Starting /dee2/code/volunteer_pipeline.sh SRR14639603 current disk space = 3058768687104 free memory = 1249819828 SRR14639603 SRAfilesize 84705d2472c742b17fb1c06c4fb5c2fa SRR14639603.sra SRR14639603.sra file validated SRR14639603 is paired end SRR14639603 is conventional basespace SRR14639603 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639603_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6825 32.0 32.0 32.0 32.0 32.0 2 31.54375 32.0 32.0 32.0 32.0 32.0 3 35.2275 37.0 32.0 37.0 32.0 37.0 4 36.075 37.0 37.0 37.0 32.0 37.0 5 36.2575 37.0 37.0 37.0 37.0 37.0 6 39.799 41.0 41.0 41.0 37.0 41.0 7 39.811 41.0 41.0 41.0 37.0 41.0 8 40.07125 41.0 41.0 41.0 37.0 41.0 9 40.124 41.0 41.0 41.0 37.0 41.0 10-14 40.13185 41.0 41.0 41.0 37.8 41.0 15-19 40.1569 41.0 41.0 41.0 37.0 41.0 20-24 40.1209 41.0 41.0 41.0 37.0 41.0 25-29 40.08845 41.0 41.0 41.0 37.0 41.0 30-34 39.96515000000001 41.0 41.0 41.0 37.0 41.0 35-39 39.8267 41.0 41.0 41.0 37.0 41.0 40-44 39.52605 41.0 41.0 41.0 37.0 41.0 45-49 39.327749999999995 41.0 41.0 41.0 37.0 41.0 50-54 39.050200000000004 41.0 41.0 41.0 37.0 41.0 55-59 38.76805 41.0 40.2 41.0 35.0 41.0 60-64 38.505100000000006 41.0 37.0 41.0 33.0 41.0 65-69 37.83445 41.0 37.0 41.0 29.0 41.0 70-74 37.03205 41.0 37.0 41.0 27.0 41.0 75-79 34.554449999999996 37.6 33.0 40.2 24.0 41.0 80-84 35.8408 40.2 32.0 41.0 25.0 41.0 85-89 35.6701 41.0 32.0 41.0 23.0 41.0 90-94 35.35055 37.8 32.0 41.0 22.0 41.0 95-99 35.248599999999996 37.8 32.0 41.0 22.0 41.0 100-104 35.499 41.0 32.0 41.0 22.0 41.0 105-109 35.781749999999995 41.0 32.0 41.0 22.0 41.0 110-114 36.007799999999996 41.0 34.0 41.0 22.0 41.0 115-119 36.265649999999994 41.0 37.0 41.0 23.0 41.0 120-124 36.609249999999996 41.0 37.0 41.0 25.0 41.0 125-129 36.99250000000001 41.0 37.0 41.0 27.0 41.0 130-134 37.0091 41.0 37.0 41.0 27.0 41.0 135-139 37.015699999999995 41.0 37.0 41.0 27.0 41.0 140-144 37.02175000000001 41.0 37.0 41.0 27.0 41.0 145-149 36.9799 41.0 37.0 41.0 27.0 41.0 150 36.9045 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 5.0 23 6.0 24 8.0 25 14.0 26 30.0 27 26.0 28 42.0 29 47.0 30 64.0 31 76.0 32 79.0 33 100.0 34 144.0 35 211.0 36 272.0 37 451.0 38 688.0 39 1131.0 40 605.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.35 12.5 10.975 44.175 2 13.900000000000002 12.425 44.474999999999994 29.2 3 15.825 17.5 29.65 37.025000000000006 4 21.099999999999998 24.625 23.825 30.45 5 21.25 33.35 27.35 18.05 6 16.675 33.825 29.9 19.6 7 14.274999999999999 27.375 40.45 17.9 8 13.750000000000002 25.025 37.125 24.099999999999998 9 15.1 25.2 36.1 23.599999999999998 10-14 19.045 28.605000000000004 29.01 23.34 15-19 19.395 28.225 27.77 24.610000000000003 20-24 19.580000000000002 28.53 27.800000000000004 24.09 25-29 19.375 28.96 27.925 23.74 30-34 19.915 27.87 27.694999999999997 24.52 35-39 19.84 28.439999999999998 27.955000000000002 23.765 40-44 20.419999999999998 28.255000000000003 27.825 23.5 45-49 19.835 27.839999999999996 28.189999999999998 24.135 50-54 20.0 28.57 27.715 23.715 55-59 19.57 27.925 28.205000000000002 24.3 60-64 19.63 28.18 27.889999999999997 24.3 65-69 20.145 28.73 27.639999999999997 23.485 70-74 20.064999999999998 28.18 27.32 24.435000000000002 75-79 20.535 27.744999999999997 27.72 24.0 80-84 19.585 28.435 27.985 23.995 85-89 20.044999999999998 28.065 28.139999999999997 23.75 90-94 20.57 27.42 27.425 24.585 95-99 19.965 28.59 27.58 23.865 100-104 20.005 28.199999999999996 27.725 24.07 105-109 20.037003700370036 28.06780678067807 27.607760776077605 24.287428742874287 110-114 20.27 27.955000000000002 27.860000000000003 23.915 115-119 20.685000000000002 27.88 27.67 23.765 120-124 20.765 28.349999999999998 27.589999999999996 23.294999999999998 125-129 19.89 27.725 28.134999999999998 24.25 130-134 20.54 28.910000000000004 26.939999999999998 23.61 135-139 20.615 27.860000000000003 27.72 23.805 140-144 20.524104820964194 28.235647129425885 27.38047609521904 23.85977195439088 145-149 20.485 28.939999999999998 26.845000000000002 23.73 150 21.05 28.675 26.875 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 2.5 23 4.0 24 3.0 25 3.5 26 7.0 27 9.5 28 10.0 29 9.5 30 15.5 31 28.0 32 36.5 33 45.5 34 54.0 35 70.5 36 94.5 37 104.5 38 141.0 39 192.0 40 211.0 41 209.0 42 224.0 43 252.0 44 270.5 45 284.5 46 266.0 47 236.5 48 218.5 49 193.5 50 158.5 51 123.0 52 95.0 53 85.5 54 81.0 55 59.5 56 39.5 57 30.5 58 27.5 59 25.0 60 15.0 61 8.0 62 7.5 63 5.5 64 6.5 65 9.5 66 7.0 67 2.5 68 3.0 69 3.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 95.79853862212944 91.77499999999999 2 4.018789144050104 7.7 3 0.18267223382045927 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.037500000000000006 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.0625 0.0 0.0 0.0 0.0 128-129 0.075 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.25 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 75 7.361034E-5 15.359999 115-119 >>END_MODULE SRR14639603 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639603_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.44625 32.0 32.0 32.0 27.0 32.0 2 30.01625 32.0 32.0 32.0 27.0 32.0 3 33.34875 37.0 32.0 37.0 27.0 37.0 4 34.4575 37.0 37.0 37.0 32.0 37.0 5 34.7725 37.0 37.0 37.0 32.0 37.0 6 37.55925 41.0 37.0 41.0 32.0 41.0 7 37.45425 41.0 37.0 41.0 32.0 41.0 8 37.642 41.0 37.0 41.0 27.0 41.0 9 37.917 41.0 37.0 41.0 27.0 41.0 10-14 37.8753 41.0 37.0 41.0 27.0 41.0 15-19 37.7306 41.0 37.0 41.0 27.0 41.0 20-24 37.35124999999999 41.0 37.0 41.0 27.0 41.0 25-29 36.8058 41.0 37.0 41.0 24.0 41.0 30-34 36.8053 41.0 37.0 41.0 25.0 41.0 35-39 37.01115 41.0 37.0 41.0 26.0 41.0 40-44 37.1195 41.0 37.0 41.0 27.0 41.0 45-49 37.03475 41.0 37.0 41.0 26.0 41.0 50-54 36.951049999999995 41.0 37.0 41.0 27.0 41.0 55-59 37.04185 41.0 37.0 41.0 27.0 41.0 60-64 36.84315 41.0 37.0 41.0 26.0 41.0 65-69 36.4631 41.0 37.0 41.0 23.0 41.0 70-74 36.3283 41.0 37.0 41.0 22.0 41.0 75-79 35.71075 40.2 35.0 41.0 22.0 41.0 80-84 36.47865 41.0 37.0 41.0 22.0 41.0 85-89 36.611450000000005 41.0 37.0 41.0 22.0 41.0 90-94 36.337149999999994 41.0 37.0 41.0 22.0 41.0 95-99 36.3267 41.0 37.0 41.0 22.0 41.0 100-104 35.9858 41.0 36.0 41.0 22.0 41.0 105-109 35.94095 41.0 36.0 41.0 22.0 41.0 110-114 35.86355 41.0 35.0 41.0 22.0 41.0 115-119 35.38205 41.0 33.0 41.0 20.0 41.0 120-124 35.52655 41.0 32.0 41.0 22.0 41.0 125-129 35.015 41.0 32.0 41.0 18.0 41.0 130-134 34.990300000000005 41.0 32.0 41.0 22.0 41.0 135-139 34.4736 40.2 31.0 41.0 14.0 41.0 140-144 34.106700000000004 37.0 32.0 41.0 12.0 41.0 145-149 33.771249999999995 37.0 31.0 41.0 12.0 41.0 150 33.38975 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 5.0 16 16.0 17 20.0 18 20.0 19 24.0 20 35.0 21 26.0 22 37.0 23 39.0 24 45.0 25 59.0 26 55.0 27 56.0 28 91.0 29 67.0 30 96.0 31 95.0 32 113.0 33 126.0 34 150.0 35 164.0 36 195.0 37 259.0 38 335.0 39 661.0 40 1211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.45504633107939 26.37114951164538 10.418231905835212 31.755572251440018 2 18.15 27.525 37.625 16.7 3 14.774999999999999 27.200000000000003 36.0 22.025 4 21.45 33.025 24.474999999999998 21.05 5 23.25 36.95 23.425 16.375 6 18.675 36.525 25.025 19.775000000000002 7 18.7 22.05 38.3 20.95 8 16.650000000000002 24.099999999999998 34.2 25.05 9 20.5 24.125 31.4 23.974999999999998 10-14 22.235 28.12 26.745 22.900000000000002 15-19 21.755 28.449999999999996 28.084999999999997 21.709999999999997 20-24 21.634999999999998 28.62 27.845 21.9 25-29 22.715 28.975 26.82 21.490000000000002 30-34 22.495 27.61 27.88 22.015 35-39 21.755 28.335 27.905 22.005 40-44 22.235 27.495000000000005 28.64 21.63 45-49 22.005 27.810000000000002 28.29 21.895 50-54 22.67 27.445000000000004 28.645 21.240000000000002 55-59 22.095000000000002 28.43 27.495000000000005 21.98 60-64 22.56 28.105000000000004 27.38 21.955 65-69 22.470000000000002 28.055000000000003 27.650000000000002 21.825 70-74 22.689999999999998 27.855 27.735 21.72 75-79 22.884999999999998 28.28 26.985 21.85 80-84 23.02 28.04 27.700000000000003 21.240000000000002 85-89 23.31 27.334999999999997 27.605 21.75 90-94 22.805 28.405 27.21 21.58 95-99 23.29 28.405 27.0 21.305 100-104 22.66 28.044999999999998 27.215 22.08 105-109 23.535 28.305000000000003 26.615 21.545 110-114 23.16 28.110000000000003 27.555000000000003 21.175 115-119 23.457345734573458 27.667766776677666 27.102710271027103 21.772177217721772 120-124 23.665 28.29 26.645000000000003 21.4 125-129 23.189999999999998 28.294999999999998 26.815 21.7 130-134 23.53 27.87 26.93 21.67 135-139 23.485 27.705000000000002 27.16 21.65 140-144 23.400000000000002 27.565 27.589999999999996 21.445 145-149 23.18 27.52 27.065 22.235 150 23.5 27.525 27.700000000000003 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 2.0 20 1.0 21 1.0 22 3.0 23 3.0 24 2.0 25 5.0 26 6.0 27 10.0 28 13.0 29 14.0 30 20.0 31 23.0 32 31.0 33 39.0 34 48.5 35 66.5 36 96.5 37 128.0 38 156.5 39 178.0 40 202.0 41 216.0 42 232.5 43 258.5 44 252.0 45 243.5 46 247.5 47 243.5 48 209.5 49 183.0 50 163.0 51 137.5 52 117.0 53 89.5 54 76.0 55 57.0 56 44.0 57 41.5 58 29.5 59 25.5 60 18.5 61 12.0 62 13.0 63 9.5 64 5.5 65 3.0 66 3.5 67 4.0 68 3.0 69 2.5 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.76919100542776 93.60000000000001 2 3.1015766347893514 6.0 3 0.10338588782631171 0.3 4 0.025846471956577927 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.0625 0.0 0.0 0.0 0.0 124-125 0.075 0.0 0.0 0.0 0.0 126-127 0.0875 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.175 0.0 0.0 0.0 0.0 134-135 0.25 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra Read 1164894 spots for SRR14639603.sra Written 1164894 spots for SRR14639603.sra SRR ids: ['SRR14639603.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ufk7a0j4 SRR14639603.sra spots: 23297880 blocks: [[1, 1164894], [1164895, 2329788], [2329789, 3494682], [3494683, 4659576], [4659577, 5824470], [5824471, 6989364], [6989365, 8154258], [8154259, 9319152], [9319153, 10484046], [10484047, 11648940], [11648941, 12813834], [12813835, 13978728], [13978729, 15143622], [15143623, 16308516], [16308517, 17473410], [17473411, 18638304], [18638305, 19803198], [19803199, 20968092], [20968093, 22132986], [22132987, 23297880]] SRR14639603 file size 8624320 SRR14639603 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639603 SRR14639603_1.fastq SRR14639603_2.fastq Input file: SRR14639603_1.fastq Paired file: SRR14639603_2.fastq trimmed: SRR14639603-trimmed-pair1.fastq, SRR14639603-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:21:09 2025 >> started Mon Feb 10 12:21:40 2025 >> done (31.415s) 23297880 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 59 ( 0.00%) empty read pairs filtered out after trimming by size control 23297794 (100.00%) read pairs available; of these: 509614 ( 2.19%) trimmed read pairs available after processing 22788180 (97.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 17 0.00% 21 9 0.00% 22 11 0.00% 23 11 0.00% 24 22 0.00% 25 17 0.00% 26 23 0.00% 27 20 0.00% 28 20 0.00% 29 41 0.00% 30 29 0.00% 31 35 0.00% 32 36 0.00% 33 32 0.00% 34 30 0.00% 35 43 0.00% 36 35 0.00% 37 38 0.00% 38 50 0.00% 39 59 0.00% 40 42 0.00% 41 74 0.00% 42 71 0.00% 43 58 0.00% 44 56 0.00% 45 47 0.00% 46 61 0.00% 47 49 0.00% 48 52 0.00% 49 60 0.00% 50 69 0.00% 51 71 0.00% 52 67 0.00% 53 78 0.00% 54 92 0.00% 55 100 0.00% 56 102 0.00% 57 99 0.00% 58 99 0.00% 59 105 0.00% 60 120 0.00% 61 102 0.00% 62 142 0.00% 63 135 0.00% 64 149 0.00% 65 142 0.00% 66 125 0.00% 67 151 0.00% 68 174 0.00% 69 134 0.00% 70 201 0.00% 71 204 0.00% 72 227 0.00% 73 204 0.00% 74 265 0.00% 75 233 0.00% 76 264 0.00% 77 226 0.00% 78 288 0.00% 79 279 0.00% 80 284 0.00% 81 347 0.00% 82 357 0.00% 83 370 0.00% 84 401 0.00% 85 423 0.00% 86 403 0.00% 87 399 0.00% 88 454 0.00% 89 498 0.00% 90 509 0.00% 91 502 0.00% 92 566 0.00% 93 614 0.00% 94 624 0.00% 95 650 0.00% 96 741 0.00% 97 715 0.00% 98 776 0.00% 99 773 0.00% 100 856 0.00% 101 861 0.00% 102 947 0.00% 103 1002 0.00% 104 1023 0.00% 105 1091 0.00% 106 1106 0.00% 107 1203 0.01% 108 1234 0.01% 109 1387 0.01% 110 1314 0.01% 111 1432 0.01% 112 1395 0.01% 113 1492 0.01% 114 1540 0.01% 115 1626 0.01% 116 1813 0.01% 117 1908 0.01% 118 2006 0.01% 119 2094 0.01% 120 2034 0.01% 121 2120 0.01% 122 2142 0.01% 123 2360 0.01% 124 2380 0.01% 125 2615 0.01% 126 2740 0.01% 127 2780 0.01% 128 2938 0.01% 129 2961 0.01% 130 3028 0.01% 131 3151 0.01% 132 3373 0.01% 133 3416 0.01% 134 3358 0.01% 135 3734 0.02% 136 3727 0.02% 137 3922 0.02% 138 4009 0.02% 139 4230 0.02% 140 4267 0.02% 141 4309 0.02% 142 4686 0.02% 143 4754 0.02% 144 4875 0.02% 145 5067 0.02% 146 5725 0.02% 147 8015 0.03% 148 23813 0.10% 149 339546 1.46% 150 22788180 97.81% 23297794 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.10 fanout-score-rank=16 prefix-density=0.27 prefix-fanout=3.3 sequence=GTTTTCTCATTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=800.62 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=33.5 sequence=TCATCATCACTCAAATCTTGCA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=16 prefix-density=0.39 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=59.23 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=14.7 sequence=CTCTCTCTTTCT SRR14639603 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:22:48 Started mapping on | Feb 10 12:22:51 Finished on | Feb 10 12:30:50 Mapping speed, Million of reads per hour | 175.10 Number of input reads | 23297794 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19203556 Uniquely mapped reads % | 82.43% Average mapped length | 297.27 Number of splices: Total | 16279462 Number of splices: Annotated (sjdb) | 15930000 Number of splices: GT/AG | 16012642 Number of splices: GC/AG | 199262 Number of splices: AT/AC | 14630 Number of splices: Non-canonical | 52928 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 579312 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 27660 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.85% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3514926 3514926 3514926 N_multimapping 579312 579312 579312 N_noFeature 621063 19047998 683074 N_ambiguous 239217 1157 145167 UnstrandedReadsAssigned:18343276 PositiveStrandReadsAssigned:154401 NegativeStrandReadsAssigned:18375315 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639603 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639603-trimmed-pair1.fastq SRR14639603-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,297,794 reads, 18,777,760 reads pseudoaligned [quant] estimated average fragment length: 361.95 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR14639603.ke.tsv 34699 SRR14639603.se.tsv 87100 total ==> SRR14639603.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1657.05 4504 124.659 Potri.005G024800.1.v4.1 1035 674.05 702 47.7647 Potri.004G059700.1.v4.1 961 600.329 209 15.9668 Potri.007G009000.2.v4.1 1416 1055.05 0 0 Potri.003G141000.2.v4.1 2943 2582.05 1005.22 17.855 Potri.016G087400.1.v4.1 270 47.2368 1125 1092.28 Potri.015G069301.1.v4.1 564 230.018 0 0 Potri.010G195200.1.v4.1 1773 1412.05 39 1.26671 Potri.012G127500.1.v4.1 977 616.201 1665 123.924 ==> SRR14639603.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 263 SRR14639603 completed mapping pipeline successfully