Starting /dee2/code/volunteer_pipeline.sh SRR14639612 current disk space = 3058884132864 free memory = 1335184004 SRR14639612 SRAfilesize 8845178cec686ca408b58e95d6878809 SRR14639612.sra SRR14639612.sra file validated SRR14639612 is paired end SRR14639612 is conventional basespace SRR14639612 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639612_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71 32.0 32.0 32.0 32.0 32.0 2 31.54875 32.0 32.0 32.0 32.0 32.0 3 35.30875 37.0 32.0 37.0 32.0 37.0 4 36.15375 37.0 37.0 37.0 32.0 37.0 5 36.335 37.0 37.0 37.0 37.0 37.0 6 39.85825 41.0 41.0 41.0 37.0 41.0 7 39.85725 41.0 41.0 41.0 37.0 41.0 8 40.24575 41.0 41.0 41.0 37.0 41.0 9 40.2375 41.0 41.0 41.0 37.0 41.0 10-14 40.24025 41.0 41.0 41.0 38.6 41.0 15-19 40.28789999999999 41.0 41.0 41.0 39.4 41.0 20-24 40.22605 41.0 41.0 41.0 39.4 41.0 25-29 40.1594 41.0 41.0 41.0 38.6 41.0 30-34 40.1541 41.0 41.0 41.0 38.6 41.0 35-39 40.0897 41.0 41.0 41.0 37.0 41.0 40-44 40.01375 41.0 41.0 41.0 37.0 41.0 45-49 39.978899999999996 41.0 41.0 41.0 37.0 41.0 50-54 39.9251 41.0 41.0 41.0 37.0 41.0 55-59 39.867900000000006 41.0 41.0 41.0 37.0 41.0 60-64 39.81305 41.0 41.0 41.0 37.0 41.0 65-69 39.64045 41.0 41.0 41.0 37.0 41.0 70-74 39.50619999999999 41.0 41.0 41.0 37.0 41.0 75-79 39.0473 41.0 40.2 41.0 36.0 41.0 80-84 39.535 41.0 41.0 41.0 37.0 41.0 85-89 39.494949999999996 41.0 41.0 41.0 37.0 41.0 90-94 39.39485 41.0 41.0 41.0 37.0 41.0 95-99 39.355650000000004 41.0 41.0 41.0 37.0 41.0 100-104 39.25279999999999 41.0 41.0 41.0 37.0 41.0 105-109 39.1035 41.0 41.0 41.0 37.0 41.0 110-114 39.114650000000005 41.0 41.0 41.0 37.0 41.0 115-119 39.1418 41.0 41.0 41.0 37.0 41.0 120-124 39.06975 41.0 41.0 41.0 37.0 41.0 125-129 39.129099999999994 41.0 41.0 41.0 37.0 41.0 130-134 38.81035 41.0 41.0 41.0 33.0 41.0 135-139 38.44565 41.0 41.0 41.0 32.0 41.0 140-144 38.2072 41.0 37.0 41.0 32.0 41.0 145-149 38.013099999999994 41.0 37.0 41.0 32.0 41.0 150 37.94825 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 1.0 23 5.0 24 3.0 25 5.0 26 10.0 27 10.0 28 14.0 29 21.0 30 24.0 31 34.0 32 40.0 33 41.0 34 63.0 35 108.0 36 114.0 37 155.0 38 272.0 39 503.0 40 2573.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.60865216304076 13.778444611152787 11.677919479869967 39.934983745936485 2 14.549999999999999 12.475 42.725 30.25 3 14.7 17.75 32.225 35.325 4 21.125 26.325 25.224999999999998 27.325 5 20.724999999999998 32.175 27.375 19.725 6 15.725 32.425 30.049999999999997 21.8 7 14.549999999999999 27.125 40.475 17.849999999999998 8 13.825000000000001 23.225 39.5 23.45 9 15.125 24.8 35.275 24.8 10-14 18.93 28.999999999999996 28.854999999999997 23.215 15-19 18.965 28.605000000000004 28.615000000000002 23.815 20-24 18.765 28.810000000000002 28.544999999999998 23.880000000000003 25-29 19.235 28.335 28.525 23.905 30-34 19.355 28.08 28.525 24.04 35-39 18.965 28.599999999999998 28.71 23.724999999999998 40-44 19.43 28.57 28.694999999999997 23.305 45-49 19.435 28.415000000000003 28.65 23.5 50-54 18.915000000000003 29.89 27.29 23.905 55-59 19.235 28.73 28.315 23.72 60-64 19.345000000000002 29.270000000000003 27.77 23.615 65-69 19.64 28.610000000000003 28.265 23.485 70-74 19.75 28.79 27.750000000000004 23.71 75-79 19.34 29.125 27.755000000000003 23.78 80-84 19.6 28.360000000000003 28.005000000000003 24.035 85-89 19.71 28.689999999999998 27.76 23.84 90-94 19.505 28.57 27.775 24.15 95-99 19.8 28.194999999999997 28.235 23.77 100-104 20.05 28.13 27.750000000000004 24.07 105-109 19.775000000000002 28.38 28.645 23.200000000000003 110-114 19.775000000000002 27.37 28.28 24.575 115-119 19.900000000000002 28.43 27.97 23.7 120-124 19.93 28.01 27.865000000000002 24.195 125-129 19.725 27.98 28.24 24.055 130-134 19.994999999999997 28.22 28.005000000000003 23.78 135-139 20.145 28.560000000000002 27.650000000000002 23.645 140-144 20.23101155057753 27.60638031901595 28.146407320366016 24.016200810040502 145-149 19.97 28.17 27.47 24.39 150 20.525 27.474999999999998 27.250000000000004 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 0.0 22 1.5 23 4.0 24 5.5 25 3.5 26 4.5 27 13.5 28 21.0 29 24.5 30 23.5 31 27.0 32 47.0 33 51.0 34 59.0 35 87.5 36 107.0 37 122.0 38 138.5 39 181.0 40 215.0 41 226.0 42 255.5 43 271.5 44 267.0 45 276.5 46 262.0 47 227.0 48 201.0 49 177.0 50 150.5 51 119.5 52 100.0 53 85.0 54 57.0 55 38.5 56 32.0 57 23.0 58 18.5 59 16.0 60 13.5 61 10.5 62 7.5 63 4.5 64 3.5 65 2.0 66 1.5 67 1.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.93937796520822 90.05 2 4.691618344754876 8.9 3 0.36900369003690037 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.05 0.0 0.0 0.0 0.0 132-133 0.05 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.05 0.0 0.0 0.0 0.0 138 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCGCCA 10 0.006973645 144.0 8 >>END_MODULE SRR14639612 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR14639612_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.62 32.0 32.0 32.0 32.0 32.0 2 30.35875 32.0 32.0 32.0 27.0 32.0 3 33.36875 37.0 32.0 37.0 27.0 37.0 4 34.46625 37.0 37.0 37.0 32.0 37.0 5 34.895 37.0 37.0 37.0 32.0 37.0 6 37.6945 41.0 37.0 41.0 32.0 41.0 7 37.67375 41.0 37.0 41.0 32.0 41.0 8 37.87425 41.0 37.0 41.0 27.0 41.0 9 37.959 41.0 37.0 41.0 27.0 41.0 10-14 38.094950000000004 41.0 39.4 41.0 30.0 41.0 15-19 37.83775000000001 41.0 37.0 41.0 28.0 41.0 20-24 37.7832 41.0 37.0 41.0 27.0 41.0 25-29 37.38955 41.0 37.0 41.0 26.0 41.0 30-34 37.26205 41.0 37.0 41.0 27.0 41.0 35-39 37.169399999999996 41.0 37.0 41.0 27.0 41.0 40-44 36.8591 41.0 37.0 41.0 26.0 41.0 45-49 36.82715 41.0 37.0 41.0 27.0 41.0 50-54 36.66105 41.0 37.0 41.0 24.0 41.0 55-59 36.6462 41.0 37.0 41.0 23.0 41.0 60-64 36.61995 41.0 37.0 41.0 23.0 41.0 65-69 36.32475 41.0 37.0 41.0 23.0 41.0 70-74 36.0323 41.0 37.0 41.0 22.0 41.0 75-79 35.27905 40.2 34.0 41.0 22.0 41.0 80-84 36.36650000000001 41.0 37.0 41.0 22.0 41.0 85-89 36.4505 41.0 37.0 41.0 22.0 41.0 90-94 36.099650000000004 41.0 37.0 41.0 22.0 41.0 95-99 36.1135 41.0 37.0 41.0 22.0 41.0 100-104 35.82215 41.0 35.0 41.0 20.0 41.0 105-109 35.770250000000004 41.0 35.0 41.0 22.0 41.0 110-114 35.7903 41.0 33.0 41.0 22.0 41.0 115-119 35.45980000000001 41.0 33.0 41.0 20.0 41.0 120-124 35.50214999999999 41.0 32.0 41.0 22.0 41.0 125-129 34.801 41.0 32.0 41.0 18.0 41.0 130-134 34.8392 41.0 32.0 41.0 18.0 41.0 135-139 34.312 39.4 31.0 41.0 14.0 41.0 140-144 34.05114999999999 37.8 32.0 41.0 12.0 41.0 145-149 33.796049999999994 37.0 31.0 41.0 12.0 41.0 150 33.4135 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 5.0 16 8.0 17 14.0 18 23.0 19 31.0 20 32.0 21 31.0 22 36.0 23 41.0 24 52.0 25 59.0 26 70.0 27 55.0 28 81.0 29 78.0 30 90.0 31 111.0 32 95.0 33 125.0 34 163.0 35 155.0 36 185.0 37 246.0 38 348.0 39 617.0 40 1244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.85047666833919 26.768690416457602 10.361264425489212 27.019568489713997 2 17.775 25.650000000000002 39.35 17.224999999999998 3 15.4 26.025 37.075 21.5 4 21.8 33.7 24.55 19.950000000000003 5 23.674999999999997 36.75 22.975 16.6 6 18.575 36.9 25.25 19.275000000000002 7 18.825 23.95 36.825 20.4 8 18.0 24.25 32.375 25.374999999999996 9 20.45 23.925 32.025 23.599999999999998 10-14 21.855 28.16 27.685 22.3 15-19 22.439999999999998 28.07 28.71 20.78 20-24 21.375 28.349999999999998 28.660000000000004 21.615000000000002 25-29 22.314999999999998 27.810000000000002 28.64 21.235 30-34 22.02 27.29 29.23 21.46 35-39 22.2 28.115000000000002 28.18 21.505 40-44 22.615 28.444999999999997 28.055000000000003 20.885 45-49 22.98 27.169999999999998 28.939999999999998 20.91 50-54 22.41 28.305000000000003 28.38 20.905 55-59 22.884999999999998 28.194999999999997 28.084999999999997 20.835 60-64 23.035 28.244999999999997 28.225 20.495 65-69 22.675 27.74 28.060000000000002 21.525 70-74 23.51 28.185 27.279999999999998 21.025 75-79 23.11 28.02 27.91 20.96 80-84 23.13 28.360000000000003 27.85 20.66 85-89 23.169999999999998 27.83 27.98 21.02 90-94 23.16 27.894999999999996 27.884999999999998 21.060000000000002 95-99 22.75 27.71 28.65 20.89 100-104 23.39 28.12 27.325 21.165 105-109 23.64 28.235 27.245 20.880000000000003 110-114 23.535 27.875 27.744999999999997 20.845 115-119 23.195 28.285 27.310000000000002 21.21 120-124 23.075000000000003 27.83 27.584999999999997 21.51 125-129 23.369999999999997 27.915 27.24 21.475 130-134 23.69 28.599999999999998 27.095000000000002 20.615 135-139 23.455000000000002 27.994999999999997 27.005000000000003 21.545 140-144 23.474999999999998 27.155 28.08 21.29 145-149 23.365 27.825 27.62 21.19 150 23.925 27.950000000000003 28.749999999999996 19.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.5 24 4.5 25 4.5 26 5.0 27 9.0 28 11.5 29 12.0 30 21.5 31 27.0 32 33.5 33 55.5 34 69.5 35 73.0 36 90.5 37 118.0 38 148.5 39 175.5 40 201.0 41 245.0 42 288.5 43 274.0 44 258.0 45 262.5 46 248.0 47 236.0 48 203.0 49 168.0 50 141.0 51 123.0 52 105.5 53 81.0 54 64.5 55 54.5 56 49.0 57 35.0 58 27.5 59 24.0 60 14.0 61 8.0 62 8.0 63 5.5 64 2.0 65 2.0 66 2.0 67 1.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 95.95511482254697 91.925 2 3.731732776617954 7.1499999999999995 3 0.2870563674321503 0.8250000000000001 4 0.026096033402922752 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0125 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.05 0.0 0.0 0.0 0.0 132-133 0.05 0.0 0.0 0.0 0.0 134-135 0.05 0.0 0.0 0.0 0.0 136-137 0.05 0.0 0.0 0.0 0.0 138 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGTC 10 0.006973645 144.0 8 >>END_MODULE Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra Read 926253 spots for SRR14639612.sra Written 926253 spots for SRR14639612.sra SRR ids: ['SRR14639612.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6eviftz8 SRR14639612.sra spots: 18525060 blocks: [[1, 926253], [926254, 1852506], [1852507, 2778759], [2778760, 3705012], [3705013, 4631265], [4631266, 5557518], [5557519, 6483771], [6483772, 7410024], [7410025, 8336277], [8336278, 9262530], [9262531, 10188783], [10188784, 11115036], [11115037, 12041289], [12041290, 12967542], [12967543, 13893795], [13893796, 14820048], [14820049, 15746301], [15746302, 16672554], [16672555, 17598807], [17598808, 18525060]] SRR14639612 file size 6855257 SRR14639612 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR14639612 SRR14639612_1.fastq SRR14639612_2.fastq Input file: SRR14639612_1.fastq Paired file: SRR14639612_2.fastq trimmed: SRR14639612-trimmed-pair1.fastq, SRR14639612-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:05:50 2025 >> started Mon Feb 10 13:06:13 2025 >> done (23.694s) 18525060 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 35 ( 0.00%) empty read pairs filtered out after trimming by size control 18524949 (100.00%) read pairs available; of these: 397704 ( 2.15%) trimmed read pairs available after processing 18127245 (97.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 7 0.00% 20 20 0.00% 21 14 0.00% 22 22 0.00% 23 8 0.00% 24 15 0.00% 25 16 0.00% 26 20 0.00% 27 29 0.00% 28 18 0.00% 29 32 0.00% 30 25 0.00% 31 29 0.00% 32 30 0.00% 33 40 0.00% 34 46 0.00% 35 34 0.00% 36 34 0.00% 37 36 0.00% 38 61 0.00% 39 47 0.00% 40 29 0.00% 41 53 0.00% 42 57 0.00% 43 50 0.00% 44 52 0.00% 45 62 0.00% 46 68 0.00% 47 62 0.00% 48 59 0.00% 49 65 0.00% 50 62 0.00% 51 68 0.00% 52 62 0.00% 53 67 0.00% 54 65 0.00% 55 109 0.00% 56 92 0.00% 57 83 0.00% 58 100 0.00% 59 104 0.00% 60 92 0.00% 61 98 0.00% 62 103 0.00% 63 125 0.00% 64 101 0.00% 65 102 0.00% 66 123 0.00% 67 131 0.00% 68 128 0.00% 69 153 0.00% 70 153 0.00% 71 158 0.00% 72 174 0.00% 73 175 0.00% 74 185 0.00% 75 178 0.00% 76 203 0.00% 77 195 0.00% 78 215 0.00% 79 251 0.00% 80 219 0.00% 81 214 0.00% 82 245 0.00% 83 251 0.00% 84 289 0.00% 85 347 0.00% 86 284 0.00% 87 309 0.00% 88 321 0.00% 89 359 0.00% 90 340 0.00% 91 389 0.00% 92 384 0.00% 93 415 0.00% 94 426 0.00% 95 435 0.00% 96 474 0.00% 97 489 0.00% 98 505 0.00% 99 582 0.00% 100 592 0.00% 101 583 0.00% 102 664 0.00% 103 642 0.00% 104 715 0.00% 105 709 0.00% 106 762 0.00% 107 749 0.00% 108 848 0.00% 109 862 0.00% 110 922 0.00% 111 944 0.01% 112 986 0.01% 113 1013 0.01% 114 1117 0.01% 115 1098 0.01% 116 1196 0.01% 117 1252 0.01% 118 1264 0.01% 119 1282 0.01% 120 1375 0.01% 121 1405 0.01% 122 1521 0.01% 123 1648 0.01% 124 1670 0.01% 125 1649 0.01% 126 1734 0.01% 127 1849 0.01% 128 1812 0.01% 129 1985 0.01% 130 1991 0.01% 131 2103 0.01% 132 2139 0.01% 133 2195 0.01% 134 2191 0.01% 135 2427 0.01% 136 2356 0.01% 137 2454 0.01% 138 2727 0.01% 139 2720 0.01% 140 2840 0.02% 141 2828 0.02% 142 3037 0.02% 143 3112 0.02% 144 3197 0.02% 145 3382 0.02% 146 3908 0.02% 147 6167 0.03% 148 20168 0.11% 149 278624 1.50% 150 18127245 97.85% 18524949 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=0.36 prefix-fanout=1.9 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=18.59 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=2.6 sequence=TTCTCAGCACCGAAGTCCATCTCAGACC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=14 prefix-density=0.50 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=83.20 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=14.0 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGGAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR14639612 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:07:04 Started mapping on | Feb 10 13:07:05 Finished on | Feb 10 13:10:34 Mapping speed, Million of reads per hour | 319.09 Number of input reads | 18524949 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16370486 Uniquely mapped reads % | 88.37% Average mapped length | 297.10 Number of splices: Total | 14252377 Number of splices: Annotated (sjdb) | 13958666 Number of splices: GT/AG | 14013445 Number of splices: GC/AG | 180461 Number of splices: AT/AC | 12909 Number of splices: Non-canonical | 45562 Mismatch rate per base, % | 0.59% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 475237 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 72978 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.46% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1679226 1679226 1679226 N_multimapping 475237 475237 475237 N_noFeature 525928 16230303 584908 N_ambiguous 203858 1093 122060 UnstrandedReadsAssigned:15640700 PositiveStrandReadsAssigned:139090 NegativeStrandReadsAssigned:15663518 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR14639612 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR14639612-trimmed-pair1.fastq SRR14639612-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,524,949 reads, 16,050,122 reads pseudoaligned [quant] estimated average fragment length: 381.905 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 980 rounds 52401 SRR14639612.ke.tsv 34699 SRR14639612.se.tsv 87100 total ==> SRR14639612.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1637.1 2931 99.6109 Potri.005G024800.1.v4.1 1035 654.095 290 24.6673 Potri.004G059700.1.v4.1 961 580.637 143 13.7024 Potri.007G009000.2.v4.1 1416 1035.1 0 0 Potri.003G141000.2.v4.1 2943 2562.1 877 19.0445 Potri.016G087400.1.v4.1 270 47.8378 983 1143.27 Potri.015G069301.1.v4.1 564 218.075 0 0 Potri.010G195200.1.v4.1 1773 1392.1 60 2.39799 Potri.012G127500.1.v4.1 977 596.41 2027 189.092 ==> SRR14639612.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 296 SRR14639612 completed mapping pipeline successfully