Starting /dee2/code/volunteer_pipeline.sh SRR14639607 current disk space = 3058957238272 free memory = 1579246516 SRR14639607 SRAfilesize 3df5cb8194b965ef8a1829e61e5dd4c1 SRR14639607.sra SRR14639607.sra file validated SRR14639607 is paired end SRR14639607 is conventional basespace SRR14639607 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639607_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6825 32.0 32.0 32.0 32.0 32.0 2 31.565 32.0 32.0 32.0 32.0 32.0 3 35.28625 37.0 32.0 37.0 32.0 37.0 4 36.34875 37.0 37.0 37.0 37.0 37.0 5 36.38875 37.0 37.0 37.0 37.0 37.0 6 39.92175 41.0 41.0 41.0 37.0 41.0 7 39.98075 41.0 41.0 41.0 37.0 41.0 8 40.26725 41.0 41.0 41.0 37.0 41.0 9 40.24625 41.0 41.0 41.0 37.0 41.0 10-14 40.2528 41.0 41.0 41.0 39.4 41.0 15-19 40.257850000000005 41.0 41.0 41.0 40.2 41.0 20-24 40.23145000000001 41.0 41.0 41.0 38.6 41.0 25-29 40.15259999999999 41.0 41.0 41.0 39.4 41.0 30-34 40.0844 41.0 41.0 41.0 37.0 41.0 35-39 39.928549999999994 41.0 41.0 41.0 37.0 41.0 40-44 39.6873 41.0 41.0 41.0 37.0 41.0 45-49 39.4444 41.0 41.0 41.0 37.0 41.0 50-54 39.1469 41.0 41.0 41.0 37.0 41.0 55-59 38.794050000000006 41.0 39.4 41.0 33.0 41.0 60-64 38.503949999999996 41.0 37.0 41.0 33.0 41.0 65-69 37.7423 41.0 37.0 41.0 29.0 41.0 70-74 37.0206 41.0 37.0 41.0 27.0 41.0 75-79 34.339150000000004 37.6 32.0 40.2 24.0 41.0 80-84 35.630950000000006 40.2 32.0 41.0 22.0 41.0 85-89 35.50855 40.2 32.0 41.0 22.0 41.0 90-94 35.4054 37.8 32.0 41.0 22.0 41.0 95-99 35.187 38.6 32.0 41.0 22.0 41.0 100-104 35.5829 41.0 32.0 41.0 22.0 41.0 105-109 35.937599999999996 41.0 33.0 41.0 22.0 41.0 110-114 36.16955 41.0 35.0 41.0 23.0 41.0 115-119 36.60415 41.0 37.0 41.0 26.0 41.0 120-124 36.86655 41.0 37.0 41.0 27.0 41.0 125-129 37.19855 41.0 37.0 41.0 27.0 41.0 130-134 37.11575 41.0 37.0 41.0 27.0 41.0 135-139 37.19799999999999 41.0 37.0 41.0 27.0 41.0 140-144 37.11875 41.0 37.0 41.0 27.0 41.0 145-149 37.056799999999996 41.0 37.0 41.0 27.0 41.0 150 36.79325 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 4.0 23 9.0 24 7.0 25 20.0 26 19.0 27 31.0 28 30.0 29 44.0 30 58.0 31 63.0 32 88.0 33 105.0 34 155.0 35 183.0 36 291.0 37 438.0 38 697.0 39 1090.0 40 666.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.125 13.225000000000001 12.25 38.4 2 14.774999999999999 12.875 41.8 30.55 3 14.399999999999999 19.3 31.35 34.949999999999996 4 20.599999999999998 26.25 25.7 27.450000000000003 5 21.725 33.375 26.724999999999998 18.175 6 16.925 33.900000000000006 29.049999999999997 20.125 7 13.525 28.075 40.625 17.775 8 13.825000000000001 24.099999999999998 37.9 24.175 9 15.275 25.025 36.225 23.474999999999998 10-14 18.965 28.78 28.970000000000002 23.285 15-19 18.765 28.34 28.744999999999997 24.15 20-24 19.005 29.575000000000003 28.01 23.41 25-29 18.83 28.165000000000003 29.035 23.97 30-34 19.325 28.955 28.235 23.485 35-39 19.165 29.28 27.775 23.78 40-44 19.17 29.07 28.48 23.28 45-49 19.415 27.965 28.815 23.805 50-54 19.705000000000002 28.000000000000004 28.660000000000004 23.635 55-59 19.005 28.43 28.83 23.735 60-64 19.555 28.175 28.194999999999997 24.075 65-69 19.03 29.115000000000002 28.255000000000003 23.599999999999998 70-74 19.055 29.134999999999998 27.99 23.82 75-79 19.36 28.535 28.175 23.93 80-84 19.580000000000002 28.95 27.735 23.735 85-89 19.215 29.459999999999997 27.744999999999997 23.580000000000002 90-94 19.03 28.744999999999997 28.199999999999996 24.025 95-99 19.650000000000002 28.875 28.16 23.315 100-104 19.665 29.185 27.92 23.23 105-109 19.48194819481948 29.102910291029104 27.59275927592759 23.82238223822382 110-114 19.38 28.525 28.215 23.880000000000003 115-119 19.61 28.78 27.944999999999997 23.665 120-124 19.955000000000002 28.084999999999997 27.58 24.38 125-129 19.675 28.845 28.485 22.994999999999997 130-134 19.985 28.565 27.49 23.96 135-139 19.915 27.584999999999997 28.444999999999997 24.055 140-144 19.807971195679354 28.58428764314647 28.039205880882136 23.568535280292043 145-149 19.689999999999998 28.29 28.435 23.585 150 20.075000000000003 27.3 29.075 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 3.0 24 3.5 25 6.5 26 10.5 27 8.5 28 10.0 29 18.0 30 28.5 31 33.0 32 45.0 33 57.0 34 61.0 35 83.0 36 106.5 37 136.0 38 173.5 39 192.0 40 220.0 41 243.5 42 242.5 43 275.0 44 275.5 45 267.5 46 247.0 47 204.5 48 197.0 49 181.0 50 152.0 51 113.5 52 92.5 53 69.0 54 49.5 55 51.5 56 35.5 57 20.5 58 19.0 59 12.0 60 9.0 61 9.5 62 8.0 63 4.5 64 3.0 65 2.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.59863767356562 91.225 2 4.008383547288447 7.6499999999999995 3 0.39297877914592616 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.16249999999999998 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.2 0.0 0.0 0.0 0.0 132-133 0.225 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 0.3 0.0 0.0 0.0 0.0 138 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAGTT 10 0.006973645 144.0 6 ATTTGAA 10 0.006973645 144.0 5 TTTGGTG 10 0.006973645 144.0 7 >>END_MODULE SRR14639607 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639607_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.38625 32.0 32.0 32.0 27.0 32.0 2 30.06375 32.0 32.0 32.0 27.0 32.0 3 33.09125 37.0 32.0 37.0 27.0 37.0 4 34.00625 37.0 37.0 37.0 27.0 37.0 5 34.74375 37.0 37.0 37.0 32.0 37.0 6 37.476 41.0 37.0 41.0 32.0 41.0 7 37.3855 41.0 37.0 41.0 27.0 41.0 8 37.39725 41.0 37.0 41.0 27.0 41.0 9 37.6665 41.0 37.0 41.0 27.0 41.0 10-14 37.69525 41.0 37.0 41.0 27.0 41.0 15-19 37.5888 41.0 37.0 41.0 27.0 41.0 20-24 37.2653 41.0 37.0 41.0 27.0 41.0 25-29 36.62330000000001 41.0 37.0 41.0 24.0 41.0 30-34 36.6678 41.0 37.0 41.0 23.0 41.0 35-39 36.8721 41.0 37.0 41.0 25.0 41.0 40-44 36.923649999999995 41.0 37.0 41.0 27.0 41.0 45-49 36.877250000000004 41.0 37.0 41.0 26.0 41.0 50-54 36.71555 41.0 37.0 41.0 26.0 41.0 55-59 36.79765 41.0 37.0 41.0 24.0 41.0 60-64 36.7263 41.0 37.0 41.0 25.0 41.0 65-69 36.511 41.0 37.0 41.0 24.0 41.0 70-74 36.21275 41.0 37.0 41.0 22.0 41.0 75-79 35.550850000000004 40.2 35.0 41.0 22.0 41.0 80-84 36.54245 41.0 37.0 41.0 22.0 41.0 85-89 36.544599999999996 41.0 37.0 41.0 22.0 41.0 90-94 36.20934999999999 41.0 37.0 41.0 22.0 41.0 95-99 36.23325 41.0 37.0 41.0 22.0 41.0 100-104 35.9151 41.0 35.0 41.0 22.0 41.0 105-109 35.822 41.0 36.0 41.0 22.0 41.0 110-114 35.84955000000001 41.0 36.0 41.0 22.0 41.0 115-119 35.5753 41.0 34.0 41.0 20.0 41.0 120-124 35.537800000000004 41.0 32.0 41.0 22.0 41.0 125-129 35.01129999999999 41.0 32.0 41.0 18.0 41.0 130-134 34.93615 41.0 32.0 41.0 18.0 41.0 135-139 34.317750000000004 39.4 31.0 41.0 14.0 41.0 140-144 34.004 37.0 32.0 41.0 12.0 41.0 145-149 33.8144 37.0 31.0 41.0 12.0 41.0 150 33.508 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 7.0 17 17.0 18 30.0 19 30.0 20 45.0 21 44.0 22 41.0 23 44.0 24 44.0 25 34.0 26 62.0 27 62.0 28 83.0 29 76.0 30 102.0 31 89.0 32 97.0 33 131.0 34 148.0 35 176.0 36 190.0 37 265.0 38 336.0 39 569.0 40 1274.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.429644466700054 27.591387080620933 9.163745618427642 26.81522283425138 2 20.974999999999998 26.5 37.45 15.075 3 17.849999999999998 27.675 34.575 19.900000000000002 4 21.05 35.0 25.124999999999996 18.825 5 22.725 38.725 22.225 16.325 6 19.275000000000002 36.1 25.85 18.775 7 20.275000000000002 24.675 35.375 19.675 8 17.724999999999998 23.65 33.575 25.05 9 19.825 25.374999999999996 31.674999999999997 23.125 10-14 22.97 29.220000000000002 27.215 20.595 15-19 22.705000000000002 27.765 28.17 21.36 20-24 22.445 28.765 27.57 21.22 25-29 22.555 28.470000000000002 27.884999999999998 21.09 30-34 22.13 28.310000000000002 28.18 21.38 35-39 21.615000000000002 28.985 27.975 21.425 40-44 22.755 27.92 28.285 21.04 45-49 22.685 28.71 27.96 20.645 50-54 21.959999999999997 28.634999999999998 27.92 21.485000000000003 55-59 23.25 28.005000000000003 27.794999999999998 20.95 60-64 22.61 28.410000000000004 28.155 20.825 65-69 22.75 27.99 27.48 21.78 70-74 22.785 28.59 27.13 21.495 75-79 22.82 28.51 27.72 20.95 80-84 23.21 28.305000000000003 27.77 20.715 85-89 22.57 28.439999999999998 27.99 21.0 90-94 23.1 27.985 27.82 21.095 95-99 22.73 28.185 28.24 20.845 100-104 23.265 28.075 27.52 21.14 105-109 23.155 28.365000000000002 27.575 20.905 110-114 23.305 28.08 28.000000000000004 20.615 115-119 23.621181059052955 28.276413820691033 27.096354817740888 21.006050302515124 120-124 22.900000000000002 28.375 27.935 20.79 125-129 22.925 27.85 27.865000000000002 21.36 130-134 22.869999999999997 28.305000000000003 27.625 21.2 135-139 22.97 28.18 27.805000000000003 21.044999999999998 140-144 22.945 27.644999999999996 27.800000000000004 21.61 145-149 23.205000000000002 27.63 27.860000000000003 21.305 150 22.900000000000002 29.075 28.175 19.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 1.0 23 2.5 24 4.0 25 4.0 26 3.5 27 6.5 28 11.0 29 16.5 30 27.0 31 30.5 32 35.5 33 48.0 34 59.5 35 71.0 36 84.5 37 126.5 38 167.0 39 182.5 40 208.5 41 234.5 42 262.0 43 280.5 44 268.5 45 267.0 46 255.5 47 230.0 48 201.5 49 171.0 50 143.5 51 113.5 52 91.0 53 75.0 54 64.0 55 58.0 56 47.5 57 29.0 58 23.0 59 18.5 60 15.0 61 14.0 62 10.0 63 5.5 64 3.0 65 3.0 66 3.0 67 3.0 68 2.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.47119875454074 92.95 2 3.269330565646082 6.3 3 0.2594706798131811 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.16249999999999998 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.2375 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.275 0.0 0.0 0.0 0.0 128-129 0.275 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.3 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 0.4 0.0 0.0 0.0 0.0 138 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAGAG 10 0.006973645 144.0 1 ATTGAGG 10 0.006973645 144.0 6 >>END_MODULE Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087851 spots for SRR14639607.sra Written 1087851 spots for SRR14639607.sra Read 1087861 spots for SRR14639607.sra Written 1087861 spots for SRR14639607.sra SRR ids: ['SRR14639607.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9x_0qjca SRR14639607.sra spots: 21757030 blocks: [[1, 1087851], [1087852, 2175702], [2175703, 3263553], [3263554, 4351404], [4351405, 5439255], [5439256, 6527106], [6527107, 7614957], [7614958, 8702808], [8702809, 9790659], [9790660, 10878510], [10878511, 11966361], [11966362, 13054212], [13054213, 14142063], [14142064, 15229914], [15229915, 16317765], [16317766, 17405616], [17405617, 18493467], [18493468, 19581318], [19581319, 20669169], [20669170, 21757030]] SRR14639607 file size 8053202 SRR14639607 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639607 SRR14639607_1.fastq SRR14639607_2.fastq Input file: SRR14639607_1.fastq Paired file: SRR14639607_2.fastq trimmed: SRR14639607-trimmed-pair1.fastq, SRR14639607-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:25:08 2025 >> started Mon Feb 10 13:25:36 2025 >> done (27.048s) 21757030 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 76 ( 0.00%) empty read pairs filtered out after trimming by size control 21756916 (100.00%) read pairs available; of these: 463016 ( 2.13%) trimmed read pairs available after processing 21293900 (97.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 13 0.00% 21 8 0.00% 22 15 0.00% 23 13 0.00% 24 14 0.00% 25 23 0.00% 26 16 0.00% 27 24 0.00% 28 21 0.00% 29 17 0.00% 30 22 0.00% 31 26 0.00% 32 41 0.00% 33 36 0.00% 34 35 0.00% 35 42 0.00% 36 41 0.00% 37 39 0.00% 38 41 0.00% 39 27 0.00% 40 45 0.00% 41 32 0.00% 42 51 0.00% 43 45 0.00% 44 48 0.00% 45 45 0.00% 46 55 0.00% 47 45 0.00% 48 52 0.00% 49 58 0.00% 50 67 0.00% 51 66 0.00% 52 68 0.00% 53 75 0.00% 54 96 0.00% 55 95 0.00% 56 90 0.00% 57 67 0.00% 58 80 0.00% 59 97 0.00% 60 96 0.00% 61 98 0.00% 62 111 0.00% 63 133 0.00% 64 122 0.00% 65 107 0.00% 66 134 0.00% 67 143 0.00% 68 140 0.00% 69 176 0.00% 70 170 0.00% 71 198 0.00% 72 168 0.00% 73 209 0.00% 74 200 0.00% 75 199 0.00% 76 268 0.00% 77 278 0.00% 78 265 0.00% 79 272 0.00% 80 281 0.00% 81 342 0.00% 82 394 0.00% 83 351 0.00% 84 382 0.00% 85 407 0.00% 86 410 0.00% 87 455 0.00% 88 491 0.00% 89 481 0.00% 90 524 0.00% 91 511 0.00% 92 575 0.00% 93 562 0.00% 94 612 0.00% 95 689 0.00% 96 678 0.00% 97 727 0.00% 98 711 0.00% 99 770 0.00% 100 861 0.00% 101 872 0.00% 102 924 0.00% 103 950 0.00% 104 997 0.00% 105 1133 0.01% 106 1084 0.00% 107 1133 0.01% 108 1227 0.01% 109 1227 0.01% 110 1266 0.01% 111 1352 0.01% 112 1414 0.01% 113 1402 0.01% 114 1574 0.01% 115 1625 0.01% 116 1687 0.01% 117 1827 0.01% 118 1960 0.01% 119 1905 0.01% 120 2059 0.01% 121 2013 0.01% 122 2192 0.01% 123 2307 0.01% 124 2373 0.01% 125 2380 0.01% 126 2552 0.01% 127 2659 0.01% 128 2738 0.01% 129 2766 0.01% 130 2882 0.01% 131 2873 0.01% 132 2957 0.01% 133 3112 0.01% 134 3138 0.01% 135 3457 0.02% 136 3504 0.02% 137 3576 0.02% 138 3629 0.02% 139 3974 0.02% 140 3878 0.02% 141 4006 0.02% 142 4132 0.02% 143 4192 0.02% 144 4331 0.02% 145 4721 0.02% 146 5159 0.02% 147 7084 0.03% 148 21414 0.10% 149 304893 1.40% 150 21293900 97.87% 21756916 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.12 sequence-density-rank=11 fanout-score=16.49 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=6.3 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.30 fanout-score-rank=12 prefix-density=0.49 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=79.26 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=20.9 sequence=TCAAGAAAATGG SRR14639607 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:26:26 Started mapping on | Feb 10 13:26:27 Finished on | Feb 10 13:30:36 Mapping speed, Million of reads per hour | 314.56 Number of input reads | 21756916 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19406498 Uniquely mapped reads % | 89.20% Average mapped length | 297.14 Number of splices: Total | 17134250 Number of splices: Annotated (sjdb) | 16761754 Number of splices: GT/AG | 16845239 Number of splices: GC/AG | 220801 Number of splices: AT/AC | 15266 Number of splices: Non-canonical | 52944 Mismatch rate per base, % | 0.62% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522952 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 30071 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.16% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1827466 1827466 1827466 N_multimapping 522952 522952 522952 N_noFeature 642924 19230015 716146 N_ambiguous 241246 1472 137192 UnstrandedReadsAssigned:18522328 PositiveStrandReadsAssigned:175011 NegativeStrandReadsAssigned:18553160 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639607 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639607-trimmed-pair1.fastq SRR14639607-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,756,916 reads, 18,929,826 reads pseudoaligned [quant] estimated average fragment length: 374.277 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR14639607.ke.tsv 34699 SRR14639607.se.tsv 87100 total ==> SRR14639607.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1644.72 2736 81.6579 Potri.005G024800.1.v4.1 1035 661.723 367 27.2248 Potri.004G059700.1.v4.1 961 588.207 133 11.0993 Potri.007G009000.2.v4.1 1416 1042.72 0 0 Potri.003G141000.2.v4.1 2943 2569.72 1002 19.1406 Potri.016G087400.1.v4.1 270 48.3476 1142 1159.49 Potri.015G069301.1.v4.1 564 224.343 0 0 Potri.010G195200.1.v4.1 1773 1399.72 108 3.78753 Potri.012G127500.1.v4.1 977 603.933 3665 297.893 ==> SRR14639607.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 332 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 309 SRR14639607 completed mapping pipeline successfully