Starting /dee2/code/volunteer_pipeline.sh SRR14639609 current disk space = 3059063369728 free memory = 1571500548 SRR14639609 SRAfilesize 067b2ca5ed09018bc72b1230a66db0d8 SRR14639609.sra SRR14639609.sra file validated SRR14639609 is paired end SRR14639609 is conventional basespace SRR14639609 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639609_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6725 32.0 32.0 32.0 32.0 32.0 2 31.68 32.0 32.0 32.0 32.0 32.0 3 35.3425 37.0 37.0 37.0 32.0 37.0 4 36.3475 37.0 37.0 37.0 37.0 37.0 5 36.31375 37.0 37.0 37.0 37.0 37.0 6 39.867 41.0 41.0 41.0 37.0 41.0 7 39.98225 41.0 41.0 41.0 37.0 41.0 8 40.15175 41.0 41.0 41.0 37.0 41.0 9 40.289 41.0 41.0 41.0 41.0 41.0 10-14 40.273900000000005 41.0 41.0 41.0 40.2 41.0 15-19 40.27265 41.0 41.0 41.0 39.4 41.0 20-24 40.2068 41.0 41.0 41.0 38.6 41.0 25-29 40.19035 41.0 41.0 41.0 39.4 41.0 30-34 40.05585 41.0 41.0 41.0 37.0 41.0 35-39 39.956599999999995 41.0 41.0 41.0 37.0 41.0 40-44 39.752500000000005 41.0 41.0 41.0 37.0 41.0 45-49 39.51795 41.0 41.0 41.0 37.0 41.0 50-54 39.30615 41.0 41.0 41.0 37.0 41.0 55-59 39.01275 41.0 41.0 41.0 37.0 41.0 60-64 38.74374999999999 41.0 39.4 41.0 34.0 41.0 65-69 38.24305 41.0 37.0 41.0 32.0 41.0 70-74 37.36044999999999 41.0 37.0 41.0 27.0 41.0 75-79 35.17185 37.6 33.0 40.2 25.0 41.0 80-84 36.531 41.0 37.0 41.0 27.0 41.0 85-89 36.427499999999995 41.0 36.0 41.0 27.0 41.0 90-94 36.27975 41.0 36.0 41.0 27.0 41.0 95-99 36.092 41.0 34.0 41.0 24.0 41.0 100-104 36.2412 41.0 37.0 41.0 23.0 41.0 105-109 36.498000000000005 41.0 37.0 41.0 27.0 41.0 110-114 36.751599999999996 41.0 37.0 41.0 27.0 41.0 115-119 37.02425 41.0 37.0 41.0 27.0 41.0 120-124 37.27819999999999 41.0 37.0 41.0 27.0 41.0 125-129 37.619600000000005 41.0 37.0 41.0 28.0 41.0 130-134 37.460750000000004 41.0 37.0 41.0 27.0 41.0 135-139 37.529650000000004 41.0 37.0 41.0 27.0 41.0 140-144 37.54715 41.0 37.0 41.0 27.0 41.0 145-149 37.34835 41.0 37.0 41.0 27.0 41.0 150 37.173 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 5.0 24 5.0 25 14.0 26 15.0 27 34.0 28 44.0 29 35.0 30 54.0 31 73.0 32 97.0 33 74.0 34 128.0 35 158.0 36 225.0 37 327.0 38 578.0 39 1071.0 40 1060.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.107276819204802 12.728182045511376 7.6019004751187795 50.56264066016504 2 14.475 13.875000000000002 44.45 27.200000000000003 3 16.625 18.375 28.825 36.175000000000004 4 22.025 25.95 23.549999999999997 28.475 5 21.825 33.2 26.75 18.224999999999998 6 18.475 34.225 25.8 21.5 7 14.174999999999999 27.675 40.6 17.549999999999997 8 15.075 24.975 37.974999999999994 21.975 9 16.5 24.175 35.325 24.0 10-14 19.24 29.165000000000003 28.194999999999997 23.400000000000002 15-19 19.09 28.46 27.975 24.474999999999998 20-24 19.375 28.555000000000003 28.189999999999998 23.880000000000003 25-29 18.925 28.485 28.439999999999998 24.15 30-34 19.93 28.33 28.15 23.59 35-39 19.305 28.525 28.115000000000002 24.055 40-44 19.35 29.134999999999998 27.87 23.645 45-49 19.02 29.085 27.605 24.29 50-54 19.439999999999998 28.225 28.77 23.565 55-59 19.68 28.615000000000002 28.365000000000002 23.34 60-64 19.155 29.110000000000003 27.589999999999996 24.145 65-69 19.325 28.725 28.060000000000002 23.89 70-74 19.84 28.165000000000003 28.000000000000004 23.995 75-79 19.805 28.65 28.105000000000004 23.44 80-84 19.48 29.520000000000003 27.865000000000002 23.135 85-89 19.96 28.78 27.939999999999998 23.32 90-94 20.064999999999998 28.58 27.900000000000002 23.455000000000002 95-99 19.49 28.465 28.155 23.89 100-104 20.1 28.610000000000003 27.544999999999998 23.745 105-109 19.91099554977749 29.13145657282864 27.40137006850343 23.556177808890443 110-114 19.53 29.015 27.6 23.855 115-119 20.025000000000002 29.03 27.794999999999998 23.150000000000002 120-124 19.925 28.46 27.88 23.735 125-129 19.885 28.904999999999998 27.88 23.330000000000002 130-134 20.605 28.705000000000002 27.52 23.169999999999998 135-139 19.82 28.43 27.58 24.169999999999998 140-144 20.307030703070307 28.397839783978394 27.762776277627765 23.532353235323534 145-149 21.310000000000002 28.435 26.779999999999998 23.474999999999998 150 20.474999999999998 27.975 28.225 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 1.0 23 1.0 24 2.5 25 6.0 26 8.5 27 11.0 28 13.5 29 14.0 30 18.0 31 25.0 32 34.5 33 45.5 34 55.5 35 73.5 36 100.5 37 132.0 38 160.5 39 189.0 40 217.0 41 232.0 42 256.5 43 282.5 44 288.5 45 256.5 46 236.0 47 232.5 48 215.0 49 176.5 50 141.0 51 125.0 52 101.0 53 88.0 54 70.5 55 49.0 56 32.0 57 25.0 58 19.5 59 13.0 60 9.5 61 7.0 62 5.5 63 5.5 64 7.0 65 4.5 66 1.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.20187304890739 92.45 2 3.6160249739854313 6.950000000000001 3 0.15608740894901144 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.026014568158168577 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATG 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.5125 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.2375 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.725 0.0 0.0 0.0 0.0 138 2.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAGAAT 10 0.006973645 144.0 1 >>END_MODULE SRR14639609 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639609_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.725 32.0 32.0 32.0 32.0 32.0 2 30.55375 32.0 32.0 32.0 27.0 32.0 3 34.00375 37.0 32.0 37.0 32.0 37.0 4 35.035 37.0 37.0 37.0 32.0 37.0 5 35.37625 37.0 37.0 37.0 32.0 37.0 6 38.32275 41.0 37.0 41.0 32.0 41.0 7 38.05725 41.0 37.0 41.0 32.0 41.0 8 38.22925 41.0 41.0 41.0 32.0 41.0 9 38.717 41.0 41.0 41.0 32.0 41.0 10-14 38.63590000000001 41.0 41.0 41.0 32.0 41.0 15-19 38.43605 41.0 40.2 41.0 32.0 41.0 20-24 38.1327 41.0 38.6 41.0 32.0 41.0 25-29 37.71235 41.0 37.0 41.0 29.0 41.0 30-34 37.71575 41.0 37.0 41.0 27.0 41.0 35-39 37.85185 41.0 37.0 41.0 28.0 41.0 40-44 37.9427 41.0 37.0 41.0 29.0 41.0 45-49 37.900099999999995 41.0 37.0 41.0 28.0 41.0 50-54 37.75895 41.0 37.0 41.0 28.0 41.0 55-59 37.7456 41.0 37.0 41.0 27.0 41.0 60-64 37.76685 41.0 37.0 41.0 27.0 41.0 65-69 37.52305 41.0 37.0 41.0 27.0 41.0 70-74 37.22365 41.0 37.0 41.0 26.0 41.0 75-79 36.6434 40.2 36.0 41.0 24.0 41.0 80-84 37.5971 41.0 37.0 41.0 27.0 41.0 85-89 37.60335 41.0 37.0 41.0 27.0 41.0 90-94 37.2184 41.0 37.0 41.0 26.0 41.0 95-99 37.391549999999995 41.0 37.0 41.0 27.0 41.0 100-104 37.0604 41.0 37.0 41.0 24.0 41.0 105-109 37.05415 41.0 37.0 41.0 26.0 41.0 110-114 37.0107 41.0 37.0 41.0 24.0 41.0 115-119 36.5733 41.0 37.0 41.0 22.0 41.0 120-124 36.62755 41.0 37.0 41.0 22.0 41.0 125-129 36.1591 41.0 36.0 41.0 22.0 41.0 130-134 36.15155 41.0 37.0 41.0 22.0 41.0 135-139 35.69435 41.0 36.0 41.0 20.0 41.0 140-144 35.34119999999999 41.0 33.0 41.0 20.0 41.0 145-149 35.122299999999996 41.0 35.0 41.0 16.0 41.0 150 34.787 41.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 4.0 16 2.0 17 12.0 18 18.0 19 19.0 20 13.0 21 22.0 22 22.0 23 32.0 24 30.0 25 35.0 26 55.0 27 49.0 28 62.0 29 73.0 30 78.0 31 85.0 32 79.0 33 106.0 34 104.0 35 159.0 36 187.0 37 227.0 38 313.0 39 565.0 40 1647.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.528822055137844 25.68922305764411 7.568922305764411 35.21303258145363 2 19.025 27.35 39.1 14.524999999999999 3 17.4 27.125 32.824999999999996 22.650000000000002 4 22.625 33.375 23.575 20.424999999999997 5 23.724999999999998 36.6 23.9 15.775 6 17.7 37.075 25.074999999999996 20.150000000000002 7 19.375 21.175 38.95 20.5 8 17.25 23.549999999999997 34.1 25.1 9 20.0 24.975 31.624999999999996 23.400000000000002 10-14 22.535 28.22 27.83 21.415 15-19 22.470000000000002 27.655 28.185 21.69 20-24 22.24 27.76 28.26 21.740000000000002 25-29 22.055 28.88 28.09 20.974999999999998 30-34 22.55 28.610000000000003 27.905 20.935000000000002 35-39 22.33 28.144999999999996 28.444999999999997 21.08 40-44 22.264999999999997 28.54 28.04 21.154999999999998 45-49 22.31 28.71 27.900000000000002 21.08 50-54 22.505 28.410000000000004 28.435 20.65 55-59 23.265 28.01 27.88 20.845 60-64 22.535 28.7 27.87 20.895 65-69 22.86 27.900000000000002 28.34 20.9 70-74 22.64 28.175 28.225 20.96 75-79 23.25 27.715 28.175 20.86 80-84 23.13 27.839999999999996 27.975 21.055 85-89 22.695 28.74 28.005000000000003 20.560000000000002 90-94 23.225 27.700000000000003 28.685 20.39 95-99 22.84 28.804999999999996 28.34 20.015 100-104 23.31 27.650000000000002 28.33 20.71 105-109 23.474999999999998 28.03 27.744999999999997 20.75 110-114 23.07 28.945 27.825 20.16 115-119 23.535 28.335 27.634999999999998 20.495 120-124 23.86 27.939999999999998 27.195000000000004 21.005 125-129 23.98 28.27 27.075 20.674999999999997 130-134 23.48 28.15 28.084999999999997 20.285 135-139 23.65 28.62 26.950000000000003 20.78 140-144 23.89 27.860000000000003 27.779999999999998 20.47 145-149 24.235 28.74 26.605 20.419999999999998 150 23.875 28.249999999999996 26.974999999999998 20.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 1.5 23 2.0 24 3.0 25 5.0 26 8.5 27 9.5 28 11.5 29 15.0 30 14.5 31 22.5 32 31.5 33 38.5 34 50.0 35 70.5 36 102.5 37 125.0 38 156.0 39 203.5 40 235.0 41 249.0 42 249.0 43 264.0 44 278.5 45 262.5 46 253.0 47 239.5 48 209.5 49 183.0 50 152.5 51 127.0 52 95.0 53 71.0 54 58.5 55 41.5 56 40.5 57 32.5 58 24.0 59 14.5 60 9.0 61 11.0 62 7.5 63 3.0 64 4.0 65 4.0 66 1.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.7 #Duplication Level Percentage of deduplicated Percentage of total 1 96.794208893485 93.60000000000001 2 3.050672182006205 5.8999999999999995 3 0.12926577042399173 0.375 4 0.0 0.0 5 0.02585315408479835 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCTC 5 0.125 Illumina Single End PCR Primer 1 (96% over 31bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.65 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.0374999999999996 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.5 0.0 0.0 0.0 0.0 138 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931042 spots for SRR14639609.sra Written 931042 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra Read 931028 spots for SRR14639609.sra Written 931028 spots for SRR14639609.sra SRR ids: ['SRR14639609.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z9lulud0 SRR14639609.sra spots: 18620574 blocks: [[1, 931028], [931029, 1862056], [1862057, 2793084], [2793085, 3724112], [3724113, 4655140], [4655141, 5586168], [5586169, 6517196], [6517197, 7448224], [7448225, 8379252], [8379253, 9310280], [9310281, 10241308], [10241309, 11172336], [11172337, 12103364], [12103365, 13034392], [13034393, 13965420], [13965421, 14896448], [14896449, 15827476], [15827477, 16758504], [16758505, 17689532], [17689533, 18620574]] SRR14639609 file size 6890689 SRR14639609 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639609 SRR14639609_1.fastq SRR14639609_2.fastq Input file: SRR14639609_1.fastq Paired file: SRR14639609_2.fastq trimmed: SRR14639609-trimmed-pair1.fastq, SRR14639609-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:32:18 2025 >> started Mon Feb 10 13:32:45 2025 >> done (27.644s) 18620574 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 196 ( 0.00%) empty read pairs filtered out after trimming by size control 18620360 (100.00%) read pairs available; of these: 1177448 ( 6.32%) trimmed read pairs available after processing 17442912 (93.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 5 0.00% 21 8 0.00% 22 10 0.00% 23 7 0.00% 24 9 0.00% 25 16 0.00% 26 10 0.00% 27 15 0.00% 28 27 0.00% 29 12 0.00% 30 14 0.00% 31 18 0.00% 32 21 0.00% 33 17 0.00% 34 22 0.00% 35 32 0.00% 36 47 0.00% 37 35 0.00% 38 62 0.00% 39 50 0.00% 40 40 0.00% 41 65 0.00% 42 56 0.00% 43 67 0.00% 44 86 0.00% 45 81 0.00% 46 77 0.00% 47 82 0.00% 48 90 0.00% 49 123 0.00% 50 125 0.00% 51 126 0.00% 52 154 0.00% 53 129 0.00% 54 176 0.00% 55 181 0.00% 56 187 0.00% 57 207 0.00% 58 215 0.00% 59 223 0.00% 60 273 0.00% 61 310 0.00% 62 298 0.00% 63 364 0.00% 64 335 0.00% 65 381 0.00% 66 400 0.00% 67 489 0.00% 68 450 0.00% 69 518 0.00% 70 539 0.00% 71 573 0.00% 72 617 0.00% 73 672 0.00% 74 749 0.00% 75 727 0.00% 76 825 0.00% 77 807 0.00% 78 940 0.01% 79 984 0.01% 80 1026 0.01% 81 1099 0.01% 82 1186 0.01% 83 1280 0.01% 84 1428 0.01% 85 1583 0.01% 86 1615 0.01% 87 1662 0.01% 88 1753 0.01% 89 1874 0.01% 90 1927 0.01% 91 2171 0.01% 92 2367 0.01% 93 2549 0.01% 94 2738 0.01% 95 2824 0.02% 96 3113 0.02% 97 3284 0.02% 98 3526 0.02% 99 3656 0.02% 100 3805 0.02% 101 4147 0.02% 102 4523 0.02% 103 4833 0.03% 104 5054 0.03% 105 5459 0.03% 106 5863 0.03% 107 6231 0.03% 108 6701 0.04% 109 7034 0.04% 110 7338 0.04% 111 7946 0.04% 112 8274 0.04% 113 8583 0.05% 114 9319 0.05% 115 9781 0.05% 116 10524 0.06% 117 11133 0.06% 118 11784 0.06% 119 12154 0.07% 120 12903 0.07% 121 13615 0.07% 122 14149 0.08% 123 15176 0.08% 124 15984 0.09% 125 16849 0.09% 126 17744 0.10% 127 18331 0.10% 128 19082 0.10% 129 20047 0.11% 130 20832 0.11% 131 21907 0.12% 132 22480 0.12% 133 23245 0.12% 134 24338 0.13% 135 25758 0.14% 136 26505 0.14% 137 27472 0.15% 138 28734 0.15% 139 29634 0.16% 140 30767 0.17% 141 31682 0.17% 142 33081 0.18% 143 33595 0.18% 144 34841 0.19% 145 35856 0.19% 146 36945 0.20% 147 39542 0.21% 148 49361 0.27% 149 229662 1.23% 150 17442912 93.68% 18620360 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=15 prefix-density=0.24 prefix-fanout=3.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=19.51 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=6.9 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=27 prefix-density=0.33 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=334.32 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=33.1 sequence=AAGAAGAAGAAA SRR14639609 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:33:34 Started mapping on | Feb 10 13:33:34 Finished on | Feb 10 13:36:43 Mapping speed, Million of reads per hour | 354.67 Number of input reads | 18620360 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16766803 Uniquely mapped reads % | 90.05% Average mapped length | 295.87 Number of splices: Total | 15045260 Number of splices: Annotated (sjdb) | 14693962 Number of splices: GT/AG | 14792081 Number of splices: GC/AG | 192202 Number of splices: AT/AC | 13294 Number of splices: Non-canonical | 47683 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460094 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 45143 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.12% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1393463 1393463 1393463 N_multimapping 460094 460094 460094 N_noFeature 653575 16613445 723208 N_ambiguous 187359 1086 103005 UnstrandedReadsAssigned:15925869 PositiveStrandReadsAssigned:152272 NegativeStrandReadsAssigned:15940590 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639609 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639609-trimmed-pair1.fastq SRR14639609-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,620,360 reads, 16,191,814 reads pseudoaligned [quant] estimated average fragment length: 290.917 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR14639609.ke.tsv 34699 SRR14639609.se.tsv 87100 total ==> SRR14639609.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.08 2345.6 83.5495 Potri.005G024800.1.v4.1 1035 745.083 384 31.7235 Potri.004G059700.1.v4.1 961 671.32 144 13.2035 Potri.007G009000.2.v4.1 1416 1126.08 0 0 Potri.003G141000.2.v4.1 2943 2653.08 858 19.9063 Potri.016G087400.1.v4.1 270 74.781 1020 839.584 Potri.015G069301.1.v4.1 564 295.847 0 0 Potri.010G195200.1.v4.1 1773 1483.08 69 2.86377 Potri.012G127500.1.v4.1 977 687.215 1506 134.892 ==> SRR14639609.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 322 SRR14639609 completed mapping pipeline successfully