Starting /dee2/code/volunteer_pipeline.sh SRR14639600 current disk space = 3059110146048 free memory = 1516903100 SRR14639600 SRAfilesize 08c6c989859bc87b262a66fed1bf11a9 SRR14639600.sra SRR14639600.sra file validated SRR14639600 is paired end SRR14639600 is conventional basespace SRR14639600 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639600_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.73125 32.0 32.0 32.0 32.0 32.0 2 31.56625 32.0 32.0 32.0 32.0 32.0 3 35.22 37.0 32.0 37.0 32.0 37.0 4 36.1825 37.0 37.0 37.0 32.0 37.0 5 36.31625 37.0 37.0 37.0 37.0 37.0 6 39.7795 41.0 41.0 41.0 37.0 41.0 7 39.74225 41.0 41.0 41.0 37.0 41.0 8 40.12625 41.0 41.0 41.0 37.0 41.0 9 40.15425 41.0 41.0 41.0 37.0 41.0 10-14 40.18195 41.0 41.0 41.0 37.0 41.0 15-19 40.169500000000006 41.0 41.0 41.0 37.0 41.0 20-24 40.22 41.0 41.0 41.0 37.8 41.0 25-29 40.150999999999996 41.0 41.0 41.0 38.6 41.0 30-34 40.15495 41.0 41.0 41.0 39.4 41.0 35-39 40.072449999999996 41.0 41.0 41.0 37.0 41.0 40-44 40.01025 41.0 41.0 41.0 37.0 41.0 45-49 39.99995 41.0 41.0 41.0 37.0 41.0 50-54 39.9069 41.0 41.0 41.0 37.0 41.0 55-59 39.8347 41.0 41.0 41.0 37.0 41.0 60-64 39.7938 41.0 41.0 41.0 37.0 41.0 65-69 39.68005 41.0 41.0 41.0 37.0 41.0 70-74 39.591249999999995 41.0 41.0 41.0 37.0 41.0 75-79 39.11515 41.0 40.2 41.0 36.0 41.0 80-84 39.58265 41.0 41.0 41.0 37.0 41.0 85-89 39.520300000000006 41.0 41.0 41.0 37.0 41.0 90-94 39.4015 41.0 41.0 41.0 37.0 41.0 95-99 39.334999999999994 41.0 41.0 41.0 37.0 41.0 100-104 39.267199999999995 41.0 41.0 41.0 37.0 41.0 105-109 39.258 41.0 41.0 41.0 37.0 41.0 110-114 39.24300000000001 41.0 41.0 41.0 37.0 41.0 115-119 39.201649999999994 41.0 41.0 41.0 37.0 41.0 120-124 39.060649999999995 41.0 41.0 41.0 37.0 41.0 125-129 39.15635 41.0 41.0 41.0 37.0 41.0 130-134 38.844100000000005 41.0 41.0 41.0 32.0 41.0 135-139 38.6031 41.0 41.0 41.0 32.0 41.0 140-144 38.425850000000004 41.0 39.4 41.0 32.0 41.0 145-149 38.14855 41.0 37.0 41.0 32.0 41.0 150 38.008 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 5.0 25 1.0 26 5.0 27 10.0 28 20.0 29 23.0 30 19.0 31 37.0 32 50.0 33 46.0 34 65.0 35 76.0 36 118.0 37 166.0 38 259.0 39 562.0 40 2533.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.5 12.675 13.125 38.7 2 14.799999999999999 11.799999999999999 42.15 31.25 3 15.9 19.15 29.549999999999997 35.4 4 22.875 25.374999999999996 24.425 27.325 5 22.400000000000002 33.300000000000004 24.7 19.6 6 16.2 32.675 29.275000000000002 21.85 7 14.85 27.025 40.1 18.025 8 13.950000000000001 23.875 37.724999999999994 24.45 9 15.15 25.25 35.15 24.45 10-14 19.615 28.615000000000002 28.060000000000002 23.71 15-19 19.625 28.565 27.91 23.9 20-24 19.48 27.705000000000002 28.775000000000002 24.04 25-29 19.314999999999998 28.854999999999997 28.1 23.73 30-34 19.535 28.050000000000004 27.955000000000002 24.46 35-39 19.29 28.355000000000004 28.395 23.96 40-44 19.79 27.74 28.205000000000002 24.265 45-49 20.064999999999998 28.375 27.205000000000002 24.355 50-54 19.91 28.865000000000002 27.275 23.95 55-59 19.439999999999998 28.610000000000003 27.505000000000003 24.445 60-64 19.96 28.294999999999998 27.284999999999997 24.46 65-69 19.49 27.42 28.34 24.75 70-74 19.689999999999998 27.855 28.32 24.135 75-79 20.169999999999998 28.610000000000003 27.37 23.849999999999998 80-84 20.19 28.025 27.644999999999996 24.14 85-89 20.405 27.915 27.74 23.94 90-94 20.325 28.395 27.134999999999998 24.145 95-99 19.96 28.03 27.955000000000002 24.055 100-104 20.544999999999998 28.175 27.55 23.73 105-109 20.119023804760953 27.81056211242248 27.89057811562313 24.179835967193437 110-114 20.27 27.825 27.744999999999997 24.16 115-119 20.18 28.03 27.860000000000003 23.93 120-124 19.96 27.529999999999998 27.97 24.54 125-129 20.79 27.38 27.884999999999998 23.945 130-134 20.625 27.705000000000002 27.750000000000004 23.919999999999998 135-139 20.849999999999998 27.855 27.605 23.69 140-144 20.8723053068574 27.784724653628768 27.3445705997099 23.99839943980393 145-149 20.595 27.96 27.98 23.465 150 20.474999999999998 28.575 27.85 23.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.5 23 4.5 24 4.5 25 2.5 26 4.0 27 7.5 28 11.0 29 14.5 30 22.0 31 29.5 32 37.5 33 45.5 34 53.0 35 68.0 36 92.0 37 103.5 38 126.0 39 157.5 40 188.5 41 227.0 42 256.0 43 249.0 44 267.0 45 277.5 46 254.0 47 238.5 48 210.0 49 209.5 50 175.5 51 135.5 52 121.0 53 96.0 54 66.5 55 50.0 56 40.0 57 29.0 58 24.5 59 20.0 60 17.5 61 13.0 62 11.0 63 8.5 64 5.0 65 3.5 66 4.0 67 4.5 68 3.0 69 1.0 70 1.5 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.034999999999999996 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.025 #Duplication Level Percentage of deduplicated Percentage of total 1 95.96459255402239 92.15 2 3.9312678989846397 7.55 3 0.1041395469929706 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0125 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.025 0.025 0.0 0.0 0.0 88-89 0.025 0.025 0.0 0.0 0.0 90-91 0.025 0.025 0.0 0.0 0.0 92-93 0.025 0.025 0.0 0.0 0.0 94-95 0.025 0.025 0.0 0.0 0.0 96-97 0.025 0.025 0.0 0.0 0.0 98-99 0.025 0.025 0.0 0.0 0.0 100-101 0.025 0.025 0.0 0.0 0.0 102-103 0.025 0.025 0.0 0.0 0.0 104-105 0.025 0.025 0.0 0.0 0.0 106-107 0.05 0.025 0.0 0.0 0.0 108-109 0.05 0.025 0.0 0.0 0.0 110-111 0.0625 0.025 0.0 0.0 0.0 112-113 0.0875 0.025 0.0 0.0 0.0 114-115 0.1125 0.025 0.0 0.0 0.0 116-117 0.15 0.025 0.0 0.0 0.0 118-119 0.15 0.025 0.0 0.0 0.0 120-121 0.1875 0.025 0.0 0.0 0.0 122-123 0.225 0.025 0.0 0.0 0.0 124-125 0.225 0.025 0.0 0.0 0.0 126-127 0.225 0.025 0.0 0.0 0.0 128-129 0.225 0.025 0.0 0.0 0.0 130-131 0.225 0.025 0.0 0.0 0.0 132-133 0.2375 0.025 0.0 0.0 0.0 134-135 0.2875 0.025 0.0 0.0 0.0 136-137 0.3 0.025 0.0 0.0 0.0 138 0.3 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGGACA 10 0.006973645 144.0 2 AAAAAAA 30 0.0015031899 23.999998 20-24 >>END_MODULE SRR14639600 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639600_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8375 32.0 32.0 32.0 32.0 32.0 2 30.8675 32.0 32.0 32.0 32.0 32.0 3 33.9525 37.0 32.0 37.0 32.0 37.0 4 34.99125 37.0 37.0 37.0 32.0 37.0 5 35.2875 37.0 37.0 37.0 32.0 37.0 6 38.33725 41.0 37.0 41.0 32.0 41.0 7 38.25575 41.0 41.0 41.0 32.0 41.0 8 38.25525 41.0 41.0 41.0 32.0 41.0 9 38.35 41.0 41.0 41.0 32.0 41.0 10-14 38.5436 41.0 41.0 41.0 32.0 41.0 15-19 38.21635 41.0 39.4 41.0 30.0 41.0 20-24 38.12105 41.0 40.2 41.0 31.0 41.0 25-29 37.7769 41.0 37.0 41.0 28.0 41.0 30-34 37.8274 41.0 37.0 41.0 27.0 41.0 35-39 37.690149999999996 41.0 37.0 41.0 27.0 41.0 40-44 37.5341 41.0 37.0 41.0 27.0 41.0 45-49 37.42255000000001 41.0 37.0 41.0 27.0 41.0 50-54 37.20385 41.0 37.0 41.0 27.0 41.0 55-59 37.264050000000005 41.0 37.0 41.0 27.0 41.0 60-64 37.136 41.0 37.0 41.0 27.0 41.0 65-69 36.884949999999996 41.0 37.0 41.0 26.0 41.0 70-74 36.71925 41.0 37.0 41.0 24.0 41.0 75-79 35.87305 40.2 35.0 41.0 22.0 41.0 80-84 36.839150000000004 41.0 37.0 41.0 23.0 41.0 85-89 36.8664 41.0 37.0 41.0 22.0 41.0 90-94 36.53915 41.0 37.0 41.0 22.0 41.0 95-99 36.65375 41.0 37.0 41.0 22.0 41.0 100-104 36.44625 41.0 37.0 41.0 22.0 41.0 105-109 36.3126 41.0 37.0 41.0 22.0 41.0 110-114 36.20675 41.0 37.0 41.0 22.0 41.0 115-119 35.933350000000004 41.0 36.0 41.0 20.0 41.0 120-124 36.00175 41.0 37.0 41.0 22.0 41.0 125-129 35.4089 41.0 34.0 41.0 20.0 41.0 130-134 35.5347 41.0 35.0 41.0 22.0 41.0 135-139 35.141949999999994 41.0 33.0 41.0 18.0 41.0 140-144 34.74055 41.0 32.0 41.0 14.0 41.0 145-149 34.57620000000001 40.2 32.0 41.0 12.0 41.0 150 34.014 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 8.0 17 10.0 18 21.0 19 34.0 20 27.0 21 35.0 22 29.0 23 34.0 24 48.0 25 36.0 26 43.0 27 54.0 28 60.0 29 84.0 30 85.0 31 91.0 32 101.0 33 105.0 34 120.0 35 168.0 36 171.0 37 234.0 38 343.0 39 599.0 40 1458.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.948859363248935 26.92404111306092 9.52619704186513 27.600902481825017 2 19.950000000000003 27.1 36.95 16.0 3 17.575 26.55 34.300000000000004 21.575 4 21.975 31.474999999999998 24.925 21.625 5 23.549999999999997 37.55 22.425 16.475 6 16.7 37.75 26.424999999999997 19.125 7 19.075 23.0 36.475 21.45 8 16.55 24.474999999999998 33.575 25.4 9 20.7 23.825 31.674999999999997 23.799999999999997 10-14 21.815 27.715 27.66 22.81 15-19 22.11 27.705000000000002 27.860000000000003 22.325 20-24 22.175 28.395 27.700000000000003 21.73 25-29 22.29 28.07 27.445000000000004 22.195 30-34 21.634999999999998 28.08 27.83 22.455 35-39 22.009999999999998 27.875 27.91 22.205 40-44 22.67 27.555000000000003 27.66 22.115000000000002 45-49 22.37 28.005000000000003 28.095 21.529999999999998 50-54 22.105 27.54 28.455000000000002 21.9 55-59 22.55 27.584999999999997 27.97 21.895 60-64 22.275 27.875 28.055000000000003 21.795 65-69 22.785 27.450000000000003 27.935 21.83 70-74 22.97 28.105000000000004 27.279999999999998 21.645 75-79 22.825 28.065 27.37 21.740000000000002 80-84 23.135 27.24 27.79 21.834999999999997 85-89 23.76 28.185 27.21 20.845 90-94 23.195 27.67 27.1 22.035 95-99 23.080000000000002 27.500000000000004 28.044999999999998 21.375 100-104 22.965 27.065 28.494999999999997 21.475 105-109 23.43 27.015 28.28 21.275 110-114 23.45 27.24 27.615000000000002 21.695 115-119 23.419999999999998 27.91 27.29 21.38 120-124 23.48 27.265 27.36 21.895 125-129 22.855 27.63 27.46 22.055 130-134 23.405 27.665 27.51 21.42 135-139 23.494999999999997 27.215 27.025 22.264999999999997 140-144 23.41 28.125 27.084999999999997 21.38 145-149 23.49 28.09 26.655 21.765 150 22.575 28.275 28.375 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.5 23 3.0 24 4.0 25 5.0 26 5.0 27 6.5 28 9.0 29 13.0 30 17.5 31 19.0 32 29.0 33 41.0 34 49.0 35 67.0 36 86.0 37 103.0 38 139.0 39 166.5 40 192.0 41 232.0 42 247.5 43 245.0 44 256.5 45 271.5 46 270.0 47 245.0 48 207.0 49 190.5 50 175.5 51 143.5 52 111.0 53 84.5 54 73.0 55 55.5 56 43.5 57 39.0 58 28.0 59 25.5 60 22.5 61 18.0 62 12.5 63 9.5 64 9.0 65 5.0 66 4.0 67 5.0 68 3.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.625 #Duplication Level Percentage of deduplicated Percentage of total 1 96.63648124191462 93.375 2 3.2341526520051747 6.25 3 0.129366106080207 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.0875 0.0 0.0 0.0 0.0 112-113 0.1125 0.0 0.0 0.0 0.0 114-115 0.1375 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.21250000000000002 0.0 0.0 0.0 0.0 122-123 0.225 0.0 0.0 0.0 0.0 124-125 0.225 0.0 0.0 0.0 0.0 126-127 0.225 0.0 0.0 0.0 0.0 128-129 0.225 0.0 0.0 0.0 0.0 130-131 0.225 0.0 0.0 0.0 0.0 132-133 0.225 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATAGT 10 0.006973645 144.0 4 CACTGGA 10 0.006973645 144.0 4 AATAGTG 10 0.006973645 144.0 5 TCACTGG 10 0.006973645 144.0 3 >>END_MODULE Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177438 spots for SRR14639600.sra Written 1177438 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra Read 1177421 spots for SRR14639600.sra Written 1177421 spots for SRR14639600.sra SRR ids: ['SRR14639600.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1da6per_ SRR14639600.sra spots: 23548437 blocks: [[1, 1177421], [1177422, 2354842], [2354843, 3532263], [3532264, 4709684], [4709685, 5887105], [5887106, 7064526], [7064527, 8241947], [8241948, 9419368], [9419369, 10596789], [10596790, 11774210], [11774211, 12951631], [12951632, 14129052], [14129053, 15306473], [15306474, 16483894], [16483895, 17661315], [17661316, 18838736], [18838737, 20016157], [20016158, 21193578], [21193579, 22370999], [22371000, 23548437]] SRR14639600 file size 8717195 SRR14639600 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639600 SRR14639600_1.fastq SRR14639600_2.fastq Input file: SRR14639600_1.fastq Paired file: SRR14639600_2.fastq trimmed: SRR14639600-trimmed-pair1.fastq, SRR14639600-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:34:52 2025 >> started Mon Feb 10 11:35:31 2025 >> done (39.250s) 23548437 read pairs processed; of these: 150 ( 0.00%) short read pairs filtered out after trimming by size control 50 ( 0.00%) empty read pairs filtered out after trimming by size control 23548237 (100.00%) read pairs available; of these: 549069 ( 2.33%) trimmed read pairs available after processing 22999168 (97.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 26 0.00% 20 32 0.00% 21 36 0.00% 22 43 0.00% 23 41 0.00% 24 43 0.00% 25 55 0.00% 26 45 0.00% 27 52 0.00% 28 64 0.00% 29 76 0.00% 30 79 0.00% 31 57 0.00% 32 57 0.00% 33 100 0.00% 34 87 0.00% 35 114 0.00% 36 82 0.00% 37 94 0.00% 38 125 0.00% 39 95 0.00% 40 124 0.00% 41 95 0.00% 42 122 0.00% 43 107 0.00% 44 134 0.00% 45 95 0.00% 46 143 0.00% 47 109 0.00% 48 129 0.00% 49 139 0.00% 50 157 0.00% 51 152 0.00% 52 147 0.00% 53 140 0.00% 54 151 0.00% 55 204 0.00% 56 147 0.00% 57 169 0.00% 58 177 0.00% 59 156 0.00% 60 199 0.00% 61 220 0.00% 62 191 0.00% 63 232 0.00% 64 205 0.00% 65 236 0.00% 66 216 0.00% 67 281 0.00% 68 223 0.00% 69 262 0.00% 70 253 0.00% 71 287 0.00% 72 317 0.00% 73 317 0.00% 74 352 0.00% 75 349 0.00% 76 352 0.00% 77 340 0.00% 78 404 0.00% 79 392 0.00% 80 391 0.00% 81 475 0.00% 82 511 0.00% 83 443 0.00% 84 545 0.00% 85 523 0.00% 86 535 0.00% 87 559 0.00% 88 605 0.00% 89 614 0.00% 90 640 0.00% 91 696 0.00% 92 750 0.00% 93 782 0.00% 94 846 0.00% 95 827 0.00% 96 892 0.00% 97 847 0.00% 98 1013 0.00% 99 1015 0.00% 100 1081 0.00% 101 1041 0.00% 102 1176 0.00% 103 1236 0.01% 104 1259 0.01% 105 1480 0.01% 106 1474 0.01% 107 1456 0.01% 108 1533 0.01% 109 1618 0.01% 110 1577 0.01% 111 1751 0.01% 112 1835 0.01% 113 1810 0.01% 114 2018 0.01% 115 2143 0.01% 116 2264 0.01% 117 2308 0.01% 118 2453 0.01% 119 2435 0.01% 120 2534 0.01% 121 2601 0.01% 122 2807 0.01% 123 3068 0.01% 124 3120 0.01% 125 3337 0.01% 126 3512 0.01% 127 3505 0.01% 128 3664 0.02% 129 3842 0.02% 130 4015 0.02% 131 4241 0.02% 132 4099 0.02% 133 4347 0.02% 134 4380 0.02% 135 4743 0.02% 136 4665 0.02% 137 5062 0.02% 138 5301 0.02% 139 5472 0.02% 140 5508 0.02% 141 5816 0.02% 142 6046 0.03% 143 6267 0.03% 144 6502 0.03% 145 6739 0.03% 146 7477 0.03% 147 9997 0.04% 148 26374 0.11% 149 332711 1.41% 150 22999168 97.67% 23548237 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=26 prefix-density=0.32 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=22.02 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.5 sequence=CCACCACCGCCGCTTCCGCGGGATTGTGCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATCTCTCATTGCCTTCTCGTTGTTGAAGGTAACAAATCCAAAGCCGCGAGATCTTCCAGTTTCACGATCGTTTATAATCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=13 prefix-density=0.45 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=88.51 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=14.7 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGGAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR14639600 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:36:29 Started mapping on | Feb 10 11:36:30 Finished on | Feb 10 11:43:36 Mapping speed, Million of reads per hour | 199.00 Number of input reads | 23548237 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19566173 Uniquely mapped reads % | 83.09% Average mapped length | 297.16 Number of splices: Total | 16785360 Number of splices: Annotated (sjdb) | 16422192 Number of splices: GT/AG | 16500141 Number of splices: GC/AG | 213677 Number of splices: AT/AC | 15550 Number of splices: Non-canonical | 55992 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 553118 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 31542 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.31% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3428946 3428946 3428946 N_multimapping 553118 553118 553118 N_noFeature 683851 19396885 756377 N_ambiguous 244984 1290 147558 UnstrandedReadsAssigned:18637338 PositiveStrandReadsAssigned:167998 NegativeStrandReadsAssigned:18662238 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639600 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639600-trimmed-pair1.fastq SRR14639600-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,548,237 reads, 19,144,142 reads pseudoaligned [quant] estimated average fragment length: 365.971 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR14639600.ke.tsv 34699 SRR14639600.se.tsv 87100 total ==> SRR14639600.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1653.03 3649 104.691 Potri.005G024800.1.v4.1 1035 670.029 391 27.6758 Potri.004G059700.1.v4.1 961 596.709 158 12.5578 Potri.007G009000.2.v4.1 1416 1051.03 1 0.0451235 Potri.003G141000.2.v4.1 2943 2578.03 1009 18.5618 Potri.016G087400.1.v4.1 270 51.5405 1128.72 1038.61 Potri.015G069301.1.v4.1 564 232.163 0 0 Potri.010G195200.1.v4.1 1773 1408.03 49 1.65045 Potri.012G127500.1.v4.1 977 612.401 2138 165.573 ==> SRR14639600.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 476 SRR14639600 completed mapping pipeline successfully