Starting /dee2/code/volunteer_pipeline.sh SRR14639610 current disk space = 3059083796480 free memory = 1576717936 SRR14639610 SRAfilesize 4244a6c9a1adbed5d307154ebc2a2ac9 SRR14639610.sra SRR14639610.sra file validated SRR14639610 is paired end SRR14639610 is conventional basespace SRR14639610 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639610_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71375 32.0 32.0 32.0 32.0 32.0 2 31.53375 32.0 32.0 32.0 32.0 32.0 3 35.21375 37.0 32.0 37.0 32.0 37.0 4 36.01 37.0 37.0 37.0 32.0 37.0 5 36.21125 37.0 37.0 37.0 37.0 37.0 6 39.82575 41.0 41.0 41.0 37.0 41.0 7 39.8785 41.0 41.0 41.0 37.0 41.0 8 40.27775 41.0 41.0 41.0 37.0 41.0 9 40.1375 41.0 41.0 41.0 37.0 41.0 10-14 40.160450000000004 41.0 41.0 41.0 37.8 41.0 15-19 40.2205 41.0 41.0 41.0 37.8 41.0 20-24 40.204449999999994 41.0 41.0 41.0 37.8 41.0 25-29 40.1776 41.0 41.0 41.0 38.6 41.0 30-34 40.17535 41.0 41.0 41.0 39.4 41.0 35-39 40.05 41.0 41.0 41.0 37.8 41.0 40-44 40.070049999999995 41.0 41.0 41.0 37.0 41.0 45-49 40.08155000000001 41.0 41.0 41.0 37.0 41.0 50-54 39.93065 41.0 41.0 41.0 37.0 41.0 55-59 39.8912 41.0 41.0 41.0 37.0 41.0 60-64 39.79915 41.0 41.0 41.0 37.0 41.0 65-69 39.74305 41.0 41.0 41.0 37.0 41.0 70-74 39.533 41.0 41.0 41.0 37.0 41.0 75-79 39.0886 41.0 40.2 41.0 36.0 41.0 80-84 39.5749 41.0 41.0 41.0 37.0 41.0 85-89 39.55045 41.0 41.0 41.0 37.0 41.0 90-94 39.445499999999996 41.0 41.0 41.0 37.0 41.0 95-99 39.3803 41.0 41.0 41.0 37.0 41.0 100-104 39.31315 41.0 41.0 41.0 37.0 41.0 105-109 39.26595 41.0 41.0 41.0 37.0 41.0 110-114 39.2513 41.0 41.0 41.0 37.0 41.0 115-119 39.17139999999999 41.0 41.0 41.0 37.0 41.0 120-124 39.142799999999994 41.0 41.0 41.0 37.0 41.0 125-129 39.20354999999999 41.0 41.0 41.0 37.0 41.0 130-134 38.83389999999999 41.0 41.0 41.0 33.0 41.0 135-139 38.666399999999996 41.0 41.0 41.0 32.0 41.0 140-144 38.330400000000004 41.0 39.4 41.0 32.0 41.0 145-149 38.09305 41.0 37.0 41.0 32.0 41.0 150 38.10425 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 5.0 24 4.0 25 6.0 26 8.0 27 9.0 28 17.0 29 20.0 30 26.0 31 31.0 32 36.0 33 46.0 34 59.0 35 85.0 36 126.0 37 163.0 38 239.0 39 525.0 40 2592.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.225 12.85 13.325000000000001 41.6 2 13.8 12.2 42.675000000000004 31.324999999999996 3 15.85 18.825 30.049999999999997 35.275 4 21.975 27.6 25.15 25.275 5 22.1 30.775000000000002 27.925 19.2 6 16.1 33.125 28.775000000000002 22.0 7 13.8 27.6 40.2 18.4 8 14.099999999999998 23.45 37.45 25.0 9 16.075 25.724999999999998 35.325 22.875 10-14 19.064999999999998 28.845 28.499999999999996 23.59 15-19 18.81 28.515 28.144999999999996 24.529999999999998 20-24 18.7 28.544999999999998 28.110000000000003 24.645 25-29 19.425 28.21 28.23 24.135 30-34 19.485 28.395 27.950000000000003 24.169999999999998 35-39 19.275000000000002 28.74 27.83 24.154999999999998 40-44 19.345000000000002 28.075 28.754999999999995 23.825 45-49 20.015 28.165000000000003 27.975 23.845 50-54 19.39 28.175 28.255000000000003 24.18 55-59 19.314999999999998 28.13 28.65 23.905 60-64 19.355 27.950000000000003 28.294999999999998 24.4 65-69 19.45 28.585 27.650000000000002 24.315 70-74 20.54 28.144999999999996 27.575 23.74 75-79 19.93 28.065 27.715 24.29 80-84 19.96 28.305000000000003 27.18 24.555 85-89 20.135 28.42 27.339999999999996 24.104999999999997 90-94 20.1 27.825 28.215 23.86 95-99 19.535 28.395 28.155 23.915 100-104 20.235 27.755000000000003 28.000000000000004 24.01 105-109 20.161008050402522 28.121406070303518 27.76138806940347 23.956197809890494 110-114 20.544999999999998 27.500000000000004 27.810000000000002 24.145 115-119 20.380000000000003 28.244999999999997 27.36 24.015 120-124 20.715 27.644999999999996 27.560000000000002 24.08 125-129 19.835 27.825 27.665 24.675 130-134 20.615 28.095 27.595 23.695 135-139 20.11 27.865000000000002 27.584999999999997 24.44 140-144 20.84021005251313 27.35683920980245 27.521880470117527 24.281070267566893 145-149 20.49 27.76 27.92 23.830000000000002 150 19.900000000000002 27.625 26.900000000000002 25.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.5 24 2.0 25 5.0 26 10.0 27 15.5 28 17.0 29 17.5 30 20.0 31 28.0 32 43.0 33 49.0 34 51.5 35 77.5 36 108.0 37 113.0 38 136.5 39 183.5 40 202.5 41 237.0 42 261.5 43 251.0 44 255.5 45 249.0 46 239.0 47 227.5 48 205.5 49 191.5 50 161.5 51 123.0 52 102.0 53 88.0 54 61.5 55 44.0 56 39.0 57 34.0 58 27.5 59 19.0 60 19.0 61 15.0 62 12.0 63 10.5 64 8.5 65 7.0 66 5.5 67 2.5 68 2.0 69 3.0 70 2.0 71 1.0 72 1.5 73 1.5 74 1.0 75 2.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.025 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 94.89687995769435 89.725 2 4.547858276044421 8.6 3 0.47593865679534636 1.35 4 0.052882072977260705 0.2 5 0.026441036488630353 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.05 0.0 70-71 0.025 0.0 0.0 0.05 0.0 72-73 0.025 0.0 0.0 0.05 0.0 74-75 0.025 0.0 0.0 0.05 0.0 76-77 0.025 0.0 0.0 0.05 0.0 78-79 0.025 0.0 0.0 0.05 0.0 80-81 0.025 0.0 0.0 0.05 0.0 82-83 0.025 0.0 0.0 0.05 0.0 84-85 0.025 0.0 0.0 0.05 0.0 86-87 0.025 0.0 0.0 0.05 0.0 88-89 0.025 0.0 0.0 0.05 0.0 90-91 0.025 0.0 0.0 0.05 0.0 92-93 0.025 0.0 0.0 0.05 0.0 94-95 0.05 0.0 0.0 0.05 0.0 96-97 0.05 0.0 0.0 0.05 0.0 98-99 0.05 0.0 0.0 0.05 0.0 100-101 0.05 0.0 0.0 0.05 0.0 102-103 0.05 0.0 0.0 0.05 0.0 104-105 0.05 0.0 0.0 0.05 0.0 106-107 0.05 0.0 0.0 0.05 0.0 108-109 0.075 0.0 0.0 0.05 0.0 110-111 0.075 0.0 0.0 0.05 0.0 112-113 0.075 0.0 0.0 0.05 0.0 114-115 0.0875 0.0 0.0 0.05 0.0 116-117 0.1 0.0 0.0 0.05 0.0 118-119 0.125 0.0 0.0 0.05 0.0 120-121 0.175 0.0 0.0 0.05 0.0 122-123 0.175 0.0 0.0 0.05 0.0 124-125 0.175 0.0 0.0 0.05 0.0 126-127 0.175 0.0 0.0 0.05 0.0 128-129 0.175 0.0 0.0 0.05 0.0 130-131 0.175 0.0 0.0 0.05 0.0 132-133 0.1875 0.0 0.0 0.05 0.0 134-135 0.2375 0.0 0.0 0.05 0.0 136-137 0.25 0.0 0.0 0.05 0.0 138 0.25 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGCT 10 0.006973645 144.0 3 >>END_MODULE SRR14639610 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639610_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.75125 32.0 32.0 32.0 32.0 32.0 2 30.64 32.0 32.0 32.0 27.0 32.0 3 33.4925 37.0 32.0 37.0 27.0 37.0 4 34.48625 37.0 37.0 37.0 32.0 37.0 5 35.06 37.0 37.0 37.0 32.0 37.0 6 38.0785 41.0 37.0 41.0 32.0 41.0 7 37.9225 41.0 37.0 41.0 32.0 41.0 8 38.238 41.0 41.0 41.0 32.0 41.0 9 38.2405 41.0 41.0 41.0 32.0 41.0 10-14 38.4559 41.0 41.0 41.0 32.0 41.0 15-19 38.157700000000006 41.0 40.2 41.0 31.0 41.0 20-24 37.98665 41.0 39.4 41.0 29.0 41.0 25-29 37.687200000000004 41.0 37.0 41.0 29.0 41.0 30-34 37.63815 41.0 37.0 41.0 27.0 41.0 35-39 37.55265 41.0 37.0 41.0 27.0 41.0 40-44 37.398300000000006 41.0 37.0 41.0 27.0 41.0 45-49 37.19685 41.0 37.0 41.0 27.0 41.0 50-54 37.06675 41.0 37.0 41.0 27.0 41.0 55-59 37.169200000000004 41.0 37.0 41.0 27.0 41.0 60-64 36.94325 41.0 37.0 41.0 27.0 41.0 65-69 36.6866 41.0 37.0 41.0 24.0 41.0 70-74 36.50405 41.0 37.0 41.0 23.0 41.0 75-79 35.8164 40.2 35.0 41.0 22.0 41.0 80-84 36.700450000000004 41.0 37.0 41.0 22.0 41.0 85-89 36.7677 41.0 37.0 41.0 23.0 41.0 90-94 36.39665000000001 41.0 37.0 41.0 22.0 41.0 95-99 36.512249999999995 41.0 37.0 41.0 22.0 41.0 100-104 36.20685 41.0 37.0 41.0 22.0 41.0 105-109 36.17655 41.0 37.0 41.0 22.0 41.0 110-114 36.10105 41.0 37.0 41.0 22.0 41.0 115-119 35.7707 41.0 35.0 41.0 20.0 41.0 120-124 35.850449999999995 41.0 36.0 41.0 22.0 41.0 125-129 35.1913 41.0 34.0 41.0 18.0 41.0 130-134 35.2969 41.0 32.0 41.0 22.0 41.0 135-139 34.89555 41.0 32.0 41.0 18.0 41.0 140-144 34.53725 41.0 32.0 41.0 14.0 41.0 145-149 34.37035000000001 40.2 31.0 41.0 12.0 41.0 150 34.0425 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 6.0 16 8.0 17 16.0 18 24.0 19 25.0 20 18.0 21 27.0 22 44.0 23 37.0 24 42.0 25 49.0 26 61.0 27 58.0 28 50.0 29 64.0 30 85.0 31 89.0 32 118.0 33 116.0 34 129.0 35 168.0 36 196.0 37 249.0 38 337.0 39 625.0 40 1357.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.229265848158356 25.808068153345026 11.250313204710599 27.712352793786017 2 19.225 27.05 37.8 15.925 3 16.85 26.150000000000002 36.65 20.349999999999998 4 23.200000000000003 32.75 24.575 19.475 5 23.599999999999998 38.375 22.975 15.049999999999999 6 18.125 35.85 26.1 19.925 7 19.900000000000002 22.7 37.375 20.025000000000002 8 16.125 23.95 33.85 26.075 9 20.775 25.35 31.35 22.525000000000002 10-14 22.28 28.68 26.93 22.11 15-19 22.74 27.66 28.144999999999996 21.455 20-24 22.765 28.194999999999997 28.144999999999996 20.895 25-29 22.56 28.42 28.16 20.86 30-34 22.41 28.16 27.87 21.560000000000002 35-39 22.605 28.055000000000003 27.860000000000003 21.48 40-44 23.080000000000002 28.775000000000002 27.229999999999997 20.915 45-49 23.225 28.255000000000003 27.944999999999997 20.575 50-54 22.585 28.599999999999998 27.99 20.825 55-59 23.294999999999998 27.884999999999998 27.805000000000003 21.015 60-64 22.78 27.85 27.82 21.55 65-69 22.42 28.42 28.235 20.925 70-74 23.119999999999997 27.169999999999998 27.334999999999997 22.375 75-79 23.565 27.794999999999998 27.33 21.310000000000002 80-84 23.375 27.634999999999998 27.544999999999998 21.445 85-89 23.31 27.665 27.534999999999997 21.490000000000002 90-94 23.54 27.71 27.525 21.224999999999998 95-99 23.655 27.74 27.310000000000002 21.295 100-104 23.825 27.779999999999998 27.32 21.075 105-109 23.785 28.13 26.93 21.154999999999998 110-114 23.150000000000002 28.54 26.765 21.545 115-119 24.349999999999998 27.529999999999998 27.445000000000004 20.674999999999997 120-124 23.775 27.994999999999997 27.105 21.125 125-129 23.74 27.67 27.650000000000002 20.94 130-134 23.7 27.534999999999997 27.685 21.08 135-139 23.805 27.750000000000004 27.47 20.974999999999998 140-144 23.71 27.965 27.04 21.285 145-149 24.26 27.705000000000002 26.82 21.215 150 23.7 25.874999999999996 28.449999999999996 21.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.5 20 2.0 21 0.5 22 1.0 23 3.0 24 2.5 25 4.0 26 7.0 27 8.5 28 11.5 29 13.5 30 22.5 31 30.0 32 36.0 33 40.0 34 50.5 35 84.0 36 106.5 37 117.0 38 139.5 39 169.5 40 201.5 41 236.0 42 246.0 43 250.5 44 252.5 45 242.5 46 250.5 47 225.5 48 199.5 49 184.0 50 147.5 51 122.0 52 115.0 53 97.5 54 71.0 55 63.0 56 52.0 57 41.5 58 33.0 59 23.0 60 17.5 61 14.5 62 14.0 63 9.5 64 3.5 65 3.0 66 3.5 67 4.0 68 4.0 69 3.5 70 2.0 71 2.5 72 2.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 2.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.87036069001567 91.7 2 3.8159958180867743 7.3 3 0.26136957658128596 0.75 4 0.0 0.0 5 0.052273915316257184 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCGGGACTACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAA 5 0.125 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.0875 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.225 0.0 0.0 0.0 0.0 132-133 0.225 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 0.275 0.0 0.0 0.0 0.0 138 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991278 spots for SRR14639610.sra Written 991278 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra Read 991273 spots for SRR14639610.sra Written 991273 spots for SRR14639610.sra SRR ids: ['SRR14639610.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a9aligkl SRR14639610.sra spots: 19825465 blocks: [[1, 991273], [991274, 1982546], [1982547, 2973819], [2973820, 3965092], [3965093, 4956365], [4956366, 5947638], [5947639, 6938911], [6938912, 7930184], [7930185, 8921457], [8921458, 9912730], [9912731, 10904003], [10904004, 11895276], [11895277, 12886549], [12886550, 13877822], [13877823, 14869095], [14869096, 15860368], [15860369, 16851641], [16851642, 17842914], [17842915, 18834187], [18834188, 19825465]] SRR14639610 file size 7337248 SRR14639610 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639610 SRR14639610_1.fastq SRR14639610_2.fastq Input file: SRR14639610_1.fastq Paired file: SRR14639610_2.fastq trimmed: SRR14639610-trimmed-pair1.fastq, SRR14639610-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:40:48 2025 >> started Mon Feb 10 13:41:12 2025 >> done (24.193s) 19825465 read pairs processed; of these: 82 ( 0.00%) short read pairs filtered out after trimming by size control 29 ( 0.00%) empty read pairs filtered out after trimming by size control 19825354 (100.00%) read pairs available; of these: 404164 ( 2.04%) trimmed read pairs available after processing 19421190 (97.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 23 0.00% 20 19 0.00% 21 20 0.00% 22 15 0.00% 23 26 0.00% 24 28 0.00% 25 30 0.00% 26 37 0.00% 27 32 0.00% 28 38 0.00% 29 34 0.00% 30 40 0.00% 31 40 0.00% 32 45 0.00% 33 47 0.00% 34 46 0.00% 35 38 0.00% 36 57 0.00% 37 54 0.00% 38 71 0.00% 39 48 0.00% 40 61 0.00% 41 60 0.00% 42 67 0.00% 43 70 0.00% 44 61 0.00% 45 71 0.00% 46 73 0.00% 47 64 0.00% 48 84 0.00% 49 91 0.00% 50 85 0.00% 51 79 0.00% 52 54 0.00% 53 74 0.00% 54 89 0.00% 55 120 0.00% 56 114 0.00% 57 103 0.00% 58 112 0.00% 59 115 0.00% 60 120 0.00% 61 119 0.00% 62 116 0.00% 63 144 0.00% 64 130 0.00% 65 133 0.00% 66 143 0.00% 67 139 0.00% 68 156 0.00% 69 170 0.00% 70 198 0.00% 71 185 0.00% 72 193 0.00% 73 184 0.00% 74 175 0.00% 75 211 0.00% 76 197 0.00% 77 228 0.00% 78 237 0.00% 79 237 0.00% 80 243 0.00% 81 252 0.00% 82 273 0.00% 83 270 0.00% 84 302 0.00% 85 313 0.00% 86 304 0.00% 87 322 0.00% 88 333 0.00% 89 361 0.00% 90 373 0.00% 91 409 0.00% 92 407 0.00% 93 437 0.00% 94 418 0.00% 95 425 0.00% 96 473 0.00% 97 492 0.00% 98 517 0.00% 99 591 0.00% 100 574 0.00% 101 594 0.00% 102 664 0.00% 103 643 0.00% 104 700 0.00% 105 745 0.00% 106 786 0.00% 107 800 0.00% 108 863 0.00% 109 853 0.00% 110 814 0.00% 111 915 0.00% 112 967 0.00% 113 892 0.00% 114 1025 0.01% 115 1075 0.01% 116 1146 0.01% 117 1136 0.01% 118 1144 0.01% 119 1238 0.01% 120 1250 0.01% 121 1296 0.01% 122 1356 0.01% 123 1428 0.01% 124 1512 0.01% 125 1579 0.01% 126 1617 0.01% 127 1680 0.01% 128 1841 0.01% 129 1831 0.01% 130 1880 0.01% 131 1934 0.01% 132 2029 0.01% 133 2022 0.01% 134 2068 0.01% 135 2235 0.01% 136 2311 0.01% 137 2225 0.01% 138 2308 0.01% 139 2523 0.01% 140 2446 0.01% 141 2670 0.01% 142 2860 0.01% 143 2822 0.01% 144 2966 0.01% 145 3146 0.02% 146 3539 0.02% 147 5685 0.03% 148 20209 0.10% 149 289949 1.46% 150 19421190 97.96% 19825354 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=65.97 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=15.1 sequence=CCATCTTCAAGCTG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=12 prefix-density=0.53 prefix-fanout=3.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=127.98 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=22.3 sequence=TTCAAGAAAATGG SRR14639610 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:42:33 Started mapping on | Feb 10 13:42:33 Finished on | Feb 10 13:46:24 Mapping speed, Million of reads per hour | 308.97 Number of input reads | 19825354 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16975724 Uniquely mapped reads % | 85.63% Average mapped length | 297.20 Number of splices: Total | 14787626 Number of splices: Annotated (sjdb) | 14480466 Number of splices: GT/AG | 14534544 Number of splices: GC/AG | 191004 Number of splices: AT/AC | 13602 Number of splices: Non-canonical | 48476 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 508308 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 605080 % of reads mapped to too many loci | 3.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.61% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2341322 2341322 2341322 N_multimapping 508308 508308 508308 N_noFeature 561351 16813259 632981 N_ambiguous 211984 1671 120160 UnstrandedReadsAssigned:16202389 PositiveStrandReadsAssigned:160794 NegativeStrandReadsAssigned:16222583 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639610 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639610-trimmed-pair1.fastq SRR14639610-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,825,354 reads, 17,058,129 reads pseudoaligned [quant] estimated average fragment length: 377.902 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52401 SRR14639610.ke.tsv 34699 SRR14639610.se.tsv 87100 total ==> SRR14639610.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1641.1 2877 89.5388 Potri.005G024800.1.v4.1 1035 658.098 198 15.3667 Potri.004G059700.1.v4.1 961 584.648 201 17.5593 Potri.007G009000.2.v4.1 1416 1039.1 0 0 Potri.003G141000.2.v4.1 2943 2566.1 928 18.4706 Potri.016G087400.1.v4.1 270 45.385 952 1071.35 Potri.015G069301.1.v4.1 564 218.88 0 0 Potri.010G195200.1.v4.1 1773 1396.1 87 3.1828 Potri.012G127500.1.v4.1 977 600.368 1392 118.421 ==> SRR14639610.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 493 SRR14639610 completed mapping pipeline successfully