Starting /dee2/code/volunteer_pipeline.sh SRR14639599 current disk space = 3058830934016 free memory = 1281812100 SRR14639599 SRAfilesize 0b1a5222f49eec0040bf10a2cad3eb44 SRR14639599.sra SRR14639599.sra file validated SRR14639599 is paired end SRR14639599 is conventional basespace SRR14639599 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639599_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6975 32.0 32.0 32.0 32.0 32.0 2 31.55625 32.0 32.0 32.0 32.0 32.0 3 35.14125 37.0 32.0 37.0 32.0 37.0 4 36.15875 37.0 37.0 37.0 32.0 37.0 5 36.29375 37.0 37.0 37.0 37.0 37.0 6 39.7335 41.0 41.0 41.0 37.0 41.0 7 39.883 41.0 41.0 41.0 37.0 41.0 8 40.18325 41.0 41.0 41.0 37.0 41.0 9 40.063 41.0 41.0 41.0 37.0 41.0 10-14 40.236000000000004 41.0 41.0 41.0 39.4 41.0 15-19 40.17235 41.0 41.0 41.0 37.0 41.0 20-24 40.17715 41.0 41.0 41.0 37.0 41.0 25-29 40.13775 41.0 41.0 41.0 37.0 41.0 30-34 40.1195 41.0 41.0 41.0 37.0 41.0 35-39 40.075250000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.96435 41.0 41.0 41.0 37.0 41.0 45-49 39.923649999999995 41.0 41.0 41.0 37.0 41.0 50-54 39.88705 41.0 41.0 41.0 37.0 41.0 55-59 39.85965 41.0 41.0 41.0 37.0 41.0 60-64 39.75915 41.0 41.0 41.0 37.0 41.0 65-69 39.60745000000001 41.0 41.0 41.0 37.0 41.0 70-74 39.479949999999995 41.0 41.0 41.0 37.0 41.0 75-79 39.025850000000005 41.0 40.2 41.0 35.0 41.0 80-84 39.504599999999996 41.0 41.0 41.0 37.0 41.0 85-89 39.4477 41.0 41.0 41.0 37.0 41.0 90-94 39.378049999999995 41.0 41.0 41.0 37.0 41.0 95-99 39.285849999999996 41.0 41.0 41.0 37.0 41.0 100-104 39.25645 41.0 41.0 41.0 37.0 41.0 105-109 39.092699999999994 41.0 41.0 41.0 37.0 41.0 110-114 39.084700000000005 41.0 41.0 41.0 37.0 41.0 115-119 39.118500000000004 41.0 41.0 41.0 37.0 41.0 120-124 38.9671 41.0 41.0 41.0 37.0 41.0 125-129 38.99175 41.0 41.0 41.0 36.0 41.0 130-134 38.73795 41.0 41.0 41.0 32.0 41.0 135-139 38.427949999999996 41.0 41.0 41.0 32.0 41.0 140-144 38.2147 41.0 37.8 41.0 32.0 41.0 145-149 37.97235 41.0 37.0 41.0 32.0 41.0 150 37.763 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 4.0 23 1.0 24 7.0 25 8.0 26 7.0 27 14.0 28 13.0 29 23.0 30 26.0 31 40.0 32 40.0 33 56.0 34 77.0 35 96.0 36 104.0 37 175.0 38 239.0 39 520.0 40 2549.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.975 13.750000000000002 10.825 38.45 2 16.225 12.15 43.05 28.575 3 17.175 18.325 29.625 34.875 4 22.25 24.725 24.85 28.175 5 22.1 34.1 25.8 18.0 6 17.9 32.35 28.675 21.075 7 15.4 26.950000000000003 40.25 17.4 8 13.850000000000001 22.925 38.5 24.725 9 15.7 25.25 36.0 23.05 10-14 19.02 29.86 27.79 23.330000000000002 15-19 20.01 28.505000000000003 27.639999999999997 23.845 20-24 19.45 28.294999999999998 28.595 23.66 25-29 19.11 28.955 27.85 24.085 30-34 19.564999999999998 28.025 27.915 24.495 35-39 19.595000000000002 29.054999999999996 27.525 23.825 40-44 20.5 29.07 27.07 23.36 45-49 19.93 28.02 27.91 24.14 50-54 19.97 28.62 27.67 23.74 55-59 19.55 28.125 28.065 24.26 60-64 19.99 28.249999999999996 27.900000000000002 23.86 65-69 19.48 28.144999999999996 28.01 24.365000000000002 70-74 20.355 28.199999999999996 28.060000000000002 23.385 75-79 19.705000000000002 28.375 27.685 24.235 80-84 19.935 27.950000000000003 28.16 23.955000000000002 85-89 19.905 28.575 27.33 24.19 90-94 20.064999999999998 28.405 27.71 23.82 95-99 20.11 28.294999999999998 27.779999999999998 23.815 100-104 19.555 28.165000000000003 28.15 24.13 105-109 19.91099554977749 27.901395069753487 27.886394319715986 24.301215060753037 110-114 19.950000000000003 27.839999999999996 28.165000000000003 24.044999999999998 115-119 20.925 27.55 27.965 23.56 120-124 19.88 27.950000000000003 27.915 24.255 125-129 20.07 27.405 28.299999999999997 24.224999999999998 130-134 21.01 28.000000000000004 27.279999999999998 23.71 135-139 20.990000000000002 28.144999999999996 27.534999999999997 23.330000000000002 140-144 20.35203520352035 27.652765276527653 28.677867786778677 23.317331733173315 145-149 20.919999999999998 28.315 27.395000000000003 23.369999999999997 150 20.674999999999997 28.599999999999998 26.5 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 2.5 23 3.5 24 7.0 25 7.0 26 8.5 27 10.5 28 12.0 29 19.0 30 22.5 31 24.5 32 38.5 33 52.5 34 58.5 35 77.0 36 94.5 37 110.5 38 142.0 39 180.0 40 195.0 41 208.0 42 220.5 43 249.5 44 279.5 45 269.5 46 253.0 47 226.0 48 197.5 49 181.0 50 157.5 51 135.5 52 115.5 53 83.5 54 67.5 55 64.0 56 54.5 57 40.5 58 27.5 59 18.0 60 14.5 61 14.0 62 9.5 63 6.5 64 7.0 65 8.0 66 6.5 67 3.5 68 2.5 69 2.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.91570073761855 90.075 2 4.82086406743941 9.15 3 0.23709167544783985 0.675 4 0.026343519494204423 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.225 0.0 0.0 0.0 0.0 128-129 0.2875 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.3875 0.0 0.0 0.0 0.0 134-135 0.42500000000000004 0.0 0.0 0.0 0.0 136-137 0.45 0.0 0.0 0.0 0.0 138 0.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639599 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639599_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83125 32.0 32.0 32.0 32.0 32.0 2 30.85625 32.0 32.0 32.0 32.0 32.0 3 33.91125 37.0 32.0 37.0 32.0 37.0 4 34.7775 37.0 37.0 37.0 32.0 37.0 5 35.04125 37.0 37.0 37.0 32.0 37.0 6 38.26425 41.0 37.0 41.0 32.0 41.0 7 38.23225 41.0 41.0 41.0 32.0 41.0 8 38.1785 41.0 41.0 41.0 32.0 41.0 9 38.45175 41.0 41.0 41.0 32.0 41.0 10-14 38.50019999999999 41.0 41.0 41.0 32.0 41.0 15-19 38.277049999999996 41.0 41.0 41.0 32.0 41.0 20-24 38.12165 41.0 39.4 41.0 31.0 41.0 25-29 37.7965 41.0 37.8 41.0 29.0 41.0 30-34 37.710249999999995 41.0 37.0 41.0 27.0 41.0 35-39 37.5547 41.0 37.0 41.0 27.0 41.0 40-44 37.3662 41.0 37.0 41.0 27.0 41.0 45-49 37.2076 41.0 37.0 41.0 27.0 41.0 50-54 37.14825 41.0 37.0 41.0 27.0 41.0 55-59 37.040150000000004 41.0 37.0 41.0 27.0 41.0 60-64 37.007799999999996 41.0 37.0 41.0 27.0 41.0 65-69 36.76225 41.0 37.0 41.0 24.0 41.0 70-74 36.5212 41.0 37.0 41.0 22.0 41.0 75-79 35.8286 40.2 35.0 41.0 22.0 41.0 80-84 36.814350000000005 41.0 37.0 41.0 24.0 41.0 85-89 36.8326 41.0 37.0 41.0 22.0 41.0 90-94 36.44045 41.0 37.0 41.0 22.0 41.0 95-99 36.4978 41.0 37.0 41.0 22.0 41.0 100-104 36.21065 41.0 37.0 41.0 22.0 41.0 105-109 36.22165 41.0 37.0 41.0 22.0 41.0 110-114 36.27245 41.0 37.0 41.0 22.0 41.0 115-119 35.99835 41.0 36.0 41.0 20.0 41.0 120-124 36.08475 41.0 37.0 41.0 22.0 41.0 125-129 35.576 41.0 34.0 41.0 18.0 41.0 130-134 35.4499 41.0 34.0 41.0 22.0 41.0 135-139 35.04690000000001 41.0 32.0 41.0 18.0 41.0 140-144 34.7332 41.0 32.0 41.0 16.0 41.0 145-149 34.623599999999996 40.2 32.0 41.0 12.0 41.0 150 34.14575 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 12.0 17 8.0 18 25.0 19 25.0 20 23.0 21 36.0 22 38.0 23 35.0 24 47.0 25 51.0 26 44.0 27 61.0 28 61.0 29 79.0 30 85.0 31 80.0 32 92.0 33 116.0 34 121.0 35 152.0 36 188.0 37 250.0 38 350.0 39 533.0 40 1486.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.406218655967905 26.980942828485453 10.356068204613841 27.256770310932797 2 19.375 26.1 38.475 16.05 3 16.8 25.35 36.1 21.75 4 22.725 32.525 24.125 20.625 5 22.8 38.550000000000004 21.85 16.8 6 18.75 38.675 23.849999999999998 18.725 7 19.375 23.9 36.425000000000004 20.3 8 16.425 23.875 33.225 26.474999999999998 9 21.275 24.05 31.75 22.925 10-14 22.275 28.765 27.015 21.945 15-19 21.575 27.425 28.884999999999998 22.115000000000002 20-24 22.085 27.860000000000003 28.249999999999996 21.805 25-29 22.03 28.050000000000004 28.225 21.695 30-34 21.834999999999997 29.145 27.665 21.355 35-39 22.305 27.98 28.42 21.295 40-44 22.259999999999998 27.815 28.294999999999998 21.63 45-49 22.205 27.045 29.244999999999997 21.505 50-54 22.475 28.17 28.435 20.919999999999998 55-59 22.825 27.525 28.194999999999997 21.455 60-64 22.545 28.084999999999997 27.794999999999998 21.575 65-69 22.795 28.03 27.605 21.57 70-74 22.64 27.955000000000002 28.050000000000004 21.355 75-79 23.01 27.779999999999998 27.73 21.48 80-84 22.915 27.765 27.944999999999997 21.375 85-89 22.86 27.52 28.355000000000004 21.265 90-94 22.45 27.705000000000002 27.689999999999998 22.155 95-99 22.935 28.470000000000002 27.355 21.240000000000002 100-104 23.330000000000002 27.725 27.24 21.705 105-109 23.28 27.68 27.91 21.13 110-114 23.565 27.944999999999997 27.560000000000002 20.93 115-119 23.355 28.025 27.525 21.095 120-124 23.895 28.244999999999997 26.889999999999997 20.97 125-129 23.085 28.115000000000002 27.405 21.395 130-134 23.45 28.335 27.279999999999998 20.935000000000002 135-139 23.1 27.97 27.36 21.57 140-144 23.255 27.544999999999998 27.37 21.83 145-149 23.22 27.794999999999998 27.96 21.025 150 23.05 26.825 28.7 21.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 2.5 24 4.5 25 4.5 26 8.5 27 13.0 28 15.0 29 16.0 30 16.5 31 32.0 32 42.0 33 47.5 34 58.5 35 72.5 36 86.5 37 111.5 38 146.0 39 174.5 40 218.0 41 246.5 42 238.5 43 242.5 44 264.5 45 268.0 46 253.0 47 227.5 48 199.0 49 172.5 50 149.5 51 121.0 52 107.0 53 90.5 54 65.5 55 57.5 56 51.0 57 42.0 58 29.5 59 24.5 60 21.0 61 13.5 62 8.5 63 6.0 64 6.0 65 5.0 66 3.0 67 2.5 68 1.5 69 1.5 70 1.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.06463382851186 92.15 2 3.6486838676048996 7.000000000000001 3 0.26062027625749284 0.75 4 0.026062027625749284 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.0875 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.175 0.0 0.0 0.0 0.0 128-129 0.23750000000000002 0.0 0.0 0.0 0.0 130-131 0.30000000000000004 0.0 0.0 0.0 0.0 132-133 0.3375 0.0 0.0 0.0 0.0 134-135 0.38749999999999996 0.0 0.0 0.0 0.0 136-137 0.425 0.0 0.0 0.0 0.0 138 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGGA 10 0.006973645 144.0 7 AAAAAAA 95 5.470836E-4 12.126316 45-49 >>END_MODULE Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186789 spots for SRR14639599.sra Written 1186789 spots for SRR14639599.sra Read 1186798 spots for SRR14639599.sra Written 1186798 spots for SRR14639599.sra SRR ids: ['SRR14639599.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c7hu2edw SRR14639599.sra spots: 23735789 blocks: [[1, 1186789], [1186790, 2373578], [2373579, 3560367], [3560368, 4747156], [4747157, 5933945], [5933946, 7120734], [7120735, 8307523], [8307524, 9494312], [9494313, 10681101], [10681102, 11867890], [11867891, 13054679], [13054680, 14241468], [14241469, 15428257], [15428258, 16615046], [16615047, 17801835], [17801836, 18988624], [18988625, 20175413], [20175414, 21362202], [21362203, 22548991], [22548992, 23735789]] SRR14639599 file size 8786542 SRR14639599 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639599 SRR14639599_1.fastq SRR14639599_2.fastq Input file: SRR14639599_1.fastq Paired file: SRR14639599_2.fastq trimmed: SRR14639599-trimmed-pair1.fastq, SRR14639599-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:21:08 2025 >> started Mon Feb 10 11:21:37 2025 >> done (28.831s) 23735789 read pairs processed; of these: 122 ( 0.00%) short read pairs filtered out after trimming by size control 50 ( 0.00%) empty read pairs filtered out after trimming by size control 23735617 (100.00%) read pairs available; of these: 547667 ( 2.31%) trimmed read pairs available after processing 23187950 (97.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 26 0.00% 20 27 0.00% 21 24 0.00% 22 40 0.00% 23 50 0.00% 24 42 0.00% 25 37 0.00% 26 42 0.00% 27 60 0.00% 28 44 0.00% 29 61 0.00% 30 64 0.00% 31 52 0.00% 32 73 0.00% 33 66 0.00% 34 79 0.00% 35 77 0.00% 36 83 0.00% 37 68 0.00% 38 100 0.00% 39 86 0.00% 40 86 0.00% 41 83 0.00% 42 101 0.00% 43 109 0.00% 44 103 0.00% 45 93 0.00% 46 117 0.00% 47 122 0.00% 48 91 0.00% 49 139 0.00% 50 119 0.00% 51 129 0.00% 52 132 0.00% 53 139 0.00% 54 149 0.00% 55 170 0.00% 56 185 0.00% 57 191 0.00% 58 157 0.00% 59 181 0.00% 60 207 0.00% 61 211 0.00% 62 268 0.00% 63 222 0.00% 64 230 0.00% 65 241 0.00% 66 233 0.00% 67 252 0.00% 68 289 0.00% 69 312 0.00% 70 316 0.00% 71 330 0.00% 72 328 0.00% 73 363 0.00% 74 380 0.00% 75 369 0.00% 76 409 0.00% 77 421 0.00% 78 439 0.00% 79 468 0.00% 80 453 0.00% 81 511 0.00% 82 592 0.00% 83 559 0.00% 84 634 0.00% 85 625 0.00% 86 638 0.00% 87 674 0.00% 88 685 0.00% 89 706 0.00% 90 789 0.00% 91 769 0.00% 92 875 0.00% 93 905 0.00% 94 918 0.00% 95 977 0.00% 96 1004 0.00% 97 1049 0.00% 98 1017 0.00% 99 1186 0.00% 100 1181 0.00% 101 1202 0.01% 102 1295 0.01% 103 1370 0.01% 104 1424 0.01% 105 1480 0.01% 106 1644 0.01% 107 1656 0.01% 108 1761 0.01% 109 1796 0.01% 110 1824 0.01% 111 1853 0.01% 112 1972 0.01% 113 2171 0.01% 114 2194 0.01% 115 2380 0.01% 116 2466 0.01% 117 2519 0.01% 118 2723 0.01% 119 2765 0.01% 120 2901 0.01% 121 3007 0.01% 122 2993 0.01% 123 3259 0.01% 124 3266 0.01% 125 3238 0.01% 126 3614 0.02% 127 3749 0.02% 128 3861 0.02% 129 4062 0.02% 130 4157 0.02% 131 4195 0.02% 132 4365 0.02% 133 4498 0.02% 134 4664 0.02% 135 4734 0.02% 136 5068 0.02% 137 5035 0.02% 138 5279 0.02% 139 5346 0.02% 140 5760 0.02% 141 5812 0.02% 142 6152 0.03% 143 6245 0.03% 144 6488 0.03% 145 6640 0.03% 146 7136 0.03% 147 9709 0.04% 148 25003 0.11% 149 324079 1.37% 150 23187950 97.69% 23735617 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=29 prefix-density=0.35 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=58.15 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=16.5 sequence=TTTTCTTTCTCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=17 prefix-density=0.50 prefix-fanout=3.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=100.23 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=20.1 sequence=TCTCTCTCTCTA SRR14639599 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:22:31 Started mapping on | Feb 10 11:22:32 Finished on | Feb 10 11:29:13 Mapping speed, Million of reads per hour | 213.09 Number of input reads | 23735617 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19951588 Uniquely mapped reads % | 84.06% Average mapped length | 297.15 Number of splices: Total | 16601367 Number of splices: Annotated (sjdb) | 16246304 Number of splices: GT/AG | 16324812 Number of splices: GC/AG | 206083 Number of splices: AT/AC | 14920 Number of splices: Non-canonical | 55552 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 586671 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 28280 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.24% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3197358 3197358 3197358 N_multimapping 586671 586671 586671 N_noFeature 659394 19774268 736135 N_ambiguous 249086 1280 147873 UnstrandedReadsAssigned:19043108 PositiveStrandReadsAssigned:176040 NegativeStrandReadsAssigned:19067580 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639599 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639599-trimmed-pair1.fastq SRR14639599-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,735,617 reads, 19,476,353 reads pseudoaligned [quant] estimated average fragment length: 369.589 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52401 SRR14639599.ke.tsv 34699 SRR14639599.se.tsv 87100 total ==> SRR14639599.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1649.41 3997 109.7 Potri.005G024800.1.v4.1 1035 666.411 679 46.1243 Potri.004G059700.1.v4.1 961 592.863 121 9.23917 Potri.007G009000.2.v4.1 1416 1047.41 0 0 Potri.003G141000.2.v4.1 2943 2574.41 1064.25 18.7141 Potri.016G087400.1.v4.1 270 51.4377 1062 934.641 Potri.015G069301.1.v4.1 564 226.263 0 0 Potri.010G195200.1.v4.1 1773 1404.41 52 1.67614 Potri.012G127500.1.v4.1 977 608.594 1256 93.4253 ==> SRR14639599.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 487 SRR14639599 completed mapping pipeline successfully