Starting /dee2/code/volunteer_pipeline.sh SRR14639602 current disk space = 3058802745344 free memory = 1205439320 SRR14639602 SRAfilesize b850fdf30edbdc20da6112e0a47a0b77 SRR14639602.sra SRR14639602.sra file validated SRR14639602 is paired end SRR14639602 is conventional basespace SRR14639602 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639602_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.635 32.0 32.0 32.0 32.0 32.0 2 31.54375 32.0 32.0 32.0 32.0 32.0 3 35.30875 37.0 37.0 37.0 32.0 37.0 4 36.165 37.0 37.0 37.0 32.0 37.0 5 36.25 37.0 37.0 37.0 37.0 37.0 6 39.82025 41.0 41.0 41.0 37.0 41.0 7 39.85175 41.0 41.0 41.0 37.0 41.0 8 40.14625 41.0 41.0 41.0 37.0 41.0 9 40.26275 41.0 41.0 41.0 37.0 41.0 10-14 40.213350000000005 41.0 41.0 41.0 39.4 41.0 15-19 40.228449999999995 41.0 41.0 41.0 39.4 41.0 20-24 40.19799999999999 41.0 41.0 41.0 37.8 41.0 25-29 40.1207 41.0 41.0 41.0 37.0 41.0 30-34 40.0238 41.0 41.0 41.0 37.0 41.0 35-39 39.79595 41.0 41.0 41.0 37.0 41.0 40-44 39.57095 41.0 41.0 41.0 37.0 41.0 45-49 39.418600000000005 41.0 41.0 41.0 37.0 41.0 50-54 39.1364 41.0 41.0 41.0 37.0 41.0 55-59 38.804649999999995 41.0 41.0 41.0 33.0 41.0 60-64 38.47405 41.0 37.8 41.0 32.0 41.0 65-69 37.80069999999999 41.0 37.0 41.0 29.0 41.0 70-74 36.92835 41.0 37.0 41.0 27.0 41.0 75-79 34.427800000000005 37.6 33.0 40.2 24.0 41.0 80-84 35.78225 41.0 32.0 41.0 24.0 41.0 85-89 35.690149999999996 41.0 32.0 41.0 22.0 41.0 90-94 35.4172 39.4 32.0 41.0 23.0 41.0 95-99 35.41635 38.6 32.0 41.0 22.0 41.0 100-104 35.699650000000005 41.0 32.0 41.0 22.0 41.0 105-109 35.91095 41.0 32.0 41.0 22.0 41.0 110-114 36.1158 41.0 34.0 41.0 22.0 41.0 115-119 36.451049999999995 41.0 37.0 41.0 25.0 41.0 120-124 36.73434999999999 41.0 37.0 41.0 27.0 41.0 125-129 37.139950000000006 41.0 37.0 41.0 27.0 41.0 130-134 37.0288 41.0 37.0 41.0 27.0 41.0 135-139 37.1124 41.0 37.0 41.0 27.0 41.0 140-144 37.136649999999996 41.0 37.0 41.0 27.0 41.0 145-149 37.022800000000004 41.0 37.0 41.0 27.0 41.0 150 36.8315 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 6.0 23 8.0 24 8.0 25 14.0 26 13.0 27 33.0 28 39.0 29 43.0 30 62.0 31 88.0 32 78.0 33 109.0 34 144.0 35 176.0 36 275.0 37 423.0 38 696.0 39 1147.0 40 635.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.225 12.675 11.4 42.699999999999996 2 14.549999999999999 12.6 43.25 29.599999999999998 3 15.425 17.224999999999998 29.75 37.6 4 21.2 25.974999999999998 25.2 27.625 5 20.549999999999997 31.924999999999997 28.525 19.0 6 17.224999999999998 32.5 28.449999999999996 21.825 7 13.425 27.575 41.925000000000004 17.075000000000003 8 15.15 26.0 35.4 23.45 9 15.15 23.45 37.225 24.175 10-14 18.765 28.985 28.4 23.849999999999998 15-19 19.134999999999998 28.244999999999997 28.77 23.849999999999998 20-24 19.41 28.27 28.28 24.04 25-29 19.67 28.595 27.735 24.0 30-34 19.395 28.765 27.700000000000003 24.14 35-39 19.145 29.37 27.800000000000004 23.685000000000002 40-44 19.425 28.74 27.63 24.205 45-49 19.535 28.16 27.800000000000004 24.505 50-54 19.57 28.26 28.244999999999997 23.925 55-59 19.435 28.854999999999997 27.97 23.74 60-64 19.869999999999997 27.860000000000003 27.785 24.485 65-69 19.505 27.905 28.42 24.169999999999998 70-74 20.085 28.1 28.46 23.355 75-79 19.64 28.87 27.77 23.72 80-84 19.45 27.794999999999998 28.23 24.525 85-89 20.095 28.005000000000003 27.450000000000003 24.45 90-94 19.55 28.884999999999998 27.88 23.685000000000002 95-99 19.88 28.59 28.095 23.435 100-104 19.785 28.410000000000004 28.04 23.765 105-109 20.413061959293895 28.134220133019955 27.474121118167727 23.978596789518427 110-114 20.349999999999998 28.105000000000004 27.405 24.14 115-119 19.955000000000002 29.17 27.735 23.14 120-124 20.23 28.12 27.875 23.775 125-129 20.135 28.365000000000002 27.495000000000005 24.005000000000003 130-134 20.44 27.955000000000002 27.925 23.68 135-139 20.26 27.935 27.560000000000002 24.245 140-144 20.514102820564112 28.160632126425284 27.81056211242248 23.514702940588116 145-149 19.945 28.46 27.96 23.635 150 21.275 28.125 26.974999999999998 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 2.0 23 2.5 24 5.0 25 7.0 26 8.5 27 7.5 28 6.5 29 10.5 30 25.0 31 34.5 32 42.5 33 56.5 34 63.5 35 76.0 36 94.5 37 114.5 38 134.0 39 164.5 40 201.5 41 238.0 42 255.0 43 268.0 44 271.0 45 261.0 46 246.5 47 218.0 48 208.5 49 191.5 50 149.0 51 121.0 52 117.0 53 97.5 54 67.0 55 45.5 56 38.0 57 34.0 58 20.5 59 17.0 60 17.0 61 11.5 62 8.5 63 8.0 64 6.0 65 5.0 66 4.5 67 2.0 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.44144616190727 91.07499999999999 2 4.375163741157977 8.35 3 0.13099292638197535 0.375 4 0.052397170552790154 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.0875 0.0 0.0 0.0 0.0 118-119 0.1375 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.21250000000000002 0.0 0.0 0.0 0.0 128-129 0.225 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.275 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 0.3375 0.0 0.0 0.0 0.0 138 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639602 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639602_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.54875 32.0 32.0 32.0 27.0 32.0 2 30.2325 32.0 32.0 32.0 27.0 32.0 3 33.4125 37.0 32.0 37.0 27.0 37.0 4 34.4975 37.0 37.0 37.0 32.0 37.0 5 35.0475 37.0 37.0 37.0 32.0 37.0 6 37.58825 41.0 37.0 41.0 32.0 41.0 7 37.618 41.0 37.0 41.0 32.0 41.0 8 37.49375 41.0 37.0 41.0 27.0 41.0 9 37.958 41.0 37.0 41.0 27.0 41.0 10-14 37.93820000000001 41.0 37.0 41.0 30.0 41.0 15-19 37.612399999999994 41.0 37.0 41.0 27.0 41.0 20-24 37.346900000000005 41.0 37.0 41.0 27.0 41.0 25-29 36.8064 41.0 37.0 41.0 25.0 41.0 30-34 36.793099999999995 41.0 37.0 41.0 25.0 41.0 35-39 37.10915 41.0 37.0 41.0 27.0 41.0 40-44 37.0876 41.0 37.0 41.0 27.0 41.0 45-49 36.98125 41.0 37.0 41.0 27.0 41.0 50-54 36.9556 41.0 37.0 41.0 27.0 41.0 55-59 36.9658 41.0 37.0 41.0 27.0 41.0 60-64 36.85105 41.0 37.0 41.0 27.0 41.0 65-69 36.5878 41.0 37.0 41.0 22.0 41.0 70-74 36.3849 41.0 37.0 41.0 23.0 41.0 75-79 35.75085 40.2 35.0 41.0 22.0 41.0 80-84 36.56525 41.0 37.0 41.0 22.0 41.0 85-89 36.62864999999999 41.0 37.0 41.0 22.0 41.0 90-94 36.3104 41.0 37.0 41.0 22.0 41.0 95-99 36.41525 41.0 37.0 41.0 22.0 41.0 100-104 36.04645 41.0 36.0 41.0 20.0 41.0 105-109 35.960950000000004 41.0 37.0 41.0 22.0 41.0 110-114 35.88235 41.0 37.0 41.0 22.0 41.0 115-119 35.43795000000001 41.0 33.0 41.0 20.0 41.0 120-124 35.588100000000004 41.0 32.0 41.0 22.0 41.0 125-129 34.9606 41.0 32.0 41.0 18.0 41.0 130-134 35.09955 41.0 32.0 41.0 22.0 41.0 135-139 34.530150000000006 40.2 32.0 41.0 18.0 41.0 140-144 34.293000000000006 38.6 32.0 41.0 12.0 41.0 145-149 33.9649 37.0 31.0 41.0 12.0 41.0 150 33.51525 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 11.0 17 25.0 18 12.0 19 32.0 20 27.0 21 41.0 22 42.0 23 40.0 24 38.0 25 54.0 26 62.0 27 64.0 28 74.0 29 80.0 30 81.0 31 88.0 32 109.0 33 138.0 34 145.0 35 138.0 36 207.0 37 237.0 38 389.0 39 633.0 40 1230.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.54732098147221 27.541311967951927 9.739609414121182 31.171757636454682 2 19.175 27.55 37.425000000000004 15.85 3 16.775000000000002 27.55 34.975 20.7 4 20.75 33.85 24.4 21.0 5 23.875 38.224999999999994 22.900000000000002 15.0 6 19.575 37.5 23.9 19.025 7 19.650000000000002 24.25 36.425000000000004 19.675 8 17.349999999999998 22.525000000000002 33.975 26.150000000000002 9 20.45 24.425 31.374999999999996 23.75 10-14 21.955 28.37 27.76 21.915000000000003 15-19 22.185 28.660000000000004 27.884999999999998 21.27 20-24 21.605 28.449999999999996 28.275 21.67 25-29 22.585 28.999999999999996 27.375 21.04 30-34 22.12 28.43 27.88 21.57 35-39 22.314999999999998 28.005000000000003 27.88 21.8 40-44 22.63 28.189999999999998 28.050000000000004 21.13 45-49 22.814999999999998 28.51 27.345000000000002 21.33 50-54 22.905 28.189999999999998 27.655 21.25 55-59 22.405 27.92 28.345 21.33 60-64 22.43 27.694999999999997 27.765 22.11 65-69 23.189999999999998 27.62 27.905 21.285 70-74 22.89 27.965 27.500000000000004 21.645 75-79 23.685000000000002 27.98 27.29 21.044999999999998 80-84 22.85 28.494999999999997 27.365000000000002 21.29 85-89 22.720000000000002 28.505000000000003 27.29 21.485000000000003 90-94 23.1 27.71 27.855 21.335 95-99 22.785 28.345 27.474999999999998 21.395 100-104 23.315 27.705000000000002 27.71 21.27 105-109 23.605 28.294999999999998 27.46 20.64 110-114 22.650000000000002 28.194999999999997 27.755000000000003 21.4 115-119 23.405 28.21 27.384999999999998 21.0 120-124 23.255 27.985 28.24 20.52 125-129 22.605 28.28 27.785 21.33 130-134 23.86 27.810000000000002 27.115000000000002 21.215 135-139 23.145 28.65 26.735 21.47 140-144 23.235 27.49 27.79 21.485000000000003 145-149 23.494999999999997 28.105000000000004 27.150000000000002 21.25 150 23.45 29.25 26.674999999999997 20.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.5 20 2.5 21 4.0 22 5.0 23 6.5 24 5.0 25 6.5 26 11.5 27 9.0 28 11.0 29 17.0 30 23.0 31 24.5 32 34.0 33 50.5 34 56.5 35 69.0 36 108.0 37 138.5 38 141.0 39 162.0 40 173.0 41 202.5 42 245.0 43 255.0 44 245.5 45 254.5 46 261.0 47 237.5 48 214.5 49 189.5 50 159.5 51 127.5 52 107.5 53 85.5 54 70.0 55 58.0 56 41.5 57 40.0 58 35.5 59 24.0 60 18.5 61 13.0 62 14.5 63 12.0 64 6.0 65 2.5 66 1.0 67 2.5 68 3.0 69 3.0 70 2.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.31073005975578 92.675 2 3.507404520654715 6.75 3 0.12990387113535984 0.375 4 0.05196154845414394 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.1125 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.16249999999999998 0.0 0.0 0.0 0.0 128-129 0.175 0.0 0.0 0.0 0.0 130-131 0.2 0.0 0.0 0.0 0.0 132-133 0.25 0.0 0.0 0.0 0.0 134-135 0.275 0.0 0.0 0.0 0.0 136-137 0.30000000000000004 0.0 0.0 0.0 0.0 138 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943485 spots for SRR14639602.sra Written 943485 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra Read 943474 spots for SRR14639602.sra Written 943474 spots for SRR14639602.sra SRR ids: ['SRR14639602.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z7r9q2ac SRR14639602.sra spots: 18869491 blocks: [[1, 943474], [943475, 1886948], [1886949, 2830422], [2830423, 3773896], [3773897, 4717370], [4717371, 5660844], [5660845, 6604318], [6604319, 7547792], [7547793, 8491266], [8491267, 9434740], [9434741, 10378214], [10378215, 11321688], [11321689, 12265162], [12265163, 13208636], [13208637, 14152110], [14152111, 15095584], [15095585, 16039058], [16039059, 16982532], [16982533, 17926006], [17926007, 18869491]] SRR14639602 file size 6982940 SRR14639602 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639602 SRR14639602_1.fastq SRR14639602_2.fastq Input file: SRR14639602_1.fastq Paired file: SRR14639602_2.fastq trimmed: SRR14639602-trimmed-pair1.fastq, SRR14639602-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:13:39 2025 >> started Mon Feb 10 12:14:01 2025 >> done (21.564s) 18869491 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 64 ( 0.00%) empty read pairs filtered out after trimming by size control 18869390 (100.00%) read pairs available; of these: 387534 ( 2.05%) trimmed read pairs available after processing 18481856 (97.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 15 0.00% 21 23 0.00% 22 14 0.00% 23 15 0.00% 24 28 0.00% 25 24 0.00% 26 24 0.00% 27 29 0.00% 28 41 0.00% 29 23 0.00% 30 34 0.00% 31 29 0.00% 32 49 0.00% 33 38 0.00% 34 32 0.00% 35 51 0.00% 36 49 0.00% 37 48 0.00% 38 62 0.00% 39 51 0.00% 40 45 0.00% 41 50 0.00% 42 68 0.00% 43 74 0.00% 44 50 0.00% 45 80 0.00% 46 83 0.00% 47 62 0.00% 48 58 0.00% 49 80 0.00% 50 89 0.00% 51 91 0.00% 52 82 0.00% 53 76 0.00% 54 76 0.00% 55 85 0.00% 56 91 0.00% 57 74 0.00% 58 113 0.00% 59 90 0.00% 60 99 0.00% 61 110 0.00% 62 126 0.00% 63 103 0.00% 64 127 0.00% 65 121 0.00% 66 134 0.00% 67 127 0.00% 68 127 0.00% 69 148 0.00% 70 154 0.00% 71 174 0.00% 72 168 0.00% 73 165 0.00% 74 195 0.00% 75 184 0.00% 76 168 0.00% 77 186 0.00% 78 212 0.00% 79 195 0.00% 80 195 0.00% 81 233 0.00% 82 270 0.00% 83 232 0.00% 84 269 0.00% 85 296 0.00% 86 336 0.00% 87 262 0.00% 88 341 0.00% 89 311 0.00% 90 350 0.00% 91 375 0.00% 92 376 0.00% 93 389 0.00% 94 444 0.00% 95 464 0.00% 96 506 0.00% 97 505 0.00% 98 549 0.00% 99 559 0.00% 100 606 0.00% 101 566 0.00% 102 638 0.00% 103 639 0.00% 104 693 0.00% 105 780 0.00% 106 821 0.00% 107 866 0.00% 108 832 0.00% 109 899 0.00% 110 933 0.00% 111 956 0.01% 112 1027 0.01% 113 1095 0.01% 114 1190 0.01% 115 1195 0.01% 116 1244 0.01% 117 1289 0.01% 118 1376 0.01% 119 1434 0.01% 120 1428 0.01% 121 1540 0.01% 122 1628 0.01% 123 1644 0.01% 124 1763 0.01% 125 1768 0.01% 126 1879 0.01% 127 2027 0.01% 128 2024 0.01% 129 2234 0.01% 130 2276 0.01% 131 2363 0.01% 132 2421 0.01% 133 2525 0.01% 134 2664 0.01% 135 2734 0.01% 136 2822 0.01% 137 2848 0.02% 138 3054 0.02% 139 3084 0.02% 140 3332 0.02% 141 3344 0.02% 142 3495 0.02% 143 3679 0.02% 144 3680 0.02% 145 3950 0.02% 146 4296 0.02% 147 6356 0.03% 148 18491 0.10% 149 260611 1.38% 150 18481856 97.95% 18869390 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=3.0 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=21.32 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=8.4 sequence=GCAGCTGCTTTCCTGCCACCCCTGTGTTTTCGACCGCGGCCGTGACG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.16 fanout-score-rank=13 prefix-density=0.55 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=141.72 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=23.1 sequence=TTCAAGAAAATGG SRR14639602 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:15:01 Started mapping on | Feb 10 12:15:02 Finished on | Feb 10 12:20:58 Mapping speed, Million of reads per hour | 190.81 Number of input reads | 18869390 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16043485 Uniquely mapped reads % | 85.02% Average mapped length | 297.29 Number of splices: Total | 13727345 Number of splices: Annotated (sjdb) | 13425767 Number of splices: GT/AG | 13495988 Number of splices: GC/AG | 173734 Number of splices: AT/AC | 12593 Number of splices: Non-canonical | 45030 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454904 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 27687 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.31% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2371001 2371001 2371001 N_multimapping 454904 454904 454904 N_noFeature 574036 15900557 635800 N_ambiguous 200761 1086 119011 UnstrandedReadsAssigned:15268688 PositiveStrandReadsAssigned:141842 NegativeStrandReadsAssigned:15288674 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639602 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639602-trimmed-pair1.fastq SRR14639602-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,869,390 reads, 15,579,521 reads pseudoaligned [quant] estimated average fragment length: 358.436 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR14639602.ke.tsv 34699 SRR14639602.se.tsv 87100 total ==> SRR14639602.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1660.56 2828 95.4805 Potri.005G024800.1.v4.1 1035 677.564 191 15.8043 Potri.004G059700.1.v4.1 961 603.908 180 16.7106 Potri.007G009000.2.v4.1 1416 1058.56 0 0 Potri.003G141000.2.v4.1 2943 2585.56 862.238 18.6966 Potri.016G087400.1.v4.1 270 46.2362 1042 1263.51 Potri.015G069301.1.v4.1 564 233.351 0 0 Potri.010G195200.1.v4.1 1773 1415.56 41 1.62385 Potri.012G127500.1.v4.1 977 619.718 1072 96.9821 ==> SRR14639602.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 76 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 252 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 363 SRR14639602 completed mapping pipeline successfully