Starting /dee2/code/volunteer_pipeline.sh SRR14639608 current disk space = 3058725384192 free memory = 1376080492 SRR14639608 SRAfilesize 7d47789aeffba2633cd47388d334fc19 SRR14639608.sra SRR14639608.sra file validated SRR14639608 is paired end SRR14639608 is conventional basespace SRR14639608 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639608_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7375 32.0 32.0 32.0 32.0 32.0 2 31.57 32.0 32.0 32.0 32.0 32.0 3 35.335 37.0 37.0 37.0 32.0 37.0 4 36.15125 37.0 37.0 37.0 32.0 37.0 5 36.36125 37.0 37.0 37.0 37.0 37.0 6 39.78775 41.0 41.0 41.0 37.0 41.0 7 39.93775 41.0 41.0 41.0 37.0 41.0 8 40.20225 41.0 41.0 41.0 37.0 41.0 9 40.22875 41.0 41.0 41.0 37.0 41.0 10-14 40.22475 41.0 41.0 41.0 38.6 41.0 15-19 40.2508 41.0 41.0 41.0 38.6 41.0 20-24 40.255399999999995 41.0 41.0 41.0 41.0 41.0 25-29 40.161500000000004 41.0 41.0 41.0 38.6 41.0 30-34 40.08004999999999 41.0 41.0 41.0 37.0 41.0 35-39 39.877649999999996 41.0 41.0 41.0 37.0 41.0 40-44 39.6548 41.0 41.0 41.0 37.0 41.0 45-49 39.452450000000006 41.0 41.0 41.0 37.0 41.0 50-54 39.2659 41.0 41.0 41.0 37.0 41.0 55-59 38.904250000000005 41.0 41.0 41.0 37.0 41.0 60-64 38.663 41.0 39.4 41.0 33.0 41.0 65-69 38.031 41.0 37.0 41.0 31.0 41.0 70-74 37.29709999999999 41.0 37.0 41.0 27.0 41.0 75-79 35.042950000000005 37.6 33.0 40.2 24.0 41.0 80-84 36.279 41.0 37.0 41.0 27.0 41.0 85-89 36.28345 41.0 36.0 41.0 27.0 41.0 90-94 36.02595 41.0 33.0 41.0 25.0 41.0 95-99 35.8863 41.0 34.0 41.0 22.0 41.0 100-104 36.140750000000004 41.0 34.0 41.0 24.0 41.0 105-109 36.39125 41.0 37.0 41.0 26.0 41.0 110-114 36.6337 41.0 37.0 41.0 26.0 41.0 115-119 36.93965 41.0 37.0 41.0 27.0 41.0 120-124 37.1023 41.0 37.0 41.0 27.0 41.0 125-129 37.539100000000005 41.0 37.0 41.0 28.0 41.0 130-134 37.2949 41.0 37.0 41.0 27.0 41.0 135-139 37.40845 41.0 37.0 41.0 27.0 41.0 140-144 37.4011 41.0 37.0 41.0 27.0 41.0 145-149 37.3339 41.0 37.0 41.0 27.0 41.0 150 37.238 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 1.0 24 9.0 25 17.0 26 24.0 27 29.0 28 36.0 29 44.0 30 55.0 31 83.0 32 83.0 33 97.0 34 112.0 35 176.0 36 221.0 37 349.0 38 552.0 39 1163.0 40 945.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.65 13.5 9.925 43.925 2 14.524999999999999 12.85 43.625 28.999999999999996 3 14.499999999999998 19.075 30.65 35.775 4 21.05 25.4 25.5 28.050000000000004 5 22.25 31.95 27.400000000000002 18.4 6 16.625 33.225 28.625 21.525 7 14.325 27.950000000000003 40.575 17.150000000000002 8 14.499999999999998 25.074999999999996 36.425000000000004 24.0 9 15.625 24.85 36.475 23.05 10-14 19.275000000000002 28.955 27.905 23.865 15-19 18.9 28.535 29.044999999999998 23.52 20-24 18.529999999999998 28.904999999999998 28.595 23.97 25-29 18.775 28.76 28.189999999999998 24.275 30-34 19.215 28.7 27.99 24.095 35-39 18.975 28.744999999999997 28.225 24.055 40-44 19.02 29.360000000000003 28.09 23.53 45-49 19.650000000000002 28.804999999999996 27.725 23.82 50-54 19.125 28.68 27.975 24.22 55-59 19.835 28.585 28.24 23.34 60-64 19.295 28.825 27.615000000000002 24.265 65-69 19.305 28.93 28.144999999999996 23.62 70-74 19.335 28.970000000000002 27.944999999999997 23.75 75-79 19.375 28.475 28.005000000000003 24.145 80-84 19.814999999999998 28.935 27.839999999999996 23.41 85-89 19.55 29.365000000000002 27.35 23.735 90-94 19.535 28.705000000000002 28.384999999999998 23.375 95-99 19.545 28.605000000000004 27.61 24.240000000000002 100-104 18.759999999999998 29.270000000000003 28.285 23.685000000000002 105-109 19.450972548627433 28.706435321766087 28.34141707085354 23.50117505875294 110-114 20.335 28.26 28.325 23.080000000000002 115-119 19.29 28.935 28.325 23.45 120-124 20.244999999999997 28.395 27.815 23.544999999999998 125-129 19.939999999999998 28.689999999999998 28.21 23.16 130-134 19.835 28.37 28.325 23.47 135-139 19.675 28.444999999999997 27.944999999999997 23.935000000000002 140-144 19.63794569185378 28.909336400460067 27.639145871880782 23.81357203580537 145-149 19.509999999999998 29.445 27.61 23.435 150 19.525000000000002 28.725 28.825 22.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 2.0 23 2.0 24 1.5 25 3.5 26 6.5 27 10.5 28 14.5 29 19.5 30 21.5 31 26.0 32 34.5 33 46.0 34 71.5 35 78.0 36 91.5 37 126.5 38 157.0 39 182.0 40 210.5 41 243.5 42 267.5 43 287.5 44 289.5 45 263.5 46 249.5 47 234.5 48 214.0 49 191.0 50 155.5 51 124.5 52 97.0 53 71.0 54 47.5 55 39.5 56 31.5 57 25.0 58 18.5 59 12.5 60 9.0 61 7.0 62 4.0 63 1.5 64 1.5 65 1.5 66 1.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 95.73633272299242 91.5 2 3.9759351294794665 7.6 3 0.26157467957101754 0.75 4 0.0 0.0 5 0.0 0.0 6 0.02615746795710175 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATG 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.325 0.0 0.0 0.0 0.0 134-135 1.4874999999999998 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTATGG 10 0.006973645 144.0 8 >>END_MODULE SRR14639608 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639608_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.69875 32.0 32.0 32.0 32.0 32.0 2 30.45625 32.0 32.0 32.0 27.0 32.0 3 33.83875 37.0 32.0 37.0 32.0 37.0 4 34.765 37.0 37.0 37.0 32.0 37.0 5 35.3175 37.0 37.0 37.0 32.0 37.0 6 38.06175 41.0 37.0 41.0 32.0 41.0 7 38.113 41.0 37.0 41.0 32.0 41.0 8 38.22825 41.0 37.0 41.0 32.0 41.0 9 38.47175 41.0 41.0 41.0 32.0 41.0 10-14 38.422349999999994 41.0 41.0 41.0 32.0 41.0 15-19 38.188100000000006 41.0 40.2 41.0 31.0 41.0 20-24 37.87985 41.0 37.8 41.0 28.0 41.0 25-29 37.43405 41.0 37.0 41.0 27.0 41.0 30-34 37.5164 41.0 37.0 41.0 27.0 41.0 35-39 37.63775 41.0 37.0 41.0 27.0 41.0 40-44 37.641 41.0 37.0 41.0 27.0 41.0 45-49 37.6344 41.0 37.0 41.0 27.0 41.0 50-54 37.4958 41.0 37.0 41.0 27.0 41.0 55-59 37.575149999999994 41.0 37.0 41.0 27.0 41.0 60-64 37.4747 41.0 37.0 41.0 27.0 41.0 65-69 37.21319999999999 41.0 37.0 41.0 27.0 41.0 70-74 36.8618 41.0 37.0 41.0 26.0 41.0 75-79 36.38015 40.2 36.0 41.0 24.0 41.0 80-84 37.2073 41.0 37.0 41.0 25.0 41.0 85-89 37.33555 41.0 37.0 41.0 26.0 41.0 90-94 36.9528 41.0 37.0 41.0 23.0 41.0 95-99 36.9863 41.0 37.0 41.0 23.0 41.0 100-104 36.72205 41.0 37.0 41.0 22.0 41.0 105-109 36.76285 41.0 37.0 41.0 22.0 41.0 110-114 36.655899999999995 41.0 37.0 41.0 22.0 41.0 115-119 36.284299999999995 41.0 36.0 41.0 22.0 41.0 120-124 36.4244 41.0 37.0 41.0 22.0 41.0 125-129 35.8846 41.0 36.0 41.0 22.0 41.0 130-134 35.84195 41.0 37.0 41.0 22.0 41.0 135-139 35.39515 41.0 34.0 41.0 18.0 41.0 140-144 35.10565 41.0 32.0 41.0 18.0 41.0 145-149 34.92855 41.0 32.0 41.0 14.0 41.0 150 34.33275 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 6.0 17 9.0 18 24.0 19 15.0 20 27.0 21 29.0 22 32.0 23 42.0 24 38.0 25 46.0 26 53.0 27 47.0 28 61.0 29 56.0 30 86.0 31 89.0 32 97.0 33 104.0 34 142.0 35 138.0 36 176.0 37 236.0 38 286.0 39 550.0 40 1609.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.41927409261577 25.481852315394242 8.760951188986233 30.337922403003752 2 18.05 27.575 37.9 16.475 3 15.725 28.499999999999996 35.55 20.225 4 21.425 34.050000000000004 26.075 18.45 5 23.0 39.65 21.5 15.85 6 17.9 38.725 25.6 17.775 7 20.95 22.825 36.675000000000004 19.55 8 16.625 24.05 34.699999999999996 24.625 9 20.325 24.65 32.15 22.875 10-14 22.96 28.535 26.979999999999997 21.525 15-19 22.46 28.23 28.235 21.075 20-24 21.82 28.49 28.249999999999996 21.44 25-29 22.775000000000002 29.615000000000002 27.235 20.375 30-34 22.259999999999998 28.725 27.98 21.035 35-39 22.11 28.555000000000003 28.349999999999998 20.985 40-44 22.52 28.285 28.29 20.905 45-49 22.99 28.15 28.33 20.53 50-54 23.02 28.499999999999996 27.22 21.26 55-59 22.75 28.24 28.499999999999996 20.51 60-64 22.66 28.910000000000004 27.93 20.5 65-69 23.169999999999998 28.449999999999996 27.6 20.78 70-74 23.345 28.725 27.185 20.745 75-79 23.474999999999998 28.425 27.765 20.335 80-84 22.79 28.48 27.845 20.885 85-89 22.685 27.935 28.965000000000003 20.415 90-94 22.85 28.42 27.855 20.875 95-99 23.189999999999998 27.935 28.249999999999996 20.625 100-104 23.505000000000003 27.855 27.485 21.154999999999998 105-109 23.369999999999997 27.98 28.49 20.16 110-114 23.21 28.225 28.189999999999998 20.375 115-119 23.015 28.575 27.825 20.585 120-124 23.605 28.249999999999996 28.255000000000003 19.89 125-129 23.505000000000003 27.694999999999997 27.785 21.015 130-134 23.54 28.405 27.575 20.48 135-139 23.415 28.18 27.73 20.674999999999997 140-144 23.785 28.095 27.894999999999996 20.225 145-149 23.695 28.42 27.54 20.345 150 24.95 27.925 28.1 19.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 3.0 26 4.5 27 5.5 28 7.0 29 14.5 30 18.5 31 23.0 32 29.5 33 38.5 34 58.5 35 78.0 36 95.5 37 109.5 38 146.5 39 183.0 40 204.5 41 258.5 42 282.0 43 272.5 44 296.5 45 292.0 46 270.5 47 261.0 48 226.5 49 186.5 50 156.0 51 117.5 52 78.5 53 61.0 54 49.0 55 37.0 56 26.0 57 23.5 58 21.0 59 14.5 60 12.0 61 6.5 62 2.5 63 2.0 64 1.0 65 1.0 66 2.5 67 2.5 68 1.0 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 96.51767151767152 92.85 2 3.1964656964656966 6.15 3 0.2079002079002079 0.6 4 0.02598752598752599 0.1 5 0.02598752598752599 0.125 6 0.0 0.0 7 0.02598752598752599 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCTC 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.9125000000000001 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4249999999999998 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGGT 10 0.006973645 144.0 8 TTTTCTC 30 0.0018473949 72.0 2 >>END_MODULE Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra Read 882840 spots for SRR14639608.sra Written 882840 spots for SRR14639608.sra SRR ids: ['SRR14639608.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_24h7rx5j SRR14639608.sra spots: 17656800 blocks: [[1, 882840], [882841, 1765680], [1765681, 2648520], [2648521, 3531360], [3531361, 4414200], [4414201, 5297040], [5297041, 6179880], [6179881, 7062720], [7062721, 7945560], [7945561, 8828400], [8828401, 9711240], [9711241, 10594080], [10594081, 11476920], [11476921, 12359760], [12359761, 13242600], [13242601, 14125440], [14125441, 15008280], [15008281, 15891120], [15891121, 16773960], [16773961, 17656800]] SRR14639608 file size 6533487 SRR14639608 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639608 SRR14639608_1.fastq SRR14639608_2.fastq Input file: SRR14639608_1.fastq Paired file: SRR14639608_2.fastq trimmed: SRR14639608-trimmed-pair1.fastq, SRR14639608-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:26:54 2025 >> started Mon Feb 10 12:27:23 2025 >> done (29.027s) 17656800 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 167 ( 0.00%) empty read pairs filtered out after trimming by size control 17656607 (100.00%) read pairs available; of these: 851295 ( 4.82%) trimmed read pairs available after processing 16805312 (95.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 14 0.00% 21 11 0.00% 22 12 0.00% 23 9 0.00% 24 15 0.00% 25 12 0.00% 26 14 0.00% 27 21 0.00% 28 10 0.00% 29 18 0.00% 30 20 0.00% 31 21 0.00% 32 31 0.00% 33 35 0.00% 34 41 0.00% 35 43 0.00% 36 37 0.00% 37 23 0.00% 38 40 0.00% 39 43 0.00% 40 46 0.00% 41 53 0.00% 42 72 0.00% 43 72 0.00% 44 66 0.00% 45 75 0.00% 46 79 0.00% 47 78 0.00% 48 106 0.00% 49 106 0.00% 50 118 0.00% 51 130 0.00% 52 133 0.00% 53 140 0.00% 54 138 0.00% 55 156 0.00% 56 148 0.00% 57 171 0.00% 58 198 0.00% 59 199 0.00% 60 221 0.00% 61 238 0.00% 62 236 0.00% 63 269 0.00% 64 248 0.00% 65 261 0.00% 66 276 0.00% 67 319 0.00% 68 319 0.00% 69 362 0.00% 70 398 0.00% 71 443 0.00% 72 476 0.00% 73 450 0.00% 74 504 0.00% 75 574 0.00% 76 510 0.00% 77 638 0.00% 78 673 0.00% 79 659 0.00% 80 715 0.00% 81 752 0.00% 82 851 0.00% 83 902 0.01% 84 1001 0.01% 85 1088 0.01% 86 1074 0.01% 87 1138 0.01% 88 1228 0.01% 89 1217 0.01% 90 1305 0.01% 91 1450 0.01% 92 1480 0.01% 93 1683 0.01% 94 1782 0.01% 95 1881 0.01% 96 1991 0.01% 97 2077 0.01% 98 2223 0.01% 99 2489 0.01% 100 2645 0.01% 101 2621 0.01% 102 2976 0.02% 103 3064 0.02% 104 3370 0.02% 105 3547 0.02% 106 3670 0.02% 107 3761 0.02% 108 4125 0.02% 109 4226 0.02% 110 4544 0.03% 111 4908 0.03% 112 5081 0.03% 113 5497 0.03% 114 5816 0.03% 115 6231 0.04% 116 6407 0.04% 117 7034 0.04% 118 7305 0.04% 119 7594 0.04% 120 8375 0.05% 121 8397 0.05% 122 8968 0.05% 123 9530 0.05% 124 10024 0.06% 125 10310 0.06% 126 11078 0.06% 127 11929 0.07% 128 12250 0.07% 129 12809 0.07% 130 13604 0.08% 131 13701 0.08% 132 14798 0.08% 133 15185 0.09% 134 15656 0.09% 135 16715 0.09% 136 17498 0.10% 137 18117 0.10% 138 18538 0.10% 139 19653 0.11% 140 20169 0.11% 141 21248 0.12% 142 21701 0.12% 143 22707 0.13% 144 23397 0.13% 145 24458 0.14% 146 25185 0.14% 147 27912 0.16% 148 38413 0.22% 149 225384 1.28% 150 16805312 95.18% 17656607 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=82.13 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=17.0 sequence=CCATCTTCAAGCTG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=4.48 fanout-score-rank=12 prefix-density=0.53 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=76.82 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=13.8 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGGAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR14639608 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:28:17 Started mapping on | Feb 10 12:28:17 Finished on | Feb 10 12:30:50 Mapping speed, Million of reads per hour | 415.45 Number of input reads | 17656607 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16102905 Uniquely mapped reads % | 91.20% Average mapped length | 296.36 Number of splices: Total | 13978227 Number of splices: Annotated (sjdb) | 13661430 Number of splices: GT/AG | 13742613 Number of splices: GC/AG | 177498 Number of splices: AT/AC | 12800 Number of splices: Non-canonical | 45316 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438630 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 31834 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.03% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1115072 1115072 1115072 N_multimapping 438630 438630 438630 N_noFeature 603189 15955081 670777 N_ambiguous 187619 1094 106765 UnstrandedReadsAssigned:15312097 PositiveStrandReadsAssigned:146730 NegativeStrandReadsAssigned:15325363 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639608 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639608-trimmed-pair1.fastq SRR14639608-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,656,607 reads, 15,600,845 reads pseudoaligned [quant] estimated average fragment length: 304.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR14639608.ke.tsv 34699 SRR14639608.se.tsv 87100 total ==> SRR14639608.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1714.82 2587 94.7557 Potri.005G024800.1.v4.1 1035 731.822 476 40.8535 Potri.004G059700.1.v4.1 961 658.205 123 11.7374 Potri.007G009000.2.v4.1 1416 1112.82 0 0 Potri.003G141000.2.v4.1 2943 2639.82 843 20.0577 Potri.016G087400.1.v4.1 270 70.0581 886 794.335 Potri.015G069301.1.v4.1 564 286.025 0 0 Potri.010G195200.1.v4.1 1773 1469.82 84 3.58957 Potri.012G127500.1.v4.1 977 673.998 1790 166.81 ==> SRR14639608.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 327 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 261 SRR14639608 completed mapping pipeline successfully