Starting /dee2/code/volunteer_pipeline.sh SRR14639601 current disk space = 3058997833728 free memory = 1560051732 SRR14639601 SRAfilesize c8b1031021a9e8fa483cb10edb090424 SRR14639601.sra SRR14639601.sra file validated SRR14639601 is paired end SRR14639601 is conventional basespace SRR14639601 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639601_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65375 32.0 32.0 32.0 32.0 32.0 2 31.55 32.0 32.0 32.0 32.0 32.0 3 35.21125 37.0 32.0 37.0 32.0 37.0 4 36.22375 37.0 37.0 37.0 37.0 37.0 5 36.2525 37.0 37.0 37.0 37.0 37.0 6 39.773 41.0 41.0 41.0 37.0 41.0 7 39.909 41.0 41.0 41.0 37.0 41.0 8 40.0875 41.0 41.0 41.0 37.0 41.0 9 40.18175 41.0 41.0 41.0 37.0 41.0 10-14 40.18635 41.0 41.0 41.0 37.8 41.0 15-19 40.21065 41.0 41.0 41.0 37.8 41.0 20-24 40.1822 41.0 41.0 41.0 37.8 41.0 25-29 40.141749999999995 41.0 41.0 41.0 37.8 41.0 30-34 40.20125 41.0 41.0 41.0 40.2 41.0 35-39 40.083 41.0 41.0 41.0 37.0 41.0 40-44 40.0572 41.0 41.0 41.0 37.0 41.0 45-49 39.98685 41.0 41.0 41.0 37.0 41.0 50-54 39.940999999999995 41.0 41.0 41.0 37.0 41.0 55-59 39.8663 41.0 41.0 41.0 37.0 41.0 60-64 39.84589999999999 41.0 41.0 41.0 37.0 41.0 65-69 39.747550000000004 41.0 41.0 41.0 37.0 41.0 70-74 39.5105 41.0 41.0 41.0 37.0 41.0 75-79 39.09655 41.0 40.2 41.0 36.0 41.0 80-84 39.547349999999994 41.0 41.0 41.0 37.0 41.0 85-89 39.495349999999995 41.0 41.0 41.0 37.0 41.0 90-94 39.4925 41.0 41.0 41.0 37.0 41.0 95-99 39.334700000000005 41.0 41.0 41.0 37.0 41.0 100-104 39.29595 41.0 41.0 41.0 37.0 41.0 105-109 39.28405 41.0 41.0 41.0 37.0 41.0 110-114 39.2112 41.0 41.0 41.0 37.0 41.0 115-119 39.23435 41.0 41.0 41.0 37.0 41.0 120-124 39.12295 41.0 41.0 41.0 37.0 41.0 125-129 39.13385 41.0 41.0 41.0 37.0 41.0 130-134 38.928000000000004 41.0 41.0 41.0 33.0 41.0 135-139 38.58565 41.0 40.2 41.0 32.0 41.0 140-144 38.321000000000005 41.0 39.4 41.0 32.0 41.0 145-149 38.17115 41.0 37.0 41.0 32.0 41.0 150 37.97975 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 1.0 24 3.0 25 5.0 26 7.0 27 14.0 28 10.0 29 10.0 30 30.0 31 32.0 32 32.0 33 64.0 34 71.0 35 101.0 36 126.0 37 154.0 38 259.0 39 508.0 40 2570.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.150000000000006 12.85 8.924999999999999 44.074999999999996 2 14.924999999999999 12.25 43.35 29.475 3 15.675 17.599999999999998 28.725 38.0 4 23.150000000000002 23.775 24.55 28.525 5 23.849999999999998 32.25 25.8 18.099999999999998 6 17.175 34.75 26.5 21.575 7 14.149999999999999 27.625 41.375 16.85 8 14.6 24.6 37.574999999999996 23.225 9 16.375 24.75 36.175000000000004 22.7 10-14 19.64 28.575 28.29 23.494999999999997 15-19 19.155 27.87 28.71 24.265 20-24 19.555 28.384999999999998 27.529999999999998 24.529999999999998 25-29 19.314999999999998 28.26 28.175 24.25 30-34 20.080000000000002 28.060000000000002 27.485 24.375 35-39 19.765 27.860000000000003 28.265 24.11 40-44 20.465 27.939999999999998 27.944999999999997 23.65 45-49 20.03 28.115000000000002 27.755000000000003 24.099999999999998 50-54 20.265 28.110000000000003 27.534999999999997 24.09 55-59 19.6 29.12 27.66 23.62 60-64 19.869999999999997 28.535 27.615000000000002 23.98 65-69 20.105 28.12 27.894999999999996 23.880000000000003 70-74 20.26 28.29 27.785 23.665 75-79 20.285 28.205000000000002 27.584999999999997 23.925 80-84 20.044999999999998 28.485 27.400000000000002 24.07 85-89 20.315 27.694999999999997 27.66 24.33 90-94 20.375 27.975 27.779999999999998 23.87 95-99 19.945 28.425 27.689999999999998 23.94 100-104 19.91 28.21 27.544999999999998 24.335 105-109 19.99 28.365000000000002 27.415 24.23 110-114 20.405 27.534999999999997 27.97 24.09 115-119 20.825 27.36 27.655 24.16 120-124 20.880000000000003 27.71 27.61 23.799999999999997 125-129 20.45 27.779999999999998 27.900000000000002 23.87 130-134 20.44 28.155 27.744999999999997 23.66 135-139 20.895 27.965 27.215 23.925 140-144 20.758113717057558 27.679151872780917 27.734160124018604 23.82857428614292 145-149 21.240000000000002 27.950000000000003 26.935 23.875 150 20.25 28.1 27.425 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 4.0 23 5.5 24 5.0 25 5.5 26 5.0 27 7.0 28 11.5 29 11.0 30 16.5 31 27.0 32 33.0 33 43.5 34 55.0 35 65.5 36 82.5 37 103.0 38 133.5 39 172.0 40 197.0 41 219.5 42 250.0 43 266.0 44 271.5 45 270.0 46 249.0 47 230.0 48 212.0 49 195.0 50 165.5 51 128.0 52 108.0 53 97.0 54 84.0 55 62.5 56 49.5 57 40.5 58 25.5 59 21.0 60 19.0 61 12.0 62 9.5 63 5.0 64 3.0 65 3.5 66 3.0 67 1.5 68 0.5 69 3.5 70 3.5 71 0.5 72 1.5 73 2.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.41644840230488 91.07499999999999 2 4.400209533787323 8.4 3 0.18334206390780514 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.2625 0.0 0.0 0.0 0.0 120-121 0.2875 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.3875 0.0 0.0 0.0 0.0 126-127 0.4625 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.6875 0.0 0.0 0.0 0.0 132-133 0.8125 0.0 0.0 0.0 0.0 134-135 0.9625 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639601 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639601_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89875 32.0 32.0 32.0 32.0 32.0 2 31.04375 32.0 32.0 32.0 32.0 32.0 3 33.975 37.0 32.0 37.0 32.0 37.0 4 34.99125 37.0 37.0 37.0 32.0 37.0 5 35.29875 37.0 37.0 37.0 32.0 37.0 6 38.506 41.0 41.0 41.0 32.0 41.0 7 38.46825 41.0 41.0 41.0 32.0 41.0 8 38.51875 41.0 41.0 41.0 32.0 41.0 9 38.624 41.0 41.0 41.0 32.0 41.0 10-14 38.67135 41.0 41.0 41.0 32.0 41.0 15-19 38.38135 41.0 41.0 41.0 32.0 41.0 20-24 38.265100000000004 41.0 41.0 41.0 31.0 41.0 25-29 37.969849999999994 41.0 39.4 41.0 29.0 41.0 30-34 37.9964 41.0 38.6 41.0 29.0 41.0 35-39 37.806400000000004 41.0 37.0 41.0 28.0 41.0 40-44 37.700199999999995 41.0 37.0 41.0 27.0 41.0 45-49 37.57395 41.0 37.0 41.0 27.0 41.0 50-54 37.42775 41.0 37.0 41.0 27.0 41.0 55-59 37.4191 41.0 37.0 41.0 27.0 41.0 60-64 37.36375 41.0 37.0 41.0 27.0 41.0 65-69 37.14725 41.0 37.0 41.0 27.0 41.0 70-74 36.92100000000001 41.0 37.0 41.0 25.0 41.0 75-79 36.096500000000006 40.2 35.0 41.0 22.0 41.0 80-84 37.0983 41.0 37.0 41.0 25.0 41.0 85-89 37.1163 41.0 37.0 41.0 24.0 41.0 90-94 36.78985 41.0 37.0 41.0 22.0 41.0 95-99 36.883050000000004 41.0 37.0 41.0 22.0 41.0 100-104 36.5834 41.0 37.0 41.0 22.0 41.0 105-109 36.61565 41.0 37.0 41.0 22.0 41.0 110-114 36.59949999999999 41.0 37.0 41.0 22.0 41.0 115-119 36.31785 41.0 36.0 41.0 22.0 41.0 120-124 36.327749999999995 41.0 37.0 41.0 22.0 41.0 125-129 35.8553 41.0 35.0 41.0 22.0 41.0 130-134 35.8897 41.0 37.0 41.0 22.0 41.0 135-139 35.410450000000004 41.0 35.0 41.0 18.0 41.0 140-144 35.106700000000004 41.0 32.0 41.0 18.0 41.0 145-149 35.0035 41.0 32.0 41.0 16.0 41.0 150 34.53625 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 4.0 16 7.0 17 12.0 18 27.0 19 19.0 20 22.0 21 31.0 22 34.0 23 35.0 24 38.0 25 47.0 26 40.0 27 60.0 28 69.0 29 57.0 30 66.0 31 84.0 32 94.0 33 104.0 34 104.0 35 154.0 36 163.0 37 218.0 38 333.0 39 556.0 40 1621.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.60511150087697 24.95615134051616 8.443998997744927 30.99473816086194 2 19.525000000000002 25.374999999999996 40.0 15.1 3 17.424999999999997 27.150000000000002 34.425 21.0 4 22.425 32.574999999999996 24.825 20.175 5 23.25 37.525 22.1 17.125 6 17.7 38.5 24.85 18.95 7 20.95 21.125 36.625 21.3 8 16.7 24.099999999999998 33.175 26.025 9 19.7 24.2 32.2 23.9 10-14 22.439999999999998 28.16 27.38 22.02 15-19 22.145 27.805000000000003 27.99 22.06 20-24 22.17 27.705000000000002 28.315 21.81 25-29 22.295 27.575 28.375 21.755 30-34 22.645 27.839999999999996 28.050000000000004 21.465 35-39 22.355 27.415 28.325 21.905 40-44 22.74 27.805000000000003 27.935 21.52 45-49 22.835 27.205000000000002 28.32 21.64 50-54 22.415 28.215 28.03 21.34 55-59 23.365 27.925 27.82 20.89 60-64 23.11 27.91 27.815 21.165 65-69 22.900000000000002 27.43 27.855 21.815 70-74 23.225 27.575 28.24 20.96 75-79 23.400000000000002 27.105 27.985 21.51 80-84 23.31 27.55 28.000000000000004 21.14 85-89 22.705000000000002 27.865000000000002 27.52 21.91 90-94 22.98 27.560000000000002 27.85 21.61 95-99 23.810000000000002 27.445000000000004 28.285 20.46 100-104 23.735 27.62 27.48 21.165 105-109 23.515 27.065 27.79 21.63 110-114 23.755000000000003 27.625 27.644999999999996 20.974999999999998 115-119 23.325000000000003 27.305 27.74 21.63 120-124 24.19 27.68 27.339999999999996 20.79 125-129 23.330000000000002 28.055000000000003 26.775 21.84 130-134 23.985 27.865000000000002 27.12 21.029999999999998 135-139 24.02 27.93 26.834999999999997 21.215 140-144 24.34 27.875 26.965 20.82 145-149 24.375 27.750000000000004 26.68 21.195 150 23.9 28.349999999999998 26.974999999999998 20.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 1.5 23 2.0 24 4.0 25 4.0 26 3.5 27 5.0 28 6.5 29 10.5 30 16.5 31 27.0 32 39.0 33 42.0 34 48.0 35 69.5 36 92.5 37 117.0 38 140.0 39 157.5 40 195.5 41 246.0 42 268.0 43 266.0 44 259.0 45 249.0 46 238.0 47 226.5 48 205.0 49 187.0 50 170.5 51 136.0 52 107.0 53 90.0 54 72.0 55 56.0 56 53.5 57 47.0 58 33.0 59 20.5 60 15.5 61 14.0 62 8.0 63 8.5 64 7.0 65 5.5 66 8.5 67 6.0 68 3.0 69 2.5 70 2.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 96.17983367983368 92.525 2 3.6902286902286905 7.1 3 0.12993762993762994 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.4375 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.7125 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.875 0.0 0.0 0.0 0.0 136-137 0.9875 0.0 0.0 0.0 0.0 138 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAACC 10 0.006973645 144.0 3 >>END_MODULE Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076607 spots for SRR14639601.sra Written 1076607 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra Read 1076605 spots for SRR14639601.sra Written 1076605 spots for SRR14639601.sra SRR ids: ['SRR14639601.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uvo4vxm1 SRR14639601.sra spots: 21532102 blocks: [[1, 1076605], [1076606, 2153210], [2153211, 3229815], [3229816, 4306420], [4306421, 5383025], [5383026, 6459630], [6459631, 7536235], [7536236, 8612840], [8612841, 9689445], [9689446, 10766050], [10766051, 11842655], [11842656, 12919260], [12919261, 13995865], [13995866, 15072470], [15072471, 16149075], [16149076, 17225680], [17225681, 18302285], [18302286, 19378890], [19378891, 20455495], [20455496, 21532102]] SRR14639601 file size 7969812 SRR14639601 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639601 SRR14639601_1.fastq SRR14639601_2.fastq Input file: SRR14639601_1.fastq Paired file: SRR14639601_2.fastq trimmed: SRR14639601-trimmed-pair1.fastq, SRR14639601-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:43:39 2025 >> started Mon Feb 10 11:44:03 2025 >> done (24.385s) 21532102 read pairs processed; of these: 130 ( 0.00%) short read pairs filtered out after trimming by size control 85 ( 0.00%) empty read pairs filtered out after trimming by size control 21531887 (100.00%) read pairs available; of these: 969498 ( 4.50%) trimmed read pairs available after processing 20562389 (95.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 17 0.00% 20 25 0.00% 21 30 0.00% 22 47 0.00% 23 31 0.00% 24 41 0.00% 25 29 0.00% 26 41 0.00% 27 41 0.00% 28 60 0.00% 29 37 0.00% 30 52 0.00% 31 59 0.00% 32 80 0.00% 33 59 0.00% 34 53 0.00% 35 65 0.00% 36 67 0.00% 37 66 0.00% 38 89 0.00% 39 74 0.00% 40 86 0.00% 41 74 0.00% 42 84 0.00% 43 100 0.00% 44 90 0.00% 45 91 0.00% 46 97 0.00% 47 105 0.00% 48 99 0.00% 49 105 0.00% 50 123 0.00% 51 118 0.00% 52 132 0.00% 53 122 0.00% 54 118 0.00% 55 120 0.00% 56 146 0.00% 57 169 0.00% 58 154 0.00% 59 153 0.00% 60 179 0.00% 61 176 0.00% 62 204 0.00% 63 190 0.00% 64 233 0.00% 65 216 0.00% 66 216 0.00% 67 249 0.00% 68 237 0.00% 69 265 0.00% 70 295 0.00% 71 298 0.00% 72 310 0.00% 73 380 0.00% 74 370 0.00% 75 404 0.00% 76 429 0.00% 77 433 0.00% 78 454 0.00% 79 528 0.00% 80 596 0.00% 81 583 0.00% 82 664 0.00% 83 707 0.00% 84 790 0.00% 85 800 0.00% 86 813 0.00% 87 894 0.00% 88 981 0.00% 89 969 0.00% 90 1124 0.01% 91 1251 0.01% 92 1300 0.01% 93 1403 0.01% 94 1519 0.01% 95 1589 0.01% 96 1735 0.01% 97 1972 0.01% 98 2086 0.01% 99 2198 0.01% 100 2337 0.01% 101 2450 0.01% 102 2589 0.01% 103 2859 0.01% 104 3129 0.01% 105 3369 0.02% 106 3448 0.02% 107 3880 0.02% 108 4114 0.02% 109 4255 0.02% 110 4540 0.02% 111 4854 0.02% 112 5275 0.02% 113 5618 0.03% 114 6002 0.03% 115 6480 0.03% 116 6722 0.03% 117 7356 0.03% 118 7757 0.04% 119 8149 0.04% 120 8774 0.04% 121 9198 0.04% 122 9707 0.05% 123 10334 0.05% 124 11246 0.05% 125 11502 0.05% 126 12355 0.06% 127 12916 0.06% 128 13616 0.06% 129 14620 0.07% 130 15045 0.07% 131 15647 0.07% 132 16452 0.08% 133 17363 0.08% 134 17865 0.08% 135 19053 0.09% 136 19752 0.09% 137 20287 0.09% 138 21297 0.10% 139 22392 0.10% 140 23315 0.11% 141 23931 0.11% 142 25055 0.12% 143 25874 0.12% 144 27279 0.13% 145 28291 0.13% 146 29435 0.14% 147 32797 0.15% 148 45324 0.21% 149 280189 1.30% 150 20562389 95.50% 21531887 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=12 prefix-density=0.31 prefix-fanout=3.2 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=25.49 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.2 sequence=CCACCACCGCCGCTTCCGCGGGATTGTGCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATCTCTCATTGCCTTCTCGTTGTTGAAGGTAACAAATCCAAAGCCGCGAGATCTTCCAGTTTCACGATCGTTTATAATCTTCGAATCGATGATTTCACCGTACTGGCTAAACGCTTCTTGAAGGGATTGGTCAGTAGTGGCCCATGCGAGGCC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.35 fanout-score-rank=13 prefix-density=0.55 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=78.48 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=13.5 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGGAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR14639601 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:45:12 Started mapping on | Feb 10 11:45:12 Finished on | Feb 10 11:51:30 Mapping speed, Million of reads per hour | 205.07 Number of input reads | 21531887 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 17589831 Uniquely mapped reads % | 81.69% Average mapped length | 296.71 Number of splices: Total | 15116934 Number of splices: Annotated (sjdb) | 14789939 Number of splices: GT/AG | 14862775 Number of splices: GC/AG | 190605 Number of splices: AT/AC | 13773 Number of splices: Non-canonical | 49781 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486999 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 41453 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.72% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3455057 3455057 3455057 N_multimapping 486999 486999 486999 N_noFeature 634793 17431003 709225 N_ambiguous 204915 1139 119900 UnstrandedReadsAssigned:16750123 PositiveStrandReadsAssigned:157689 NegativeStrandReadsAssigned:16760706 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639601 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639601-trimmed-pair1.fastq SRR14639601-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,531,887 reads, 17,242,448 reads pseudoaligned [quant] estimated average fragment length: 310.283 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR14639601.ke.tsv 34699 SRR14639601.se.tsv 87100 total ==> SRR14639601.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1708.72 2991 95.4803 Potri.005G024800.1.v4.1 1035 725.717 404 30.3656 Potri.004G059700.1.v4.1 961 652.128 178 14.8886 Potri.007G009000.2.v4.1 1416 1106.72 0 0 Potri.003G141000.2.v4.1 2943 2633.72 987.249 20.4468 Potri.016G087400.1.v4.1 270 69.2429 1070 842.9 Potri.015G069301.1.v4.1 564 281.445 0 0 Potri.010G195200.1.v4.1 1773 1463.72 54 2.01235 Potri.012G127500.1.v4.1 977 667.946 1586 129.518 ==> SRR14639601.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 309 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 469 SRR14639601 completed mapping pipeline successfully