Starting /dee2/code/volunteer_pipeline.sh SRR14639605 current disk space = 3058812444672 free memory = 1230932228 SRR14639605 SRAfilesize f6de66e95e13d9369d246cabfea05e1e SRR14639605.sra SRR14639605.sra file validated SRR14639605 is paired end SRR14639605 is conventional basespace SRR14639605 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639605_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66125 32.0 32.0 32.0 32.0 32.0 2 31.56875 32.0 32.0 32.0 32.0 32.0 3 35.245 37.0 32.0 37.0 32.0 37.0 4 36.16875 37.0 37.0 37.0 32.0 37.0 5 36.3275 37.0 37.0 37.0 37.0 37.0 6 39.8515 41.0 41.0 41.0 37.0 41.0 7 39.89325 41.0 41.0 41.0 37.0 41.0 8 40.01775 41.0 41.0 41.0 37.0 41.0 9 40.118 41.0 41.0 41.0 37.0 41.0 10-14 40.19375 41.0 41.0 41.0 37.8 41.0 15-19 40.223400000000005 41.0 41.0 41.0 38.6 41.0 20-24 40.16925 41.0 41.0 41.0 37.0 41.0 25-29 40.08285 41.0 41.0 41.0 37.0 41.0 30-34 39.95335 41.0 41.0 41.0 37.0 41.0 35-39 39.76315 41.0 41.0 41.0 37.0 41.0 40-44 39.5612 41.0 41.0 41.0 37.0 41.0 45-49 39.34755 41.0 41.0 41.0 37.0 41.0 50-54 39.04585000000001 41.0 41.0 41.0 37.0 41.0 55-59 38.7344 41.0 40.2 41.0 34.0 41.0 60-64 38.39375 41.0 37.0 41.0 32.0 41.0 65-69 37.7824 41.0 37.0 41.0 30.0 41.0 70-74 36.85289999999999 41.0 37.0 41.0 27.0 41.0 75-79 34.3501 37.6 33.0 40.2 24.0 41.0 80-84 35.69395 40.2 32.0 41.0 22.0 41.0 85-89 35.64675 40.2 32.0 41.0 23.0 41.0 90-94 35.32535 38.6 32.0 41.0 22.0 41.0 95-99 35.2835 37.8 32.0 41.0 22.0 41.0 100-104 35.493649999999995 40.2 32.0 41.0 22.0 41.0 105-109 35.79795 41.0 32.0 41.0 22.0 41.0 110-114 36.24555 41.0 35.0 41.0 24.0 41.0 115-119 36.63385 41.0 37.0 41.0 26.0 41.0 120-124 36.76525 41.0 37.0 41.0 27.0 41.0 125-129 37.235749999999996 41.0 37.0 41.0 27.0 41.0 130-134 37.0524 41.0 37.0 41.0 27.0 41.0 135-139 37.14985 41.0 37.0 41.0 27.0 41.0 140-144 37.06824999999999 41.0 37.0 41.0 27.0 41.0 145-149 36.997550000000004 41.0 37.0 41.0 27.0 41.0 150 36.878 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 2.0 22 1.0 23 6.0 24 13.0 25 14.0 26 22.0 27 27.0 28 25.0 29 53.0 30 56.0 31 68.0 32 93.0 33 115.0 34 151.0 35 189.0 36 289.0 37 424.0 38 745.0 39 1109.0 40 595.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.1090272568142 13.703425856464117 10.277569392348088 39.90997749437359 2 15.8 12.2 43.875 28.125 3 16.825000000000003 18.4 28.799999999999997 35.975 4 20.775 25.6 26.05 27.575 5 22.025 32.5 27.025 18.45 6 17.724999999999998 33.1 28.849999999999998 20.325 7 15.25 27.725 39.574999999999996 17.45 8 15.675 22.95 38.4 22.975 9 15.775 24.825 34.699999999999996 24.7 10-14 19.39 28.470000000000002 28.544999999999998 23.595 15-19 19.63 28.09 28.095 24.185000000000002 20-24 19.78 27.97 27.87 24.38 25-29 19.195 28.835 27.775 24.195 30-34 19.814999999999998 28.349999999999998 27.555000000000003 24.279999999999998 35-39 19.215 27.815 28.544999999999998 24.425 40-44 20.03 27.865000000000002 28.549999999999997 23.555 45-49 19.595000000000002 28.32 27.76 24.325 50-54 19.355 28.810000000000002 27.66 24.175 55-59 19.875 28.12 28.26 23.745 60-64 19.605 27.405 28.175 24.815 65-69 20.65 28.12 27.485 23.745 70-74 19.900000000000002 28.189999999999998 27.855 24.055 75-79 20.285 28.76 27.42 23.535 80-84 20.49 28.749999999999996 27.115000000000002 23.645 85-89 20.055 29.235 27.54 23.169999999999998 90-94 20.325 28.43 27.495000000000005 23.75 95-99 20.335 27.96 27.71 23.995 100-104 20.025000000000002 29.439999999999998 26.840000000000003 23.695 105-109 20.49 28.535 27.584999999999997 23.39 110-114 20.445 28.384999999999998 27.544999999999998 23.625 115-119 20.45 28.244999999999997 27.775 23.53 120-124 20.73 28.28 27.555000000000003 23.435 125-129 20.474999999999998 28.07 27.68 23.775 130-134 20.599999999999998 28.365000000000002 27.41 23.625 135-139 20.285 28.555000000000003 27.775 23.385 140-144 21.227122712271225 27.987798779877988 27.07270727072707 23.712371237123712 145-149 20.325 28.32 27.6 23.755000000000003 150 20.225 27.675 28.325 23.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 1.0 21 0.5 22 1.5 23 4.0 24 6.5 25 7.0 26 5.0 27 8.0 28 14.0 29 17.0 30 18.5 31 27.5 32 43.0 33 53.5 34 59.5 35 72.0 36 92.5 37 108.0 38 130.0 39 162.5 40 192.5 41 217.0 42 245.5 43 266.0 44 272.5 45 260.0 46 243.0 47 236.5 48 208.5 49 172.0 50 150.5 51 130.5 52 108.0 53 92.5 54 76.5 55 59.0 56 40.0 57 36.0 58 37.5 59 22.5 60 15.0 61 16.5 62 14.0 63 11.0 64 8.5 65 8.0 66 8.0 67 6.0 68 2.5 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.6 #Duplication Level Percentage of deduplicated Percentage of total 1 95.55439330543933 91.35 2 4.288702928870293 8.200000000000001 3 0.15690376569037656 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.075 0.0 0.0 0.0 0.0 124-125 0.075 0.0 0.0 0.0 0.0 126-127 0.075 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.1375 0.0 0.0 0.0 0.0 132-133 0.16249999999999998 0.0 0.0 0.0 0.0 134-135 0.175 0.0 0.0 0.0 0.0 136-137 0.1875 0.0 0.0 0.0 0.0 138 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR14639605 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639605_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3575 32.0 32.0 32.0 27.0 32.0 2 29.995 32.0 32.0 32.0 27.0 32.0 3 33.04875 37.0 32.0 37.0 27.0 37.0 4 34.2875 37.0 37.0 37.0 27.0 37.0 5 34.765 37.0 37.0 37.0 32.0 37.0 6 37.3855 41.0 37.0 41.0 32.0 41.0 7 37.2305 41.0 37.0 41.0 27.0 41.0 8 37.396 41.0 37.0 41.0 27.0 41.0 9 37.81475 41.0 37.0 41.0 27.0 41.0 10-14 37.77740000000001 41.0 37.0 41.0 28.0 41.0 15-19 37.50425 41.0 37.0 41.0 27.0 41.0 20-24 37.05245 41.0 37.0 41.0 27.0 41.0 25-29 36.5344 41.0 37.0 41.0 25.0 41.0 30-34 36.6122 41.0 37.0 41.0 22.0 41.0 35-39 36.864599999999996 41.0 37.0 41.0 25.0 41.0 40-44 36.79995 41.0 37.0 41.0 25.0 41.0 45-49 36.83245 41.0 37.0 41.0 26.0 41.0 50-54 36.580600000000004 41.0 37.0 41.0 23.0 41.0 55-59 36.557449999999996 41.0 37.0 41.0 22.0 41.0 60-64 36.5674 41.0 37.0 41.0 24.0 41.0 65-69 36.272999999999996 41.0 37.0 41.0 22.0 41.0 70-74 36.0519 41.0 37.0 41.0 22.0 41.0 75-79 35.3389 40.2 34.0 41.0 22.0 41.0 80-84 36.243849999999995 41.0 37.0 41.0 22.0 41.0 85-89 36.4222 41.0 37.0 41.0 22.0 41.0 90-94 35.943 41.0 37.0 41.0 22.0 41.0 95-99 36.009750000000004 41.0 37.0 41.0 22.0 41.0 100-104 35.83399999999999 41.0 35.0 41.0 20.0 41.0 105-109 35.6866 41.0 34.0 41.0 22.0 41.0 110-114 35.6291 41.0 33.0 41.0 22.0 41.0 115-119 35.340250000000005 41.0 32.0 41.0 20.0 41.0 120-124 35.2999 41.0 32.0 41.0 22.0 41.0 125-129 34.647850000000005 40.2 32.0 41.0 16.0 41.0 130-134 34.68775000000001 41.0 32.0 41.0 18.0 41.0 135-139 34.1271 39.4 30.0 41.0 14.0 41.0 140-144 33.80765 37.0 31.0 41.0 12.0 41.0 145-149 33.566449999999996 37.0 30.0 41.0 12.0 41.0 150 33.20875 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 8.0 17 20.0 18 33.0 19 32.0 20 37.0 21 40.0 22 32.0 23 53.0 24 43.0 25 55.0 26 60.0 27 73.0 28 76.0 29 109.0 30 85.0 31 111.0 32 101.0 33 116.0 34 141.0 35 176.0 36 193.0 37 249.0 38 363.0 39 610.0 40 1180.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.636591478696744 26.71679197994987 8.571428571428571 30.075187969924812 2 18.45 28.000000000000004 37.574999999999996 15.975 3 16.5 27.6 34.675 21.224999999999998 4 23.1 33.275 23.775 19.85 5 22.575 37.7 22.775000000000002 16.950000000000003 6 18.625 37.574999999999996 24.0 19.8 7 19.725 22.075 36.3 21.9 8 16.900000000000002 24.7 32.75 25.650000000000002 9 18.975 24.925 30.85 25.25 10-14 22.040000000000003 28.565 26.700000000000003 22.695 15-19 21.89 27.215 28.16 22.735 20-24 22.02 28.360000000000003 27.605 22.015 25-29 22.455 27.955000000000002 27.74 21.85 30-34 21.69 28.389999999999997 27.925 21.995 35-39 22.555 27.939999999999998 27.51 21.995 40-44 22.17 27.87 27.705000000000002 22.255 45-49 22.32 28.185 27.52 21.975 50-54 22.75 27.775 27.11 22.365 55-59 22.36 27.61 28.15 21.88 60-64 22.415 27.855 27.615000000000002 22.115000000000002 65-69 22.445 27.305 27.61 22.64 70-74 22.79 27.965 27.32 21.925 75-79 23.32 27.93 27.565 21.185000000000002 80-84 22.900000000000002 27.71 27.065 22.325 85-89 22.64 28.189999999999998 27.215 21.955 90-94 23.075000000000003 27.800000000000004 27.474999999999998 21.65 95-99 22.67 27.224999999999998 28.025 22.08 100-104 23.51 27.92 27.185 21.385 105-109 23.255 27.605 27.665 21.475 110-114 23.0 28.125 27.284999999999997 21.59 115-119 23.325000000000003 28.03 27.450000000000003 21.195 120-124 23.275000000000002 27.375 27.384999999999998 21.965 125-129 22.97 28.000000000000004 26.695 22.335 130-134 23.7 28.000000000000004 26.939999999999998 21.36 135-139 23.02 27.584999999999997 27.375 22.02 140-144 23.385 27.500000000000004 27.275 21.84 145-149 23.3 27.665 26.915 22.12 150 22.55 28.65 28.000000000000004 20.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 1.5 18 1.5 19 1.5 20 2.5 21 1.5 22 2.0 23 1.5 24 2.0 25 5.0 26 6.5 27 9.0 28 12.0 29 15.0 30 20.0 31 30.5 32 33.5 33 34.0 34 52.5 35 65.5 36 78.5 37 106.0 38 135.0 39 171.5 40 186.0 41 206.5 42 223.0 43 233.0 44 268.0 45 265.5 46 254.5 47 245.0 48 207.5 49 179.0 50 154.5 51 131.0 52 126.0 53 110.5 54 89.5 55 75.0 56 59.0 57 42.0 58 33.5 59 27.5 60 17.0 61 17.5 62 15.5 63 9.5 64 7.5 65 5.5 66 5.0 67 2.5 68 1.0 69 2.0 70 1.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.42208970702619 92.975 2 3.4482758620689653 6.65 3 0.12963443090484833 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0125 0.0 0.0 0.0 96-97 0.025 0.025 0.0 0.0 0.0 98-99 0.05 0.025 0.0 0.0 0.0 100-101 0.05 0.025 0.0 0.0 0.0 102-103 0.05 0.025 0.0 0.0 0.0 104-105 0.05 0.025 0.0 0.0 0.0 106-107 0.05 0.025 0.0 0.0 0.0 108-109 0.05 0.025 0.0 0.0 0.0 110-111 0.05 0.025 0.0 0.0 0.0 112-113 0.05 0.025 0.0 0.0 0.0 114-115 0.05 0.025 0.0 0.0 0.0 116-117 0.075 0.025 0.0 0.0 0.0 118-119 0.075 0.025 0.0 0.0 0.0 120-121 0.075 0.025 0.0 0.0 0.0 122-123 0.075 0.025 0.0 0.0 0.0 124-125 0.075 0.025 0.0 0.0 0.0 126-127 0.075 0.025 0.0 0.0 0.0 128-129 0.075 0.025 0.0 0.0 0.0 130-131 0.0875 0.025 0.0 0.0 0.0 132-133 0.1125 0.025 0.0 0.0 0.0 134-135 0.15 0.025 0.0 0.0 0.0 136-137 0.1875 0.025 0.0 0.0 0.0 138 0.225 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCCA 10 0.006973645 144.0 4 AGGCCAA 10 0.006973645 144.0 5 CCCCCCC 20 0.006139246 28.8 45-49 >>END_MODULE Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra Read 982660 spots for SRR14639605.sra Written 982660 spots for SRR14639605.sra Read 982657 spots for SRR14639605.sra Written 982657 spots for SRR14639605.sra SRR ids: ['SRR14639605.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dh_50skr SRR14639605.sra spots: 19653143 blocks: [[1, 982657], [982658, 1965314], [1965315, 2947971], [2947972, 3930628], [3930629, 4913285], [4913286, 5895942], [5895943, 6878599], [6878600, 7861256], [7861257, 8843913], [8843914, 9826570], [9826571, 10809227], [10809228, 11791884], [11791885, 12774541], [12774542, 13757198], [13757199, 14739855], [14739856, 15722512], [15722513, 16705169], [16705170, 17687826], [17687827, 18670483], [18670484, 19653143]] SRR14639605 file size 7273384 SRR14639605 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639605 SRR14639605_1.fastq SRR14639605_2.fastq Input file: SRR14639605_1.fastq Paired file: SRR14639605_2.fastq trimmed: SRR14639605-trimmed-pair1.fastq, SRR14639605-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:26:10 2025 >> started Mon Feb 10 12:26:35 2025 >> done (24.401s) 19653143 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 81 ( 0.00%) empty read pairs filtered out after trimming by size control 19653027 (100.00%) read pairs available; of these: 424173 ( 2.16%) trimmed read pairs available after processing 19228854 (97.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 7 0.00% 21 9 0.00% 22 9 0.00% 23 11 0.00% 24 13 0.00% 25 23 0.00% 26 18 0.00% 27 22 0.00% 28 19 0.00% 29 18 0.00% 30 21 0.00% 31 24 0.00% 32 26 0.00% 33 24 0.00% 34 32 0.00% 35 39 0.00% 36 28 0.00% 37 36 0.00% 38 39 0.00% 39 40 0.00% 40 37 0.00% 41 45 0.00% 42 48 0.00% 43 51 0.00% 44 41 0.00% 45 40 0.00% 46 53 0.00% 47 32 0.00% 48 36 0.00% 49 54 0.00% 50 83 0.00% 51 49 0.00% 52 57 0.00% 53 68 0.00% 54 71 0.00% 55 72 0.00% 56 73 0.00% 57 67 0.00% 58 77 0.00% 59 93 0.00% 60 76 0.00% 61 90 0.00% 62 110 0.00% 63 107 0.00% 64 87 0.00% 65 100 0.00% 66 101 0.00% 67 113 0.00% 68 127 0.00% 69 120 0.00% 70 118 0.00% 71 143 0.00% 72 142 0.00% 73 158 0.00% 74 149 0.00% 75 196 0.00% 76 172 0.00% 77 159 0.00% 78 181 0.00% 79 210 0.00% 80 198 0.00% 81 213 0.00% 82 226 0.00% 83 221 0.00% 84 254 0.00% 85 254 0.00% 86 277 0.00% 87 298 0.00% 88 310 0.00% 89 284 0.00% 90 313 0.00% 91 349 0.00% 92 362 0.00% 93 366 0.00% 94 370 0.00% 95 399 0.00% 96 427 0.00% 97 471 0.00% 98 449 0.00% 99 505 0.00% 100 505 0.00% 101 572 0.00% 102 557 0.00% 103 591 0.00% 104 608 0.00% 105 693 0.00% 106 772 0.00% 107 751 0.00% 108 752 0.00% 109 798 0.00% 110 838 0.00% 111 838 0.00% 112 944 0.00% 113 917 0.00% 114 978 0.00% 115 1068 0.01% 116 1138 0.01% 117 1138 0.01% 118 1217 0.01% 119 1299 0.01% 120 1361 0.01% 121 1383 0.01% 122 1384 0.01% 123 1586 0.01% 124 1684 0.01% 125 1680 0.01% 126 1785 0.01% 127 1898 0.01% 128 1835 0.01% 129 1986 0.01% 130 2053 0.01% 131 2082 0.01% 132 2105 0.01% 133 2263 0.01% 134 2320 0.01% 135 2514 0.01% 136 2533 0.01% 137 2694 0.01% 138 2793 0.01% 139 2893 0.01% 140 2902 0.01% 141 3156 0.02% 142 3273 0.02% 143 3355 0.02% 144 3393 0.02% 145 3655 0.02% 146 4136 0.02% 147 6470 0.03% 148 21491 0.11% 149 303720 1.55% 150 19228854 97.84% 19653027 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=18 prefix-density=0.36 prefix-fanout=2.6 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=29.64 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.3 sequence=CCACCACCGCCGCTTCCGCGGGATTGTGCTTCATTCACGGTGATGTTACGCCCATCAAGGTCTTGGCCGTTCATTCCATCAATCGCATCTCTCATTGCCTTCTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=21 prefix-density=0.37 prefix-fanout=2.7 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=172.89 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.1 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTC SRR14639605 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:27:31 Started mapping on | Feb 10 12:27:31 Finished on | Feb 10 12:33:56 Mapping speed, Million of reads per hour | 183.77 Number of input reads | 19653027 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16107244 Uniquely mapped reads % | 81.96% Average mapped length | 297.17 Number of splices: Total | 13753650 Number of splices: Annotated (sjdb) | 13469556 Number of splices: GT/AG | 13526847 Number of splices: GC/AG | 171071 Number of splices: AT/AC | 12279 Number of splices: Non-canonical | 43453 Mismatch rate per base, % | 0.63% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 464547 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 18105 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.48% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3081236 3081236 3081236 N_multimapping 464547 464547 464547 N_noFeature 537330 15978413 587451 N_ambiguous 201706 989 122518 UnstrandedReadsAssigned:15368208 PositiveStrandReadsAssigned:127842 NegativeStrandReadsAssigned:15397275 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639605 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639605-trimmed-pair1.fastq SRR14639605-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,653,027 reads, 15,850,316 reads pseudoaligned [quant] estimated average fragment length: 367.484 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR14639605.ke.tsv 34699 SRR14639605.se.tsv 87100 total ==> SRR14639605.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1651.52 2888.66 97.7131 Potri.005G024800.1.v4.1 1035 668.516 335 27.9944 Potri.004G059700.1.v4.1 961 595.034 124 11.6418 Potri.007G009000.2.v4.1 1416 1049.52 0 0 Potri.003G141000.2.v4.1 2943 2576.52 892.222 19.3454 Potri.016G087400.1.v4.1 270 46.1166 908 1099.94 Potri.015G069301.1.v4.1 564 227.221 0 0 Potri.010G195200.1.v4.1 1773 1406.52 34 1.35043 Potri.012G127500.1.v4.1 977 610.773 1711 156.498 ==> SRR14639605.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 92 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 239 SRR14639605 completed mapping pipeline successfully