Starting /dee2/code/volunteer_pipeline.sh SRR14639606 current disk space = 3058740760576 free memory = 1545464080 SRR14639606 SRAfilesize 48eccd0de83e81d984b2ca36f045f78f SRR14639606.sra SRR14639606.sra file validated SRR14639606 is paired end SRR14639606 is conventional basespace SRR14639606 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639606_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.58125 32.0 32.0 32.0 32.0 32.0 2 31.49 32.0 32.0 32.0 32.0 32.0 3 35.13375 37.0 32.0 37.0 32.0 37.0 4 36.07375 37.0 37.0 37.0 32.0 37.0 5 36.085 37.0 37.0 37.0 37.0 37.0 6 39.723 41.0 41.0 41.0 37.0 41.0 7 39.75975 41.0 41.0 41.0 37.0 41.0 8 39.85675 41.0 41.0 41.0 37.0 41.0 9 40.0145 41.0 41.0 41.0 37.0 41.0 10-14 40.1084 41.0 41.0 41.0 37.0 41.0 15-19 40.101699999999994 41.0 41.0 41.0 37.0 41.0 20-24 40.07195 41.0 41.0 41.0 37.0 41.0 25-29 40.00125 41.0 41.0 41.0 37.0 41.0 30-34 39.912349999999996 41.0 41.0 41.0 37.0 41.0 35-39 39.731500000000004 41.0 41.0 41.0 37.0 41.0 40-44 39.39639999999999 41.0 41.0 41.0 37.0 41.0 45-49 39.2302 41.0 41.0 41.0 37.0 41.0 50-54 38.93945 41.0 41.0 41.0 36.0 41.0 55-59 38.6083 41.0 39.4 41.0 32.0 41.0 60-64 38.30395 41.0 37.0 41.0 32.0 41.0 65-69 37.6395 41.0 37.0 41.0 29.0 41.0 70-74 36.8225 41.0 37.0 41.0 27.0 41.0 75-79 34.189949999999996 37.6 33.0 40.2 22.0 41.0 80-84 35.5273 40.2 32.0 41.0 22.0 41.0 85-89 35.34160000000001 38.6 32.0 41.0 22.0 41.0 90-94 35.19205 37.8 32.0 41.0 22.0 41.0 95-99 35.03335 37.8 32.0 41.0 22.0 41.0 100-104 35.221 37.8 32.0 41.0 22.0 41.0 105-109 35.6132 41.0 32.0 41.0 22.0 41.0 110-114 35.9812 41.0 34.0 41.0 22.0 41.0 115-119 36.15635 41.0 37.0 41.0 22.0 41.0 120-124 36.5009 41.0 37.0 41.0 24.0 41.0 125-129 36.8658 41.0 37.0 41.0 27.0 41.0 130-134 36.9012 41.0 37.0 41.0 27.0 41.0 135-139 36.80285 41.0 37.0 41.0 27.0 41.0 140-144 36.7752 41.0 37.0 41.0 27.0 41.0 145-149 36.87355 41.0 37.0 41.0 26.0 41.0 150 36.72925 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 4.0 23 6.0 24 9.0 25 23.0 26 25.0 27 35.0 28 44.0 29 53.0 30 72.0 31 84.0 32 109.0 33 106.0 34 156.0 35 195.0 36 273.0 37 425.0 38 712.0 39 1043.0 40 622.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.075 14.2 12.125 38.6 2 15.9 13.05 40.5 30.55 3 15.825 19.575 31.6 33.0 4 21.575 25.650000000000002 25.6 27.175 5 21.375 34.35 25.775 18.5 6 16.275000000000002 33.475 28.825 21.425 7 14.799999999999999 27.025 40.400000000000006 17.775 8 13.775 24.95 37.2 24.075 9 15.950000000000001 26.724999999999998 35.475 21.85 10-14 19.57 29.080000000000002 27.815 23.535 15-19 19.314999999999998 28.794999999999998 28.025 23.865 20-24 18.834999999999997 28.660000000000004 28.075 24.43 25-29 19.185 29.060000000000002 27.884999999999998 23.87 30-34 19.615 29.270000000000003 27.525 23.59 35-39 19.05 28.804999999999996 28.499999999999996 23.645 40-44 19.215 28.89 28.249999999999996 23.645 45-49 19.0 29.095 27.98 23.925 50-54 19.68 28.24 27.985 24.095 55-59 19.555 28.075 28.305000000000003 24.065 60-64 18.695 28.720000000000002 28.76 23.825 65-69 19.505 28.74 28.405 23.35 70-74 19.535 28.610000000000003 28.08 23.775 75-79 19.71 29.025000000000002 27.97 23.294999999999998 80-84 19.525000000000002 28.349999999999998 28.244999999999997 23.880000000000003 85-89 19.07 29.049999999999997 28.26 23.62 90-94 20.25 29.24 27.150000000000002 23.36 95-99 18.92 29.01 28.52 23.549999999999997 100-104 19.345000000000002 28.23 28.26 24.165 105-109 19.415 28.27 28.044999999999998 24.27 110-114 19.384999999999998 28.84 28.505000000000003 23.27 115-119 20.175 28.565 28.249999999999996 23.01 120-124 19.634999999999998 28.23 28.335 23.799999999999997 125-129 19.62 28.384999999999998 28.26 23.735 130-134 19.645000000000003 28.860000000000003 28.03 23.465 135-139 19.74 28.549999999999997 28.389999999999997 23.32 140-144 19.689999999999998 27.700000000000003 28.865000000000002 23.745 145-149 20.445 28.01 28.18 23.365 150 19.275000000000002 28.125 27.950000000000003 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 1.0 13 1.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.5 20 1.5 21 1.5 22 2.5 23 3.5 24 3.5 25 5.0 26 7.0 27 8.0 28 12.5 29 19.0 30 23.0 31 30.0 32 40.5 33 51.0 34 68.0 35 85.5 36 94.0 37 130.0 38 168.5 39 184.5 40 216.5 41 232.0 42 238.0 43 258.0 44 283.5 45 289.0 46 257.5 47 231.0 48 193.5 49 171.5 50 147.5 51 114.5 52 100.5 53 71.0 54 57.0 55 50.0 56 33.0 57 27.5 58 22.0 59 15.0 60 12.0 61 7.0 62 6.0 63 3.5 64 3.5 65 5.0 66 3.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.05523408732246 90.35 2 4.681746449237243 8.9 3 0.2630194634402946 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.1375 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.15 0.0 0.0 0.0 0.0 126-127 0.175 0.0 0.0 0.0 0.0 128-129 0.1875 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.2875 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 0.3125 0.0 0.0 0.0 0.0 138 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTAAT 10 0.006973645 144.0 5 TAATGCA 10 0.006973645 144.0 8 AATGCAT 10 0.006973645 144.0 9 >>END_MODULE SRR14639606 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639606_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.2675 32.0 32.0 32.0 27.0 32.0 2 30.09875 32.0 32.0 32.0 27.0 32.0 3 33.18625 37.0 32.0 37.0 27.0 37.0 4 34.1875 37.0 37.0 37.0 27.0 37.0 5 34.8025 37.0 37.0 37.0 32.0 37.0 6 37.4275 41.0 37.0 41.0 32.0 41.0 7 37.25725 41.0 37.0 41.0 27.0 41.0 8 37.522 41.0 37.0 41.0 27.0 41.0 9 37.84475 41.0 37.0 41.0 27.0 41.0 10-14 37.7205 41.0 37.0 41.0 27.0 41.0 15-19 37.574 41.0 37.0 41.0 27.0 41.0 20-24 37.10525 41.0 37.0 41.0 27.0 41.0 25-29 36.55285 41.0 37.0 41.0 24.0 41.0 30-34 36.6367 41.0 37.0 41.0 23.0 41.0 35-39 36.843900000000005 41.0 37.0 41.0 25.0 41.0 40-44 36.75880000000001 41.0 37.0 41.0 25.0 41.0 45-49 36.7222 41.0 37.0 41.0 25.0 41.0 50-54 36.68445 41.0 37.0 41.0 23.0 41.0 55-59 36.65775 41.0 37.0 41.0 25.0 41.0 60-64 36.56145 41.0 37.0 41.0 22.0 41.0 65-69 36.283100000000005 41.0 37.0 41.0 22.0 41.0 70-74 36.021249999999995 41.0 37.0 41.0 22.0 41.0 75-79 35.4402 40.2 35.0 41.0 22.0 41.0 80-84 36.4621 41.0 37.0 41.0 22.0 41.0 85-89 36.278099999999995 41.0 37.0 41.0 22.0 41.0 90-94 35.958000000000006 41.0 37.0 41.0 22.0 41.0 95-99 36.12355 41.0 37.0 41.0 22.0 41.0 100-104 35.78340000000001 41.0 35.0 41.0 20.0 41.0 105-109 35.65840000000001 41.0 33.0 41.0 22.0 41.0 110-114 35.610350000000004 41.0 32.0 41.0 22.0 41.0 115-119 35.27315 41.0 32.0 41.0 20.0 41.0 120-124 35.321 41.0 32.0 41.0 22.0 41.0 125-129 34.63485 41.0 32.0 41.0 16.0 41.0 130-134 34.77714999999999 41.0 32.0 41.0 18.0 41.0 135-139 34.22175 39.4 31.0 41.0 14.0 41.0 140-144 33.82285 37.0 29.0 41.0 12.0 41.0 145-149 33.77585 37.0 31.0 41.0 12.0 41.0 150 33.397 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 2.0 16 10.0 17 17.0 18 26.0 19 38.0 20 31.0 21 41.0 22 46.0 23 47.0 24 53.0 25 49.0 26 68.0 27 69.0 28 72.0 29 84.0 30 83.0 31 92.0 32 122.0 33 135.0 34 140.0 35 171.0 36 184.0 37 254.0 38 360.0 39 585.0 40 1215.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.09927300075207 28.152419152669843 8.924542491852595 26.82376535472549 2 19.85 28.549999999999997 36.15 15.45 3 17.5 27.825 34.675 20.0 4 21.2 34.775 25.174999999999997 18.85 5 22.825 38.550000000000004 23.075000000000003 15.55 6 18.625 38.175 25.05 18.15 7 19.1 23.599999999999998 37.475 19.825 8 16.3 24.65 31.974999999999998 27.075 9 19.975 24.825 30.0 25.2 10-14 22.105 28.904999999999998 27.279999999999998 21.709999999999997 15-19 21.88 28.46 28.720000000000002 20.94 20-24 22.165000000000003 29.215000000000003 27.205000000000002 21.415 25-29 22.220000000000002 28.675 28.08 21.025 30-34 22.2 28.610000000000003 28.294999999999998 20.895 35-39 22.33 29.075 27.875 20.72 40-44 22.75 28.435 28.16 20.655 45-49 22.64 28.265 27.97 21.125 50-54 22.435 29.17 27.310000000000002 21.085 55-59 22.705000000000002 28.28 28.000000000000004 21.015 60-64 22.345000000000002 28.315 28.110000000000003 21.23 65-69 22.655 27.925 28.15 21.27 70-74 23.01 28.485 27.884999999999998 20.62 75-79 23.06 28.705000000000002 27.255000000000003 20.979999999999997 80-84 22.86 28.22 27.79 21.13 85-89 23.105 28.38 27.894999999999996 20.62 90-94 23.21 28.349999999999998 27.72 20.72 95-99 22.830000000000002 28.835 27.515 20.82 100-104 23.765 28.134999999999998 27.224999999999998 20.875 105-109 23.225 28.57 27.105 21.099999999999998 110-114 23.47 28.294999999999998 27.505000000000003 20.73 115-119 23.805 28.02 27.345000000000002 20.830000000000002 120-124 23.075000000000003 28.63 27.73 20.565 125-129 22.935 28.405 27.229999999999997 21.43 130-134 22.745 28.389999999999997 27.560000000000002 21.305 135-139 23.16 28.825 27.279999999999998 20.735 140-144 23.345 28.705000000000002 27.295 20.655 145-149 23.115 28.33 27.485 21.07 150 22.525000000000002 28.775000000000002 28.299999999999997 20.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.5 11 0.5 12 0.5 13 1.5 14 1.5 15 0.5 16 0.5 17 2.0 18 2.5 19 2.0 20 1.0 21 0.5 22 1.0 23 3.0 24 6.0 25 5.0 26 4.5 27 6.5 28 12.0 29 20.5 30 24.5 31 28.0 32 32.5 33 39.5 34 57.0 35 74.0 36 101.5 37 129.0 38 145.5 39 172.0 40 208.5 41 243.0 42 255.0 43 268.0 44 279.5 45 283.0 46 269.0 47 218.0 48 205.0 49 195.0 50 161.5 51 123.0 52 84.5 53 71.5 54 59.0 55 48.5 56 36.0 57 29.5 58 23.5 59 15.0 60 10.5 61 8.0 62 6.0 63 6.5 64 5.5 65 2.5 66 2.0 67 1.0 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.275 #Duplication Level Percentage of deduplicated Percentage of total 1 96.44248247208517 92.85 2 3.2459101532069594 6.25 3 0.3116073747078681 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.075 0.0 0.0 0.0 0.0 120-121 0.0875 0.0 0.0 0.0 0.0 122-123 0.1 0.0 0.0 0.0 0.0 124-125 0.1 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.1125 0.0 0.0 0.0 0.0 130-131 0.175 0.0 0.0 0.0 0.0 132-133 0.21250000000000002 0.0 0.0 0.0 0.0 134-135 0.25 0.0 0.0 0.0 0.0 136-137 0.2625 0.0 0.0 0.0 0.0 138 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAAAC 10 0.006973645 144.0 7 >>END_MODULE Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098370 spots for SRR14639606.sra Written 1098370 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra Read 1098369 spots for SRR14639606.sra Written 1098369 spots for SRR14639606.sra SRR ids: ['SRR14639606.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tprdin3c SRR14639606.sra spots: 21967381 blocks: [[1, 1098369], [1098370, 2196738], [2196739, 3295107], [3295108, 4393476], [4393477, 5491845], [5491846, 6590214], [6590215, 7688583], [7688584, 8786952], [8786953, 9885321], [9885322, 10983690], [10983691, 12082059], [12082060, 13180428], [13180429, 14278797], [14278798, 15377166], [15377167, 16475535], [16475536, 17573904], [17573905, 18672273], [18672274, 19770642], [19770643, 20869011], [20869012, 21967381]] SRR14639606 file size 8131156 SRR14639606 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639606 SRR14639606_1.fastq SRR14639606_2.fastq Input file: SRR14639606_1.fastq Paired file: SRR14639606_2.fastq trimmed: SRR14639606-trimmed-pair1.fastq, SRR14639606-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:02:05 2025 >> started Mon Feb 10 13:02:31 2025 >> done (26.267s) 21967381 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 251 ( 0.00%) empty read pairs filtered out after trimming by size control 21967094 (100.00%) read pairs available; of these: 540792 ( 2.46%) trimmed read pairs available after processing 21426302 (97.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 13 0.00% 21 9 0.00% 22 15 0.00% 23 14 0.00% 24 14 0.00% 25 19 0.00% 26 7 0.00% 27 22 0.00% 28 35 0.00% 29 21 0.00% 30 27 0.00% 31 20 0.00% 32 38 0.00% 33 32 0.00% 34 25 0.00% 35 39 0.00% 36 39 0.00% 37 52 0.00% 38 72 0.00% 39 48 0.00% 40 44 0.00% 41 67 0.00% 42 65 0.00% 43 77 0.00% 44 67 0.00% 45 81 0.00% 46 88 0.00% 47 94 0.00% 48 70 0.00% 49 108 0.00% 50 102 0.00% 51 121 0.00% 52 142 0.00% 53 138 0.00% 54 130 0.00% 55 164 0.00% 56 164 0.00% 57 185 0.00% 58 211 0.00% 59 191 0.00% 60 233 0.00% 61 235 0.00% 62 252 0.00% 63 255 0.00% 64 244 0.00% 65 260 0.00% 66 296 0.00% 67 324 0.00% 68 273 0.00% 69 340 0.00% 70 377 0.00% 71 383 0.00% 72 419 0.00% 73 442 0.00% 74 417 0.00% 75 443 0.00% 76 479 0.00% 77 525 0.00% 78 583 0.00% 79 606 0.00% 80 604 0.00% 81 609 0.00% 82 706 0.00% 83 736 0.00% 84 689 0.00% 85 813 0.00% 86 793 0.00% 87 788 0.00% 88 829 0.00% 89 860 0.00% 90 969 0.00% 91 936 0.00% 92 962 0.00% 93 1025 0.00% 94 1079 0.00% 95 1130 0.01% 96 1195 0.01% 97 1231 0.01% 98 1207 0.01% 99 1353 0.01% 100 1295 0.01% 101 1421 0.01% 102 1520 0.01% 103 1537 0.01% 104 1578 0.01% 105 1732 0.01% 106 1719 0.01% 107 1788 0.01% 108 1850 0.01% 109 1911 0.01% 110 1838 0.01% 111 2062 0.01% 112 2082 0.01% 113 2098 0.01% 114 2267 0.01% 115 2393 0.01% 116 2401 0.01% 117 2627 0.01% 118 2559 0.01% 119 2581 0.01% 120 2701 0.01% 121 3045 0.01% 122 2928 0.01% 123 3047 0.01% 124 3251 0.01% 125 3269 0.01% 126 3417 0.02% 127 3586 0.02% 128 3600 0.02% 129 3880 0.02% 130 3818 0.02% 131 3988 0.02% 132 3995 0.02% 133 4184 0.02% 134 4360 0.02% 135 4414 0.02% 136 4480 0.02% 137 4545 0.02% 138 4730 0.02% 139 4819 0.02% 140 4847 0.02% 141 5159 0.02% 142 5172 0.02% 143 5268 0.02% 144 5582 0.03% 145 5748 0.03% 146 6340 0.03% 147 8831 0.04% 148 24910 0.11% 149 324836 1.48% 150 21426302 97.54% 21967094 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=25 prefix-density=0.38 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=23.59 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.2 sequence=ATTCCTCCACGGAGACGCAGCACCAAGTGAAGGGTTGACTCCTTCTG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.20 fanout-score-rank=11 prefix-density=0.55 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=80.10 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=21.0 sequence=TCAAGAAAATGG SRR14639606 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:03:20 Started mapping on | Feb 10 13:03:20 Finished on | Feb 10 13:07:06 Mapping speed, Million of reads per hour | 349.92 Number of input reads | 21967094 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19744190 Uniquely mapped reads % | 89.88% Average mapped length | 296.90 Number of splices: Total | 17086731 Number of splices: Annotated (sjdb) | 16738343 Number of splices: GT/AG | 16800829 Number of splices: GC/AG | 216581 Number of splices: AT/AC | 15932 Number of splices: Non-canonical | 53389 Mismatch rate per base, % | 0.63% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 539510 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 49669 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.32% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1683394 1683394 1683394 N_multimapping 539510 539510 539510 N_noFeature 609134 19565696 683675 N_ambiguous 242171 1413 137399 UnstrandedReadsAssigned:18892885 PositiveStrandReadsAssigned:177081 NegativeStrandReadsAssigned:18923116 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639606 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639606-trimmed-pair1.fastq SRR14639606-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,967,094 reads, 19,370,906 reads pseudoaligned [quant] estimated average fragment length: 370.484 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR14639606.ke.tsv 34699 SRR14639606.se.tsv 87100 total ==> SRR14639606.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1648.52 2826 81.4935 Potri.005G024800.1.v4.1 1035 665.516 267 19.072 Potri.004G059700.1.v4.1 961 592.092 169 13.5688 Potri.007G009000.2.v4.1 1416 1046.52 0 0 Potri.003G141000.2.v4.1 2943 2573.52 955.412 17.6485 Potri.016G087400.1.v4.1 270 50.9101 1124.71 1050.22 Potri.015G069301.1.v4.1 564 227.604 0 0 Potri.010G195200.1.v4.1 1773 1403.52 66 2.23548 Potri.012G127500.1.v4.1 977 607.817 2306 180.356 ==> SRR14639606.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 113 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 347 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 387 SRR14639606 completed mapping pipeline successfully