Starting /dee2/code/volunteer_pipeline.sh SRR14639604 current disk space = 3058662981632 free memory = 1523689304 SRR14639604 SRAfilesize bb5b3393b2cecfafcb19c76e7751b013 SRR14639604.sra SRR14639604.sra file validated SRR14639604 is paired end SRR14639604 is conventional basespace SRR14639604 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639604_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7075 32.0 32.0 32.0 32.0 32.0 2 31.53375 32.0 32.0 32.0 32.0 32.0 3 35.34125 37.0 32.0 37.0 32.0 37.0 4 36.10375 37.0 37.0 37.0 32.0 37.0 5 36.195 37.0 37.0 37.0 37.0 37.0 6 39.7645 41.0 41.0 41.0 37.0 41.0 7 39.793 41.0 41.0 41.0 37.0 41.0 8 40.1485 41.0 41.0 41.0 37.0 41.0 9 40.1415 41.0 41.0 41.0 37.0 41.0 10-14 40.21405 41.0 41.0 41.0 40.2 41.0 15-19 40.22355 41.0 41.0 41.0 38.6 41.0 20-24 40.152300000000004 41.0 41.0 41.0 37.8 41.0 25-29 40.0148 41.0 41.0 41.0 37.0 41.0 30-34 39.9208 41.0 41.0 41.0 37.0 41.0 35-39 39.734449999999995 41.0 41.0 41.0 37.0 41.0 40-44 39.45184999999999 41.0 41.0 41.0 37.0 41.0 45-49 39.25545 41.0 41.0 41.0 37.0 41.0 50-54 38.93295 41.0 41.0 41.0 37.0 41.0 55-59 38.6641 41.0 38.6 41.0 33.0 41.0 60-64 38.3164 41.0 37.0 41.0 32.0 41.0 65-69 37.699349999999995 41.0 37.0 41.0 29.0 41.0 70-74 36.7539 41.0 37.0 41.0 27.0 41.0 75-79 34.2086 37.6 33.0 40.2 23.0 41.0 80-84 35.58579999999999 39.4 32.0 41.0 22.0 41.0 85-89 35.45235 40.2 32.0 41.0 22.0 41.0 90-94 35.3089 38.6 32.0 41.0 22.0 41.0 95-99 35.31515 38.6 32.0 41.0 22.0 41.0 100-104 35.3806 41.0 32.0 41.0 22.0 41.0 105-109 35.74265 41.0 32.0 41.0 22.0 41.0 110-114 36.02225 41.0 35.0 41.0 22.0 41.0 115-119 36.39355 41.0 37.0 41.0 24.0 41.0 120-124 36.70739999999999 41.0 37.0 41.0 27.0 41.0 125-129 36.9799 41.0 37.0 41.0 27.0 41.0 130-134 36.971250000000005 41.0 37.0 41.0 27.0 41.0 135-139 37.062599999999996 41.0 37.0 41.0 27.0 41.0 140-144 36.9496 41.0 37.0 41.0 27.0 41.0 145-149 36.82345 41.0 37.0 41.0 27.0 41.0 150 36.6825 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 0.0 22 3.0 23 8.0 24 5.0 25 18.0 26 28.0 27 32.0 28 49.0 29 44.0 30 70.0 31 76.0 32 99.0 33 110.0 34 137.0 35 181.0 36 280.0 37 427.0 38 728.0 39 1100.0 40 601.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.21810905452726 12.656328164082039 10.430215107553776 40.69534767383692 2 15.825 12.15 41.9 30.125 3 16.0 17.025000000000002 29.049999999999997 37.925 4 21.5 26.375 24.75 27.375 5 23.375 31.525 27.125 17.974999999999998 6 17.525 34.849999999999994 26.775 20.849999999999998 7 14.924999999999999 27.05 39.050000000000004 18.975 8 15.825 24.7 35.9 23.575 9 16.3 24.25 35.0 24.45 10-14 19.32 28.560000000000002 28.71 23.41 15-19 19.744999999999997 27.735 27.965 24.555 20-24 20.16 27.855 27.860000000000003 24.125 25-29 20.035 28.560000000000002 27.445000000000004 23.96 30-34 20.349999999999998 28.610000000000003 27.48 23.56 35-39 20.405 27.805000000000003 27.63 24.16 40-44 20.549999999999997 28.15 27.705000000000002 23.595 45-49 19.5 27.655 27.950000000000003 24.895 50-54 19.75 28.115000000000002 27.705000000000002 24.43 55-59 20.46 28.15 27.105 24.285 60-64 20.455000000000002 28.065 27.22 24.26 65-69 20.49 27.625 27.700000000000003 24.185000000000002 70-74 20.325 28.215 27.255000000000003 24.205 75-79 20.275000000000002 28.544999999999998 27.27 23.91 80-84 20.810000000000002 27.71 27.075 24.404999999999998 85-89 20.115 27.705000000000002 27.655 24.525 90-94 20.674999999999997 28.060000000000002 27.339999999999996 23.925 95-99 20.91 27.805000000000003 27.485 23.799999999999997 100-104 20.925 28.07 26.919999999999998 24.085 105-109 20.001000050002503 28.131406570328515 27.67638381919096 24.191209560478026 110-114 20.424999999999997 28.194999999999997 27.49 23.89 115-119 20.875 27.67 27.615000000000002 23.84 120-124 20.395 27.87 27.27 24.465 125-129 21.3 27.084999999999997 27.465 24.15 130-134 21.305 28.055000000000003 27.150000000000002 23.49 135-139 21.025 27.79 26.784999999999997 24.4 140-144 20.789157831566314 27.830566113222645 27.030406081216242 24.3498699739948 145-149 20.775 27.845 27.465 23.915 150 21.2 26.875 26.700000000000003 25.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 4.0 21 5.0 22 2.5 23 1.5 24 3.0 25 6.0 26 6.0 27 7.5 28 9.5 29 18.0 30 25.0 31 27.0 32 29.5 33 38.5 34 53.5 35 62.5 36 79.5 37 111.0 38 134.5 39 147.0 40 175.5 41 211.0 42 239.0 43 258.0 44 250.0 45 260.0 46 247.5 47 213.0 48 196.5 49 186.5 50 182.0 51 145.0 52 111.5 53 97.0 54 83.0 55 72.0 56 61.5 57 50.0 58 38.0 59 28.0 60 24.5 61 19.5 62 17.0 63 14.5 64 11.0 65 8.5 66 7.5 67 6.5 68 3.0 69 2.0 70 2.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.95617010174797 91.95 2 3.8351160970519174 7.35 3 0.15653535090007828 0.44999999999999996 4 0.0 0.0 5 0.05217845030002609 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATG 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) ATGATCAAACTTACCACCCTGCAAATTACGGTGAAGAGATGTGAATGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.037500000000000006 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.0875 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.125 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.1875 0.0 0.0 0.0 0.0 136-137 0.21250000000000002 0.0 0.0 0.0 0.0 138 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639604 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639604_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.27 32.0 32.0 32.0 27.0 32.0 2 30.01125 32.0 32.0 32.0 27.0 32.0 3 33.07625 37.0 32.0 37.0 27.0 37.0 4 34.27 37.0 37.0 37.0 27.0 37.0 5 34.81875 37.0 37.0 37.0 32.0 37.0 6 37.443 41.0 37.0 41.0 32.0 41.0 7 37.24325 41.0 37.0 41.0 27.0 41.0 8 37.42575 41.0 37.0 41.0 27.0 41.0 9 37.83525 41.0 37.0 41.0 27.0 41.0 10-14 37.747249999999994 41.0 37.0 41.0 28.0 41.0 15-19 37.51225000000001 41.0 37.0 41.0 27.0 41.0 20-24 37.0122 41.0 37.0 41.0 26.0 41.0 25-29 36.45595 41.0 37.0 41.0 24.0 41.0 30-34 36.427550000000004 41.0 37.0 41.0 22.0 41.0 35-39 36.77645 41.0 37.0 41.0 26.0 41.0 40-44 36.79015 41.0 37.0 41.0 25.0 41.0 45-49 36.74525 41.0 37.0 41.0 25.0 41.0 50-54 36.61475 41.0 37.0 41.0 24.0 41.0 55-59 36.6135 41.0 37.0 41.0 24.0 41.0 60-64 36.53705 41.0 37.0 41.0 23.0 41.0 65-69 36.304500000000004 41.0 37.0 41.0 22.0 41.0 70-74 36.16875 41.0 37.0 41.0 23.0 41.0 75-79 35.37715 40.2 34.0 41.0 22.0 41.0 80-84 36.3505 41.0 37.0 41.0 22.0 41.0 85-89 36.3386 41.0 37.0 41.0 22.0 41.0 90-94 36.0433 41.0 37.0 41.0 22.0 41.0 95-99 36.12645 41.0 37.0 41.0 22.0 41.0 100-104 35.798950000000005 41.0 35.0 41.0 20.0 41.0 105-109 35.73774999999999 41.0 33.0 41.0 22.0 41.0 110-114 35.65454999999999 41.0 33.0 41.0 22.0 41.0 115-119 35.254999999999995 41.0 32.0 41.0 20.0 41.0 120-124 35.25335 41.0 32.0 41.0 20.0 41.0 125-129 34.77285 40.2 32.0 41.0 16.0 41.0 130-134 34.602050000000006 41.0 32.0 41.0 12.0 41.0 135-139 34.25695 38.6 30.0 41.0 16.0 41.0 140-144 33.94775 37.0 32.0 41.0 12.0 41.0 145-149 33.73479999999999 37.0 31.0 41.0 12.0 41.0 150 33.26975 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 3.0 16 9.0 17 14.0 18 22.0 19 32.0 20 33.0 21 31.0 22 49.0 23 50.0 24 48.0 25 62.0 26 54.0 27 73.0 28 77.0 29 81.0 30 99.0 31 102.0 32 126.0 33 112.0 34 135.0 35 182.0 36 220.0 37 272.0 38 370.0 39 572.0 40 1167.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.980966691710496 26.496368645128975 9.466566491359881 32.05609817180065 2 19.325 28.000000000000004 35.775 16.900000000000002 3 16.35 25.5 34.2 23.95 4 21.475 33.425 23.575 21.525 5 23.674999999999997 36.825 23.200000000000003 16.3 6 19.0 36.175000000000004 24.125 20.7 7 19.925 21.9 35.975 22.2 8 17.974999999999998 23.275000000000002 31.825 26.924999999999997 9 19.325 26.375 29.575000000000003 24.725 10-14 21.94 28.275 26.8 22.985 15-19 22.12 27.77 27.3 22.81 20-24 22.405 28.43 27.04 22.125 25-29 22.165000000000003 28.76 26.82 22.255 30-34 21.91 28.58 26.834999999999997 22.675 35-39 22.355 27.800000000000004 27.47 22.375 40-44 22.775000000000002 27.694999999999997 27.51 22.02 45-49 22.645 27.865000000000002 27.785 21.705 50-54 22.7 27.22 27.779999999999998 22.3 55-59 22.665 27.525 27.224999999999998 22.585 60-64 22.939999999999998 27.985 26.345000000000002 22.73 65-69 22.759999999999998 27.615000000000002 27.715 21.91 70-74 22.97 28.185 26.700000000000003 22.145 75-79 23.27 28.1 26.8 21.83 80-84 23.244999999999997 27.250000000000004 27.229999999999997 22.275 85-89 23.419999999999998 27.944999999999997 26.595000000000002 22.040000000000003 90-94 22.56 27.675 27.215 22.55 95-99 23.02 27.87 27.115000000000002 21.995 100-104 23.119999999999997 27.735 26.665 22.48 105-109 22.79 27.71 27.315 22.185 110-114 23.485 27.3 26.96 22.255 115-119 23.21 27.51 26.955000000000002 22.325 120-124 23.205000000000002 27.625 27.169999999999998 22.0 125-129 23.62 27.73 26.345000000000002 22.305 130-134 23.94 27.46 26.575 22.025 135-139 23.695 27.205000000000002 26.595000000000002 22.505 140-144 24.285 27.48 26.724999999999998 21.51 145-149 23.34 28.199999999999996 26.235000000000003 22.225 150 24.175 28.7 26.200000000000003 20.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 2.0 20 2.0 21 1.0 22 1.5 23 3.0 24 4.0 25 3.5 26 3.0 27 5.5 28 11.0 29 17.5 30 19.0 31 19.0 32 27.5 33 40.0 34 45.0 35 60.0 36 82.0 37 98.0 38 114.0 39 134.5 40 172.0 41 215.5 42 251.0 43 249.0 44 244.0 45 255.0 46 251.5 47 227.0 48 197.0 49 193.5 50 184.0 51 149.5 52 127.0 53 121.5 54 99.0 55 71.0 56 61.5 57 54.0 58 41.0 59 31.0 60 24.5 61 19.0 62 13.0 63 11.0 64 11.0 65 10.0 66 6.5 67 2.5 68 2.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.70728545501686 93.25 2 3.0593725693544207 5.8999999999999995 3 0.155561317085818 0.44999999999999996 4 0.0 0.0 5 0.051853772361939325 0.25 6 0.025926886180969663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCTC 6 0.15 Illumina Single End PCR Primer 1 (96% over 33bp) GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit CCTCAACACACTTGCAGGAAGATCTTACAATGACTTAACACAGTATCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.0625 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.075 0.0 0.0 0.0 0.0 122-123 0.1125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.125 0.0 0.0 0.0 0.0 128-129 0.125 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.2 0.0 0.0 0.0 0.0 134-135 0.21250000000000002 0.0 0.0 0.0 0.0 136-137 0.225 0.0 0.0 0.0 0.0 138 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTAAA 10 0.0069754543 143.9875 6 >>END_MODULE Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871312 spots for SRR14639604.sra Written 871312 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra Read 871301 spots for SRR14639604.sra Written 871301 spots for SRR14639604.sra SRR ids: ['SRR14639604.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p9xzvl3w SRR14639604.sra spots: 17426031 blocks: [[1, 871301], [871302, 1742602], [1742603, 2613903], [2613904, 3485204], [3485205, 4356505], [4356506, 5227806], [5227807, 6099107], [6099108, 6970408], [6970409, 7841709], [7841710, 8713010], [8713011, 9584311], [9584312, 10455612], [10455613, 11326913], [11326914, 12198214], [12198215, 13069515], [13069516, 13940816], [13940817, 14812117], [14812118, 15683418], [15683419, 16554719], [16554720, 17426031]] SRR14639604 file size 6447933 SRR14639604 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639604 SRR14639604_1.fastq SRR14639604_2.fastq Input file: SRR14639604_1.fastq Paired file: SRR14639604_2.fastq trimmed: SRR14639604-trimmed-pair1.fastq, SRR14639604-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:33:23 2025 >> started Mon Feb 10 12:33:51 2025 >> done (28.504s) 17426031 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 90 ( 0.00%) empty read pairs filtered out after trimming by size control 17425897 (100.00%) read pairs available; of these: 379760 ( 2.18%) trimmed read pairs available after processing 17046137 (97.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 9 0.00% 21 7 0.00% 22 8 0.00% 23 20 0.00% 24 21 0.00% 25 25 0.00% 26 22 0.00% 27 30 0.00% 28 24 0.00% 29 27 0.00% 30 38 0.00% 31 37 0.00% 32 30 0.00% 33 56 0.00% 34 41 0.00% 35 43 0.00% 36 38 0.00% 37 41 0.00% 38 47 0.00% 39 39 0.00% 40 52 0.00% 41 41 0.00% 42 59 0.00% 43 44 0.00% 44 53 0.00% 45 55 0.00% 46 55 0.00% 47 52 0.00% 48 66 0.00% 49 67 0.00% 50 61 0.00% 51 75 0.00% 52 70 0.00% 53 64 0.00% 54 86 0.00% 55 90 0.00% 56 89 0.00% 57 73 0.00% 58 96 0.00% 59 95 0.00% 60 105 0.00% 61 91 0.00% 62 110 0.00% 63 112 0.00% 64 103 0.00% 65 113 0.00% 66 103 0.00% 67 142 0.00% 68 132 0.00% 69 138 0.00% 70 136 0.00% 71 136 0.00% 72 168 0.00% 73 127 0.00% 74 164 0.00% 75 150 0.00% 76 142 0.00% 77 165 0.00% 78 165 0.00% 79 188 0.00% 80 208 0.00% 81 153 0.00% 82 209 0.00% 83 176 0.00% 84 224 0.00% 85 250 0.00% 86 217 0.00% 87 243 0.00% 88 245 0.00% 89 275 0.00% 90 258 0.00% 91 277 0.00% 92 303 0.00% 93 327 0.00% 94 342 0.00% 95 342 0.00% 96 369 0.00% 97 385 0.00% 98 373 0.00% 99 415 0.00% 100 399 0.00% 101 404 0.00% 102 399 0.00% 103 456 0.00% 104 526 0.00% 105 521 0.00% 106 590 0.00% 107 591 0.00% 108 541 0.00% 109 616 0.00% 110 640 0.00% 111 681 0.00% 112 682 0.00% 113 692 0.00% 114 781 0.00% 115 816 0.00% 116 866 0.00% 117 949 0.01% 118 899 0.01% 119 941 0.01% 120 1000 0.01% 121 1002 0.01% 122 1112 0.01% 123 1120 0.01% 124 1094 0.01% 125 1233 0.01% 126 1328 0.01% 127 1370 0.01% 128 1269 0.01% 129 1453 0.01% 130 1494 0.01% 131 1525 0.01% 132 1602 0.01% 133 1606 0.01% 134 1675 0.01% 135 1722 0.01% 136 1840 0.01% 137 1913 0.01% 138 1953 0.01% 139 2061 0.01% 140 2093 0.01% 141 2190 0.01% 142 2228 0.01% 143 2311 0.01% 144 2497 0.01% 145 2633 0.02% 146 3079 0.02% 147 5088 0.03% 148 18802 0.11% 149 286233 1.64% 150 17046137 97.82% 17425897 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.51 fanout-score-rank=16 prefix-density=0.35 prefix-fanout=2.7 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=20.72 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=7.0 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=13 prefix-density=0.35 prefix-fanout=2.7 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=14 fanout-score=12.94 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=6.6 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR14639604 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:35:01 Started mapping on | Feb 10 12:35:01 Finished on | Feb 10 12:43:49 Mapping speed, Million of reads per hour | 118.81 Number of input reads | 17425897 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13163888 Uniquely mapped reads % | 75.54% Average mapped length | 297.18 Number of splices: Total | 11517551 Number of splices: Annotated (sjdb) | 11274020 Number of splices: GT/AG | 11324545 Number of splices: GC/AG | 146844 Number of splices: AT/AC | 10326 Number of splices: Non-canonical | 35836 Mismatch rate per base, % | 0.63% Deletion rate per base | 0.03% Deletion average length | 3.03 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366930 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 16203 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 22.14% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3895079 3895079 3895079 N_multimapping 366930 366930 366930 N_noFeature 429919 13048651 477052 N_ambiguous 164966 854 96406 UnstrandedReadsAssigned:12569003 PositiveStrandReadsAssigned:114383 NegativeStrandReadsAssigned:12590430 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639604 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639604-trimmed-pair1.fastq SRR14639604-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,425,897 reads, 12,881,749 reads pseudoaligned [quant] estimated average fragment length: 374.735 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR14639604.ke.tsv 34699 SRR14639604.se.tsv 87100 total ==> SRR14639604.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1644.26 1980 82.9988 Potri.005G024800.1.v4.1 1035 661.265 187 19.4915 Potri.004G059700.1.v4.1 961 587.639 107 12.5502 Potri.007G009000.2.v4.1 1416 1042.26 0 0 Potri.003G141000.2.v4.1 2943 2569.26 635.611 17.0514 Potri.016G087400.1.v4.1 270 44.2053 821 1280.11 Potri.015G069301.1.v4.1 564 222.434 0 0 Potri.010G195200.1.v4.1 1773 1399.26 37 1.82255 Potri.012G127500.1.v4.1 977 603.484 1570 179.313 ==> SRR14639604.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 42 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 213 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 215 SRR14639604 completed mapping pipeline successfully