140-144 23.32 27.744999999999997 27.73 21.205 145-149 23.405 27.625 27.435 21.535 150 22.05 27.800000000000004 29.075 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 1.5 14 1.0 15 0.0 16 0.0 17 0.0 18 0.5 19 4.0 20 5.5 21 4.5 22 4.5 23 3.5 24 6.0 25 7.0 26 4.5 27 5.0 28 7.5 29 12.5 30 20.5 31 28.0 32 37.5 33 42.5 34 54.5 35 79.5 36 97.0 37 125.5 38 148.5 39 157.5 40 192.5 41 212.5 42 236.5 43 270.5 44 276.5 45 282.0 46 253.0 47 228.5 48 200.5 49 165.5 50 154.0 51 138.5 52 119.0 53 84.5 54 63.0 55 55.0 56 44.5 57 35.5 58 27.0 59 21.5 60 18.5 61 13.0 62 12.0 63 9.0 64 5.0 65 6.0 66 3.5 67 2.0 68 2.0 69 1.5 70 1.5 71 0.5 72 0.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.275 #Duplication Level Percentage of deduplicated Percentage of total 1 96.41651519085951 92.825 2 3.323811996883926 6.4 3 0.23370553103090105 0.675 4 0.025967281225655673 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.16249999999999998 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.225 0.0 0.0 0.0 0.0 132-133 0.25 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 0.3125 0.0 0.0 0.0 0.0 138 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCCG 10 0.006973645 144.0 5 >>END_MODULE Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra Read 1181613 spots for SRR14639598.sra Written 1181613 spots for SRR14639598.sra Read 1181598 spots for SRR14639598.sra Written 1181598 spots for SRR14639598.sra SRR ids: ['SRR14639598.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m_3pcx25 SRR14639598.sra spots: 23631975 blocks: [[1, 1181598], [1181599, 2363196], [2363197, 3544794], [3544795, 4726392], [4726393, 5907990], [5907991, 7089588], [7089589, 8271186], [8271187, 9452784], [9452785, 10634382], [10634383, 11815980], [11815981, 12997578], [12997579, 14179176], [14179177, 15360774], [15360775, 16542372], [16542373, 17723970], [17723971, 18905568], [18905569, 20087166], [20087167, 21268764], [21268765, 22450362], [22450363, 23631975]] SRR14639598 file size 8748101 SRR14639598 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639598 SRR14639598_1.fastq SRR14639598_2.fastq Input file: SRR14639598_1.fastq Paired file: SRR14639598_2.fastq trimmed: SRR14639598-trimmed-pair1.fastq, SRR14639598-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:26:48 2025 >> started Mon Feb 10 11:27:27 2025 >> done (38.301s) 23631975 read pairs processed; of these: 122 ( 0.00%) short read pairs filtered out after trimming by size control 70 ( 0.00%) empty read pairs filtered out after trimming by size control 23631783 (100.00%) read pairs available; of these: 529509 ( 2.24%) trimmed read pairs available after processing 23102274 (97.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 16 0.00% 20 31 0.00% 21 39 0.00% 22 30 0.00% 23 40 0.00% 24 46 0.00% 25 53 0.00% 26 49 0.00% 27 65 0.00% 28 48 0.00% 29 38 0.00% 30 50 0.00% 31 54 0.00% 32 48 0.00% 33 52 0.00% 34 71 0.00% 35 66 0.00% 36 81 0.00% 37 76 0.00% 38 104 0.00% 39 78 0.00% 40 97 0.00% 41 74 0.00% 42 91 0.00% 43 113 0.00% 44 89 0.00% 45 97 0.00% 46 117 0.00% 47 121 0.00% 48 126 0.00% 49 120 0.00% 50 110 0.00% 51 117 0.00% 52 126 0.00% 53 123 0.00% 54 127 0.00% 55 149 0.00% 56 150 0.00% 57 142 0.00% 58 157 0.00% 59 169 0.00% 60 151 0.00% 61 178 0.00% 62 191 0.00% 63 173 0.00% 64 160 0.00% 65 200 0.00% 66 201 0.00% 67 215 0.00% 68 197 0.00% 69 192 0.00% 70 232 0.00% 71 251 0.00% 72 242 0.00% 73 268 0.00% 74 259 0.00% 75 269 0.00% 76 285 0.00% 77 301 0.00% 78 311 0.00% 79 339 0.00% 80 345 0.00% 81 370 0.00% 82 350 0.00% 83 379 0.00% 84 456 0.00% 85 438 0.00% 86 482 0.00% 87 474 0.00% 88 525 0.00% 89 502 0.00% 90 564 0.00% 91 563 0.00% 92 640 0.00% 93 674 0.00% 94 678 0.00% 95 766 0.00% 96 767 0.00% 97 747 0.00% 98 794 0.00% 99 877 0.00% 100 897 0.00% 101 928 0.00% 102 1004 0.00% 103 1070 0.00% 104 1125 0.00% 105 1190 0.01% 106 1259 0.01% 107 1324 0.01% 108 1302 0.01% 109 1363 0.01% 110 1470 0.01% 111 1542 0.01% 112 1668 0.01% 113 1705 0.01% 114 1897 0.01% 115 1913 0.01% 116 2035 0.01% 117 2088 0.01% 118 2276 0.01% 119 2303 0.01% 120 2385 0.01% 121 2498 0.01% 122 2684 0.01% 123 2753 0.01% 124 2862 0.01% 125 2994 0.01% 126 3277 0.01% 127 3275 0.01% 128 3435 0.01% 129 3628 0.02% 130 3796 0.02% 131 3934 0.02% 132 3916 0.02% 133 4079 0.02% 134 4140 0.02% 135 4540 0.02% 136 4580 0.02% 137 4762 0.02% 138 4915 0.02% 139 5138 0.02% 140 5213 0.02% 141 5575 0.02% 142 5812 0.02% 143 5931 0.03% 144 6109 0.03% 145 6505 0.03% 146 7220 0.03% 147 9778 0.04% 148 26031 0.11% 149 327805 1.39% 150 23102274 97.76% 23631783 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=16 prefix-density=0.33 prefix-fanout=2.9 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=70.58 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=18.6 sequence=TTTTCTTTCTCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.31 fanout-score-rank=15 prefix-density=0.49 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=145.06 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=22.7 sequence=TTCAAGAAAATGG SRR14639598 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:28:17 Started mapping on | Feb 10 11:28:18 Finished on | Feb 10 11:34:17 Mapping speed, Million of reads per hour | 236.98 Number of input reads | 23631783 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20128307 Uniquely mapped reads % | 85.17% Average mapped length | 297.22 Number of splices: Total | 17323388 Number of splices: Annotated (sjdb) | 16953461 Number of splices: GT/AG | 17035736 Number of splices: GC/AG | 215671 Number of splices: AT/AC | 15837 Number of splices: Non-canonical | 56144 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 590732 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 59237 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.93% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2912744 2912744 2912744 N_multimapping 590732 590732 590732 N_noFeature 664430 19962824 732477 N_ambiguous 247748 1221 149756 UnstrandedReadsAssigned:19216129 PositiveStrandReadsAssigned:164262 NegativeStrandReadsAssigned:19246074 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639598 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639598-trimmed-pair1.fastq SRR14639598-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,631,783 reads, 19,729,151 reads pseudoaligned [quant] estimated average fragment length: 361.959 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR14639598.ke.tsv 34699 SRR14639598.se.tsv 87100 total ==> SRR14639598.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1657.04 3795 103.202 Potri.005G024800.1.v4.1 1035 674.041 443 29.6159 Potri.004G059700.1.v4.1 961 600.594 160 12.0046 Potri.007G009000.2.v4.1 1416 1055.04 0 0 Potri.003G141000.2.v4.1 2943 2582.04 1021.42 17.8258 Potri.016G087400.1.v4.1 270 50.4174 1130 1009.96 Potri.015G069301.1.v4.1 564 232.878 0 0 Potri.010G195200.1.v4.1 1773 1412.04 29 0.925462 Potri.012G127500.1.v4.1 977 616.35 1665 121.729 ==> SRR14639598.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 473 SRR14639598 completed mapping pipeline successfully